ID: 900565115

View in Genome Browser
Species Human (GRCh38)
Location 1:3328365-3328387
Sequence CAGAGCTATCTCCTTGGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900565111_900565115 -1 Left 900565111 1:3328343-3328365 CCCAGTAGACAACAGTGACAACC 0: 1
1: 0
2: 0
3: 17
4: 111
Right 900565115 1:3328365-3328387 CAGAGCTATCTCCTTGGTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 74
900565112_900565115 -2 Left 900565112 1:3328344-3328366 CCAGTAGACAACAGTGACAACCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 900565115 1:3328365-3328387 CAGAGCTATCTCCTTGGTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 74
900565110_900565115 5 Left 900565110 1:3328337-3328359 CCTCTGCCCAGTAGACAACAGTG 0: 1
1: 0
2: 0
3: 14
4: 241
Right 900565115 1:3328365-3328387 CAGAGCTATCTCCTTGGTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900565115 Original CRISPR CAGAGCTATCTCCTTGGTCG TGG Intronic
900099416 1:955021-955043 CAGAGCTGCCTCCTGGGTCTGGG - Intronic
900565115 1:3328365-3328387 CAGAGCTATCTCCTTGGTCGTGG + Intronic
901057737 1:6456552-6456574 CACAGCTACCTCCTTGGCTGAGG + Intronic
901196221 1:7441444-7441466 CAGAGCTGTCTCTGTGGTGGAGG + Intronic
902255796 1:15187835-15187857 CAGAGCTCTTTCCTTGGCCGGGG - Intronic
902415879 1:16238839-16238861 CAGAGCTCTCTCCATGGGCCAGG + Intergenic
902476614 1:16691900-16691922 CACAGCTACCTCCTTGGCTGAGG - Intergenic
902617522 1:17631980-17632002 CAGAGCTGTGTCCTTGGCAGTGG + Intronic
903765338 1:25730598-25730620 GAGAGCTGTCTCCTGGGCCGTGG + Intronic
905343257 1:37293648-37293670 CAGAGCTACCTCCTAGGGTGAGG + Intergenic
905931661 1:41792274-41792296 CAGGGCTATGTCCTTGGGAGAGG + Intronic
909023479 1:70458065-70458087 AAGAGCTATGTCCTTGGTGTTGG - Intergenic
910935298 1:92481826-92481848 CAGAGCTGTCTCCTTGCAGGTGG - Intronic
912736257 1:112151950-112151972 CATAGGTATCTCCTTGGCCATGG - Intergenic
913189699 1:116403092-116403114 CAGAACAATCTCTTTGGTGGTGG - Intronic
1062922801 10:1292824-1292846 CAGAGAAAGCTCCTTGTTCGAGG + Intronic
1073051826 10:100672012-100672034 CACAGCTCTCTCCGAGGTCGGGG + Intergenic
1073254245 10:102140907-102140929 CAGAGCTGTCTTCTTGGCTGGGG - Exonic
1075377523 10:121990689-121990711 GAGAGCTTTCTCCATGGTTGTGG - Intronic
1078957106 11:16211400-16211422 CATTGCTATCACCTTGGTCCAGG - Intronic
1090721069 11:129473725-129473747 CAGAGCTTTCACCCTGGTCAGGG + Intergenic
1102149144 12:110676706-110676728 CAGAGCCCTCTCCTGGGTTGGGG - Intronic
1121548164 14:94778272-94778294 CAAAGCTCTCTCCTTGGCAGCGG + Intergenic
1123987416 15:25657857-25657879 CATCGCTGTCTCCTTGGTCTGGG + Intergenic
1127499751 15:59544905-59544927 CAGGGCCTTCTCCTTGGTTGGGG + Intergenic
1127715375 15:61644509-61644531 CAGAGCTTGCTCCTTGTTCATGG - Intergenic
1135588292 16:23687924-23687946 CAGGGCTTTCTCCCTGGTCCTGG + Intronic
1145322815 17:21776371-21776393 CAGAGCTGTCTCCAAGGCCGCGG + Intergenic
1146947947 17:36886510-36886532 CAGAGCTATCTCCCCGGACTGGG + Intergenic
1147881819 17:43659239-43659261 AAGAGCTTTCCCCTTGGTGGCGG - Intronic
1156371721 18:36477188-36477210 CAGACCTGTCTCCTTAGTTGGGG + Intronic
1159765675 18:72485381-72485403 CGGAGCTACCTCCATGGTGGGGG - Intergenic
