ID: 900568251

View in Genome Browser
Species Human (GRCh38)
Location 1:3345924-3345946
Sequence AGCCAACAAGAGCCCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900568249_900568251 -9 Left 900568249 1:3345910-3345932 CCTGGGCTCCTGGGAGCCAACAA 0: 1
1: 1
2: 2
3: 33
4: 252
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192
900568244_900568251 -2 Left 900568244 1:3345903-3345925 CCCCCACCCTGGGCTCCTGGGAG 0: 1
1: 1
2: 12
3: 105
4: 956
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192
900568245_900568251 -3 Left 900568245 1:3345904-3345926 CCCCACCCTGGGCTCCTGGGAGC 0: 1
1: 0
2: 11
3: 73
4: 677
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192
900568237_900568251 15 Left 900568237 1:3345886-3345908 CCCAGAGCTACACAGTCCCCCCA 0: 1
1: 0
2: 1
3: 13
4: 167
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192
900568248_900568251 -8 Left 900568248 1:3345909-3345931 CCCTGGGCTCCTGGGAGCCAACA 0: 1
1: 1
2: 4
3: 46
4: 397
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192
900568247_900568251 -5 Left 900568247 1:3345906-3345928 CCACCCTGGGCTCCTGGGAGCCA 0: 1
1: 0
2: 9
3: 81
4: 670
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192
900568246_900568251 -4 Left 900568246 1:3345905-3345927 CCCACCCTGGGCTCCTGGGAGCC 0: 1
1: 0
2: 9
3: 90
4: 602
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192
900568236_900568251 18 Left 900568236 1:3345883-3345905 CCACCCAGAGCTACACAGTCCCC 0: 1
1: 0
2: 1
3: 22
4: 236
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192
900568238_900568251 14 Left 900568238 1:3345887-3345909 CCAGAGCTACACAGTCCCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 166
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192
900568243_900568251 -1 Left 900568243 1:3345902-3345924 CCCCCCACCCTGGGCTCCTGGGA 0: 1
1: 0
2: 14
3: 125
4: 1112
Right 900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900568251 Original CRISPR AGCCAACAAGAGCCCCAAAG AGG Intronic
900534830 1:3171678-3171700 AGCCAACCAGAACCCAGAAGGGG - Intronic
900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG + Intronic
900782874 1:4629248-4629270 AGCCACCATGAGCTCCACAGTGG + Intergenic
901592710 1:10358900-10358922 AGCCACCAAGTGACCCAAACAGG - Intronic
901604764 1:10450356-10450378 AGCCAACAAGAGACAGAGAGTGG - Intronic
902172655 1:14625497-14625519 ATCCCAAAAAAGCCCCAAAGAGG + Intronic
905467543 1:38166729-38166751 AGCCAGCATGAGCCCCACATGGG + Intergenic
905468459 1:38173932-38173954 AGCCCACAGGAGCCCAGAAGTGG - Intergenic
906687089 1:47769733-47769755 AGTCAACAGGGACCCCAAAGTGG + Intronic
907074465 1:51565812-51565834 AGCCAGTGAGAGCCCAAAAGCGG - Intergenic
907467207 1:54646324-54646346 AGCCAAAAAGACCCGGAAAGAGG - Intronic
908105717 1:60839721-60839743 AGCCAACAATAGCAACAATGGGG + Intergenic
909474857 1:76071508-76071530 AGCCAAGAAGAGCCCTAGGGAGG + Intergenic
914785776 1:150829104-150829126 AGCCAACAGTAGCCACACAGCGG + Exonic
915137829 1:153746202-153746224 AGCCAAAAAGGATCCCAAAGAGG - Intronic
915160847 1:153919528-153919550 AGCCACCAAAATCCCCAAACAGG + Intronic
915306705 1:154983925-154983947 AGCCACCCAGACCCCCAAATAGG - Exonic
915574692 1:156767869-156767891 AGCGAACAAGCCCCCTAAAGCGG - Exonic
915847050 1:159277486-159277508 AGTGAGCAGGAGCCCCAAAGAGG + Intergenic
916499184 1:165372080-165372102 AGCCAAAAATAGCCCCAAAAGGG + Intergenic
