ID: 900564751

View in Genome Browser
Species Human (GRCh38)
Location 1:3326778-3326800
Sequence TCAGGCCACGCGGCGGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900564751_900564763 11 Left 900564751 1:3326778-3326800 CCACCAGCCGCCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 900564763 1:3326812-3326834 GGCCGCTTTGTCTCAGGGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 109
900564751_900564766 25 Left 900564751 1:3326778-3326800 CCACCAGCCGCCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 900564766 1:3326826-3326848 AGGGTCAGGAACAGAGAAGGTGG 0: 1
1: 0
2: 8
3: 118
4: 1187
900564751_900564765 22 Left 900564751 1:3326778-3326800 CCACCAGCCGCCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 900564765 1:3326823-3326845 CTCAGGGTCAGGAACAGAGAAGG 0: 1
1: 0
2: 5
3: 65
4: 511
900564751_900564761 5 Left 900564751 1:3326778-3326800 CCACCAGCCGCCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 900564761 1:3326806-3326828 GGGGGAGGCCGCTTTGTCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 119
900564751_900564759 -10 Left 900564751 1:3326778-3326800 CCACCAGCCGCCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 900564759 1:3326791-3326813 CGTGGCCTGACAGCAGGGGGAGG 0: 1
1: 0
2: 2
3: 24
4: 309
900564751_900564762 6 Left 900564751 1:3326778-3326800 CCACCAGCCGCCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 900564762 1:3326807-3326829 GGGGAGGCCGCTTTGTCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 121
900564751_900564767 26 Left 900564751 1:3326778-3326800 CCACCAGCCGCCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 900564767 1:3326827-3326849 GGGTCAGGAACAGAGAAGGTGGG 0: 1
1: 0
2: 1
3: 43
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900564751 Original CRISPR TCAGGCCACGCGGCGGCTGG TGG (reversed) Intronic