1160126340 18:76175898-76175920 CTGAGCTATGTGCTTGGTCCTGG - Intergenic
1168356467 19:55703257-55703279 AGCAGCTATCTCCTTGGTTGAGG - Intronic
1202710635 1_KI270714v1_random:17741-17763 CACAGCTACCTCCTTGGCTGAGG - Intergenic
927983089 2:27387391-27387413 CTGAGATATCTCCTAGGTTGAGG - Intronic
930227276 2:48806516-48806538 CATAGCTCTGTCCTTGGTGGTGG + Intergenic
931458523 2:62431361-62431383 CAGAGTTATGTCCTTGGCCAAGG - Intergenic
940413383 2:153392442-153392464 CAGAGTAATCTCCTTAGTTGAGG + Intergenic
942717567 2:178910770-178910792 CAGAGCTCCCTCCTTGTTCCAGG + Intronic
947388283 2:229614567-229614589 CAGAGCTACCTCCTTGTCCCAGG - Intronic
1170080985 20:12475445-12475467 CAGTGCTAACTCCTTGGTCTTGG + Intergenic
1170967673 20:21090173-21090195 CACAGTTATCTTCTTGGGCGTGG + Intergenic
1176101103 20:63364986-63365008 CACAGCCATCTCCTTGGGTGCGG - Intronic
1182135483 22:27898584-27898606 CAGAGATATCTCCTTATTCTGGG - Intronic
951911851 3:27758716-27758738 CAGAGCTTTCTCCTAGTTCCTGG - Intergenic
953382322 3:42481258-42481280 CAGAGCTTTCTTCTTGGTTTGGG - Intergenic
960010635 3:112830978-112831000 CGGACCCATCTCCTTGGTTGGGG + Intronic
962446236 3:135468408-135468430 AAGATCTATCTTCTTGGTCATGG - Intergenic
964686885 3:159405025-159405047 CAGAGGTACCACCTTGGTCTTGG - Intronic
966447858 3:180023839-180023861 CATACCTAGCTCCTTGGTAGAGG + Intronic
966710314 3:182966070-182966092 CAGAGCACTGTGCTTGGTCGGGG - Intronic
974066300 4:57080905-57080927 CAGAGATATCCCCTTGGCAGTGG - Intronic
975424040 4:74205806-74205828 CAGAGCTATAGTCTTGGTGGTGG + Intronic
987074433 5:14367391-14367413 CTGAGCTCTCTGCTTGGTTGAGG - Intronic
990810062 5:59713737-59713759 CAGTGCTTTCTCCGTGCTCGTGG - Intronic
990818379 5:59810525-59810547 CTGGGCCATCTCCTTGGTCAAGG + Intronic
995374556 5:111459354-111459376 AAGGGCTATCTCCTTGGTTTGGG + Intronic
1000874410 5:166618487-166618509 CAAAGTTATTTCCTTGGTCTAGG + Intergenic
1004227026 6:13794939-13794961 CAGACTTATCTCCTTAGTAGTGG + Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1004473322 6:15948078-15948100 CAGAACAATCTGCTTGGTGGAGG - Intergenic
1006097272 6:31663982-31664004 GTGAGCTATCTCCTGGGCCGTGG - Exonic
1024883436 7:54115253-54115275 CAGAGCCCTCTCCTTCGTGGTGG - Intergenic
1026454052 7:70555494-70555516 CAGAGTTACCTCCTTGGACCTGG + Intronic
1026468107 7:70671819-70671841 CAGAGCTCTGTCCTTGGGCCTGG + Intronic
1027981033 7:85222750-85222772 CATAGTTATCTCCTAGGTCCTGG - Intergenic
1029676685 7:102074675-102074697 CAGAGCTTTGTCCCTGGTCCAGG + Intronic
1032393683 7:131573928-131573950 CAGAGCTCTCTCCTGGTTCCTGG - Intergenic
1035397431 7:158544278-158544300 CAGAGCCATCTCGTGGGCCGTGG - Intronic
1037785163 8:21898604-21898626 CAGTGCTATCTCCTTGCTTTAGG + Intergenic
1043742793 8:83835168-83835190 CAGAGCTATCTCCATCTTTGTGG - Intergenic
1044589515 8:93900028-93900050 CAGAGCTCTGTCCTTTGTCCAGG + Intronic
1045491571 8:102674245-102674267 CAGAGCTATCTTCTTGTCCAGGG - Intergenic
1049465592 8:142749928-142749950 CAGGGCCATCTCCTTGGAGGAGG - Intergenic
1056778783 9:89533786-89533808 CAAAGCTATCTGCTTGGCCCAGG - Intergenic
1056808400 9:89745822-89745844 TAGAGCTATGTCCTTGGCCCAGG - Intergenic
1060009068 9:120027419-120027441 CAGAGCTACCTCCTTGATGGGGG - Intergenic