917929298 1:179812819-179812841 AGGCGAGAAGAGCACCAAAGGGG + Intronic
919105742 1:193148310-193148332 TGCCAAAAAGAACCCCAAACTGG - Intronic
919435956 1:197561361-197561383 AGCCAACAAGAATACCAAAGAGG - Intronic
922470398 1:225873467-225873489 TGCCACCCAGAGCCCCAGAGGGG - Intronic
923310208 1:232727808-232727830 AGCCATTAAGAGCCCCAAGCTGG - Intergenic
924035251 1:239929888-239929910 GGTCAACAAGACCTCCAAAGAGG + Intergenic
924858552 1:247898234-247898256 AACAAACCAGAGCCCCAGAGAGG + Intergenic
1067307658 10:45079908-45079930 ACCCAACTAGATCCCCCAAGAGG + Intergenic
1068489230 10:57701007-57701029 GGCCAAGAAGAGCCCAGAAGTGG + Intergenic
1068562715 10:58533841-58533863 AGGCAGCAAGAGCCGCAAAGGGG + Intronic
1069724533 10:70568826-70568848 AATCAACCAGAGGCCCAAAGGGG - Intergenic
1070449859 10:76547328-76547350 AGGCAAGAAGAACCCCAAAATGG + Intronic
1070976517 10:80609800-80609822 AGCCACCAAGGGCCCCTCAGAGG + Intronic
1074653744 10:115558350-115558372 AGCCAATAAGAACCTCAAATTGG - Intronic
1075189062 10:120289414-120289436 ACCCAAAAAGAGTCCCAAAGGGG + Intergenic
1075580469 10:123614033-123614055 AGCCAAGTAAAACCCCAAAGTGG + Intergenic
1075615893 10:123890954-123890976 AGCCATCCACATCCCCAAAGCGG + Intronic
1075816235 10:125266756-125266778 AACCAGCAAGAGCCCCGAATGGG + Intergenic
1075901004 10:126042930-126042952 AGCCAACAAGAAACCCAGTGGGG - Intronic
1076014318 10:127015483-127015505 AGGAAAGAAGAGCCCCGAAGAGG - Intronic
1076050584 10:127329975-127329997 AGCCACTAAGAGCCCTAACGTGG - Intronic
1076050592 10:127330050-127330072 AGCCACTAGGAGCCCCAACGCGG - Intronic
1077277119 11:1717448-1717470 AGCAAACAAGAGGGCCATAGAGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079499647 11:21088493-21088515 ACCCAAGAAGAGCCCAAATGTGG - Intronic
1083415273 11:62521522-62521544 TGACATCAAGGGCCCCAAAGTGG - Exonic
1083415339 11:62521906-62521928 TGACATCAAGGGCCCCAAAGTGG - Exonic
1083415404 11:62522290-62522312 TGACATCAAGGGCCCCAAAGTGG - Exonic
1083415527 11:62523058-62523080 TGACATCAAGGGCCCCAAAGTGG - Exonic
1083415564 11:62523280-62523302 GGACATCAAGGGCCCCAAAGTGG - Exonic
1085300088 11:75452842-75452864 ACCCAACCTGAGCCCCAGAGAGG - Intronic
1087445248 11:98242860-98242882 AGACAATGAGAGCCCAAAAGGGG + Intergenic
1089401308 11:118166220-118166242 AGCCAACGGGAGCCCCAAGGAGG + Exonic
1089424938 11:118365119-118365141 AGCCAAAAAGAGCAGCAAAGGGG - Exonic
1092503069 12:9066300-9066322 CGCCAACCAGGGCCCCAAAGAGG - Intergenic
1093023067 12:14220774-14220796 AGCCACCAAGGGCCCCAAGAAGG - Intergenic
1094919194 12:35410834-35410856 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1094919358 12:35413550-35413572 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1094934682 12:35661973-35661995 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1094942455 12:35787996-35788018 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1094945900 12:35843712-35843734 ATCCAACGAAGGCCCCAAAGAGG - Intergenic
1094948185 12:35880740-35880762 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1094952185 12:35945963-35945985 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1094955753 12:36003374-36003396 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1094957882 12:36037680-36037702 ATCCAACGAAGGCCCCAAAGAGG - Intergenic
1094976524 12:36338316-36338338 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1094997040 12:36670584-36670606 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1095009519 12:36872746-36872768 TTCCAACAAAGGCCCCAAAGAGG - Intergenic
1099470481 12:83042005-83042027 TGCAAACAAGAACCTCAAAGTGG - Intronic
1101499840 12:105292934-105292956 TGCCAACTAGAACTCCAAAGTGG - Intronic
1101670162 12:106863204-106863226 AGGCATCTAGAGGCCCAAAGAGG + Intronic
1106025412 13:25951047-25951069 AGCCAAAGAGATCTCCAAAGTGG - Intronic
1107939596 13:45372216-45372238 AGCCATCAAAAACCCCAAGGAGG + Intergenic
1108583188 13:51845087-51845109 AGTCAAGAGGAGCCCCACAGAGG - Intergenic
1115464022 14:33694384-33694406 AGCCAAAAAGCCCCCCAAAAAGG + Intronic
1124438694 15:29671754-29671776 AGCCCACAAGGACCCCAGAGAGG - Intergenic
1126807427 15:52365361-52365383 AGCAAACCACAGCCACAAAGAGG - Intronic
1128796998 15:70473381-70473403 AGAGACCAAGAGCCCCAAATAGG - Intergenic
1134278047 16:12794085-12794107 AGTCAGAAAGAGTCCCAAAGTGG - Intronic
1134710459 16:16324856-16324878 AGGCAGCAAGAGCCCCCCAGCGG - Intergenic
1134718630 16:16369144-16369166 AGGCAGCAAGAGCCCCCCAGCGG - Intergenic
1139570429 16:67808274-67808296 AGCCTACAAAAGCCCCTAAGAGG + Intronic
1143115588 17:4580214-4580236 AGCCAAGAAGAGCGATAAAGAGG - Intergenic
1143962675 17:10733605-10733627 AACCCACATAAGCCCCAAAGAGG - Intergenic
1148817517 17:50340462-50340484 AGACAACTAGAGGACCAAAGAGG + Intergenic
1150276292 17:63899870-63899892 ACCCAACAAGAGCCTCTATGTGG + Intergenic
1150319484 17:64200475-64200497 AGCCAGCAAGAACTCCACAGTGG - Intronic
1152133656 17:78491819-78491841 AGCCAGCCAGGGCCACAAAGAGG - Intronic
1153522569 18:5966477-5966499 AGGAAAGAAGAGCCGCAAAGGGG - Intronic
1154071413 18:11155544-11155566 AGCACACAAAAACCCCAAAGTGG - Intergenic
1158901506 18:61966248-61966270 GGCGTACAATAGCCCCAAAGTGG - Intergenic
1160236454 18:77089667-77089689 AGCCTCCAAGAGCCCAAGAGCGG - Intronic
1160962655 19:1730423-1730445 AGCCACCAAGAGCCCCTGAGCGG - Intergenic
1164882160 19:31741566-31741588 AGCACAGAAGGGCCCCAAAGCGG + Intergenic
1167535040 19:50044558-50044580 ATCCATCAAGGGACCCAAAGGGG - Intronic
1167748942 19:51368459-51368481 CGCCAACAAGAGGGCCACAGTGG - Exonic
924997657 2:377867-377889 AGCCCAAAGAAGCCCCAAAGAGG + Intergenic
925243612 2:2358521-2358543 AGCCAACAAAAGCAGCAAACAGG - Intergenic
925684510 2:6457921-6457943 AACCAAGAACAGCACCAAAGGGG + Intergenic
929573614 2:43038953-43038975 AGGCCACCAGAGCCCCCAAGGGG - Intergenic
929910545 2:46085859-46085881 AGACAACTGGAGCCCCAAAAGGG + Intronic
932733847 2:74240282-74240304 GGCCAAGAAAAGCCTCAAAGAGG - Intronic
936401568 2:112168556-112168578 CTCCAGCAAGAGCCTCAAAGCGG + Intronic
937304555 2:120863209-120863231 AGCCCACAAGTTCCCTAAAGAGG + Intronic
937320999 2:120960731-120960753 ATCCCACAAGAGCCCCGTAGAGG - Intronic
938067844 2:128291684-128291706 AGGCAACAAGAGCCCCAGGCTGG - Intronic
938533429 2:132217229-132217251 TTCCAACAAAAGCCTCAAAGTGG - Intronic
939581756 2:143958147-143958169 AGCCAATTAGAGCCCCCAAAAGG - Intronic
940799732 2:158120082-158120104 ATCCAACTAGAGACCCAAGGTGG - Intronic
944501557 2:200365399-200365421 AGCCAGCAGCAGCCCCACAGTGG - Intronic
946553385 2:220827618-220827640 ATCCAATAACAGCCCCAAATTGG - Intergenic
947580747 2:231316056-231316078 TGGCAACAAGAGCACAAAAGAGG - Intronic
1169048698 20:2558699-2558721 AGCGGACAGCAGCCCCAAAGAGG + Exonic
1172385207 20:34529390-34529412 AGCCATCAAGGGCAACAAAGTGG + Intronic
1173415463 20:42850964-42850986 AGCTACCAAGAGCCCTAATGAGG - Intronic
1175311220 20:58012812-58012834 AGAAAACAAGAGCCGCTAAGTGG + Intergenic
1178640280 21:34339903-34339925 ATCCTCCCAGAGCCCCAAAGAGG - Intergenic
1180793616 22:18591066-18591088 GGCAAGCCAGAGCCCCAAAGAGG - Intergenic
1181228123 22:21404247-21404269 GGCAAGCCAGAGCCCCAAAGAGG + Intergenic
1181250528 22:21530603-21530625 GGCAAGCCAGAGCCCCAAAGAGG - Intergenic
1181558379 22:23685189-23685211 CACATACAAGAGCCCCAAAGAGG + Intergenic
1181924759 22:26349076-26349098 TGCCAAGAAAAGGCCCAAAGTGG + Intronic
1182830601 22:33302018-33302040 AGCGAAGAAGAGTCCCAGAGGGG + Intronic
1183520460 22:38293698-38293720 ATCCAAACATAGCCCCAAAGAGG + Intronic
1183984186 22:41560581-41560603 AGCCAAGAGGAGCCCCCCAGAGG - Intergenic
953469768 3:43156760-43156782 CAGCAACAACAGCCCCAAAGTGG + Intergenic
955051231 3:55413207-55413229 AGACAACAATAGTGCCAAAGGGG + Intergenic
956726279 3:72159027-72159049 AGCCATCAAGCGCTCCAAATTGG - Intergenic
956926001 3:73989418-73989440 AGCCAAGAATAGCCCCAGACAGG + Intergenic
958210091 3:90463057-90463079 ATCCAACAAAGGCCTCAAAGAGG + Intergenic
958272907 3:91529405-91529427 ATCCAACGAAAGCCTCAAAGAGG + Intergenic
958279066 3:91632461-91632483 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958285157 3:91732328-91732350 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958309427 3:92129797-92129819 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958317576 3:92262679-92262701 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958333992 3:92532184-92532206 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958345746 3:92724969-92724991 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958351297 3:92815633-92815655 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
959473993 3:106787320-106787342 AGCCAGCAAGAAAGCCAAAGAGG - Intergenic
960143065 3:114169878-114169900 AGCCAACAAATGCCCCTGAGTGG + Intronic
960934512 3:122889676-122889698 AGCCAGCAACACCCCCAAAAGGG + Intergenic
965994132 3:174858401-174858423 AGCAAACAAGAGCAACAAATTGG - Intronic
969072155 4:4548066-4548088 AGCCAAAAAGCACACCAAAGTGG + Intergenic
969101706 4:4774529-4774551 AGCCAAAAAAATCCCCAAAGAGG - Intergenic
970146293 4:13039754-13039776 AGCCACTAAGATCCCCCAAGTGG + Intergenic
974615243 4:64271740-64271762 AGCAGAGAAGAGACCCAAAGTGG - Intergenic
977558277 4:98506577-98506599 AGTCAACAAAAGCCCCTCAGAGG - Intronic
983177803 4:164611853-164611875 AGCCAACCTGAGTCCCTAAGAGG + Intergenic
984140522 4:176000003-176000025 AGCCAATAAGAGGGGCAAAGTGG - Intronic
987875456 5:23675138-23675160 AGCTCTCAGGAGCCCCAAAGTGG - Intergenic
988202293 5:28083553-28083575 AGCAGACAGGAGACCCAAAGTGG - Intergenic
990224794 5:53637318-53637340 AGCCAATAAAAGCCCCTTAGGGG - Intronic
992000285 5:72429766-72429788 AACAAACAAAAGCCCCATAGAGG + Intergenic
995538581 5:113162168-113162190 AGCCAACAATAGTCCCAACTCGG + Intronic
995774076 5:115706945-115706967 AGGGAAGGAGAGCCCCAAAGTGG + Intergenic
995809637 5:116090202-116090224 AGCCAAGAAGATGGCCAAAGAGG - Intronic
997837328 5:137206193-137206215 AGCCAATAATAACCCCTAAGTGG + Intronic
998168818 5:139860103-139860125 AGTCCCCAAGAGCCCCAAGGAGG + Intronic
999315353 5:150579925-150579947 AGCCCTCAAGAGACCCAGAGTGG - Intergenic
999425017 5:151480262-151480284 AGCCAAATAGAGCCAAAAAGAGG - Intronic
1000975654 5:167761401-167761423 AGGAAACAAGTGTCCCAAAGAGG + Intronic
1006533695 6:34679898-34679920 AGCCACCAAAAGCCAAAAAGAGG + Intronic
1008617466 6:53240461-53240483 AGGCAACAAGAAACCCCAAGTGG + Intergenic
1009157441 6:60239084-60239106 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
1009706060 6:67253391-67253413 AGCTAACAAGAGCCCCCCTGGGG + Intergenic
1014391728 6:120872779-120872801 AGCTAAGAAGAGACCCACAGTGG - Intergenic
1014770525 6:125453684-125453706 AGCCCAGAAGAGACACAAAGTGG - Intergenic
1018069784 6:160154219-160154241 AGCCAACAAGTGACCCTTAGAGG - Intronic
1022968132 7:35493195-35493217 AGCCAGCAAGAGCCACAGAAAGG - Intergenic
1023106999 7:36772295-36772317 TGCCAAGAAGAGCCCCATAGTGG - Intergenic
1023472948 7:40544643-40544665 AGTCTACAACAGCCCCAGAGTGG - Intronic
1024998809 7:55296372-55296394 AGCCAATAAGAACCTCAAATGGG + Intergenic
1028857017 7:95604098-95604120 AGCCCAGATGAGCCCCAAAAGGG + Intergenic
1031087846 7:117321362-117321384 AGCCAAAAAGAGCTACAAAATGG - Intronic
1034956223 7:155337017-155337039 AGCCAACAAGAAGACCAACGTGG + Intergenic
1036456002 8:8908572-8908594 AGAGACCAAGAGCACCAAAGGGG + Intergenic
1038278684 8:26143140-26143162 AGCCAACATGGGCCCACAAGAGG - Intergenic
1040520079 8:48169132-48169154 AGCCACCAAGAAGTCCAAAGTGG - Intergenic
1041639851 8:60185254-60185276 AAACAACAAAAGCCCCAGAGGGG + Intergenic
1045873416 8:106950661-106950683 AGCTCTCAAGAGACCCAAAGTGG - Intergenic
1047747730 8:127857312-127857334 AGTCATCAAGAGCCCAAAAGAGG - Intergenic
1050631368 9:7561999-7562021 AGCCAACATGGGCCATAAAGGGG - Intergenic
1052359711 9:27540921-27540943 AGCAAACAAGAGCCCCAAGTAGG + Intergenic
1053572218 9:39320901-39320923 ATCCAACAAGTGGCCCAGAGGGG - Intergenic
1053623611 9:39845437-39845459 ATCCAACAAGTGGCCCAGAGGGG - Intergenic
1053881258 9:42597791-42597813 ATCCAACAAGTGGCCCAGAGGGG + Intergenic
1053891408 9:42696522-42696544 ATCCAACAAGTGGCCCAGAGGGG - Intergenic
1054093777 9:60879612-60879634 ATCCAACAAGTGGCCCAGAGGGG - Intergenic
1054115255 9:61155536-61155558 ATCCAACAAGTGGCCCAGAGGGG - Intergenic
1054124927 9:61298110-61298132 ATCCAACAAGTGGCCCAGAGGGG + Intergenic
1054220289 9:62405262-62405284 ATCCAACAAGTGGCCCAGAGGGG + Intergenic
1054230426 9:62503910-62503932 ATCCAACAAGTGGCCCAGAGGGG - Intergenic
1054592501 9:67027006-67027028 ATCCAACAAGTGGCCCAGAGGGG + Intergenic
1057559034 9:96113027-96113049 AGCCAAGAACAGGCCCCAAGAGG + Intronic
1057654576 9:96940590-96940612 AGCCAACAAGGGCCCTGGAGAGG - Intronic
1057846187 9:98526472-98526494 AGTCAAGCAGAGCCTCAAAGAGG - Intronic
1060729929 9:126030814-126030836 AGCAGCCAAAAGCCCCAAAGAGG - Intergenic
1061928746 9:133821299-133821321 TGCCAACAAGAGACCCACTGCGG - Intronic
1188198770 X:27274138-27274160 AGGCAACAGGAGCCACAAATGGG + Intergenic
1188587096 X:31790717-31790739 AGCCAACAAGAGATCAAATGAGG + Intronic
1192930168 X:75798737-75798759 AATCAACAACAGCCCCAAAGAGG - Intergenic
1196285691 X:113877111-113877133 AGCCAACTATAGGCCCAAACTGG - Intergenic
1197251842 X:124225189-124225211 AGCCAACAAGAGGCAGAATGGGG + Intronic
1197351474 X:125388203-125388225 AGCCGATAAGAACCTCAAAGGGG + Intergenic
1197679164 X:129363868-129363890 AGCCAACTAGAGCCAGAAGGAGG - Intergenic
1198627587 X:138595362-138595384 ACTCAAAAAGAGCCCCAAATGGG - Intergenic
1200518919 Y:4184783-4184805 AGCCCACAAGAGCCCCTACAAGG - Intergenic