ID: 900570704

View in Genome Browser
Species Human (GRCh38)
Location 1:3356912-3356934
Sequence CGAGTCTCCTGAGAGCCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900570687_900570704 21 Left 900570687 1:3356868-3356890 CCCAGGTGCCGGCTGGCTACCCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
900570694_900570704 2 Left 900570694 1:3356887-3356909 CCCCGGATCCCGGCAGCGGGAGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
900570690_900570704 13 Left 900570690 1:3356876-3356898 CCGGCTGGCTACCCCGGATCCCG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
900570696_900570704 1 Left 900570696 1:3356888-3356910 CCCGGATCCCGGCAGCGGGAGGG 0: 1
1: 0
2: 1
3: 23
4: 227
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
900570698_900570704 0 Left 900570698 1:3356889-3356911 CCGGATCCCGGCAGCGGGAGGGC 0: 1
1: 0
2: 0
3: 16
4: 130
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
900570700_900570704 -7 Left 900570700 1:3356896-3356918 CCGGCAGCGGGAGGGCCGAGTCT 0: 1
1: 0
2: 0
3: 8
4: 89
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
900570684_900570704 30 Left 900570684 1:3356859-3356881 CCCTCAGAACCCAGGTGCCGGCT 0: 1
1: 0
2: 1
3: 10
4: 118
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
900570685_900570704 29 Left 900570685 1:3356860-3356882 CCTCAGAACCCAGGTGCCGGCTG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
900570699_900570704 -6 Left 900570699 1:3356895-3356917 CCCGGCAGCGGGAGGGCCGAGTC 0: 1
1: 0
2: 2
3: 12
4: 219
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
900570688_900570704 20 Left 900570688 1:3356869-3356891 CCAGGTGCCGGCTGGCTACCCCG 0: 1
1: 0
2: 1
3: 4
4: 107
Right 900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900570704 Original CRISPR CGAGTCTCCTGAGAGCCGGG TGG Intronic
900495938 1:2976269-2976291 CCAGCCTCCTAAGAGCTGGGTGG - Intergenic
900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG + Intronic
901655724 1:10768120-10768142 GGAGCCTCCTGAGATCAGGGCGG - Intronic
903044533 1:20554828-20554850 CGAGGCTCCTCAGAGCAGGTGGG + Exonic
903225451 1:21892198-21892220 CTAGGCTCCTGGGTGCCGGGTGG + Intronic
904528897 1:31155261-31155283 CGAGTCCCGGGAGAGGCGGGCGG + Intergenic
908836051 1:68231142-68231164 CGAGTGTGCAGAGAGGCGGGAGG + Intronic
919757723 1:201076245-201076267 CGAGTCTCTTGAAAGGCCGGAGG + Intronic
920249983 1:204617109-204617131 GGACTCTCCTCAGAGCCTGGAGG - Intergenic
921251596 1:213303419-213303441 CAAGTCACCTCAGAGCTGGGAGG - Intergenic
921261616 1:213389482-213389504 CGAGCCTCTTGTGAGCAGGGAGG - Intergenic
922891296 1:229063733-229063755 TGAGACCCCTGAGAGCCCGGAGG + Intergenic
1064004496 10:11689243-11689265 CCAGGATCCTGAGAGCCTGGGGG + Intergenic
1064258833 10:13768326-13768348 CAAGAGTCCTGAGAGCCGGAGGG + Intronic
1069898213 10:71691972-71691994 GGAAGCTCCTGAGAGCTGGGAGG - Intronic
1075694597 10:124424469-124424491 CGAGGATCTTGAGAGCTGGGGGG + Intergenic
1076564541 10:131389172-131389194 CGAGTCTCATAAGAGCCATGCGG - Intergenic
1076589313 10:131572250-131572272 CCAGGTTCCTGAGAGCTGGGTGG - Intergenic
1078171704 11:8933243-8933265 GGAGTCTCCTGGGATCCGTGAGG - Intergenic
1084028564 11:66467431-66467453 CAGGCCTCCTGAGACCCGGGCGG + Intronic
1091238503 11:134037175-134037197 CGGGTCTCCTCCGAGCAGGGCGG + Intergenic
1094514616 12:31119612-31119634 TGGGTGTCCTAAGAGCCGGGGGG - Intergenic
1101721591 12:107355165-107355187 GGAGTCTCCTGTGAGGCTGGCGG - Intronic
1101969114 12:109300385-109300407 CCAGTCTCCTGAGAGCCTGTGGG + Intronic
1103595440 12:122022236-122022258 CGCGGCTCCAGAGAGCCGCGGGG + Intronic
1104628148 12:130376887-130376909 CGAGTCTCCTGTGAGCAGCTGGG - Intergenic
1104725215 12:131071543-131071565 TGAGTGTCCTGGGAGCCAGGAGG - Intronic
1105927022 13:25018037-25018059 CGTTTCTGCTGAGAGGCGGGAGG - Intergenic
1107941678 13:45382122-45382144 TGGGGGTCCTGAGAGCCGGGGGG + Intergenic
1108053019 13:46464150-46464172 TGGGGGTCCTGAGAGCCGGGGGG - Intergenic
1108575150 13:51784162-51784184 AGCGCCTCCTGAGAGCCAGGTGG + Intronic
1114602790 14:23969837-23969859 CGAGCCTCCTGAGAGCCCGCGGG - Intergenic
1114607158 14:24006966-24006988 CGAGCCTCCTGAGAGCCCGCGGG - Intergenic
1117038043 14:51746966-51746988 TGGGGCTCCTAAGAGCCGGGGGG - Intergenic
1118761858 14:68885034-68885056 CCAGTCTCCTGAAAGAGGGGAGG - Intronic
1122290988 14:100680424-100680446 CGAGTGTCCTGAGGACCGGTGGG + Intergenic
1123042752 14:105497059-105497081 CGGATGTCCTCAGAGCCGGGGGG + Intronic
1123760146 15:23425487-23425509 CGAGGCTCCTTACAGCCGCGTGG + Intergenic
1125542819 15:40480372-40480394 AGTGTCTCCTGAGGGCAGGGAGG - Intergenic
1126307003 15:47271319-47271341 CAAGTCTTATGAGAGCCGTGCGG + Intronic
1127224810 15:56918364-56918386 CGGGCCTCCTGGGAGCGGGGTGG - Intronic
1128133242 15:65244820-65244842 TGAGTCTCCTGTGAGCCTGTTGG + Intronic
1128987189 15:72230379-72230401 CGAGCCTGCTGGGAGCTGGGAGG + Intronic
1129770968 15:78203454-78203476 CAAGTCAGCTGAGAGCTGGGGGG + Intronic
1139429743 16:66904756-66904778 AGAGTCGCCTGAGAACAGGGAGG - Intergenic
1142271214 16:89090408-89090430 CGAGTCTCCTGAAAGGCAGGAGG + Intronic
1142648445 17:1330208-1330230 CCAGTCCCCGGAGAGCTGGGGGG - Intergenic
1142851307 17:2706119-2706141 CCCCGCTCCTGAGAGCCGGGTGG - Intronic
1143672545 17:8406359-8406381 CAAGTCTCCAGAGAGCAGTGAGG - Intergenic
1148394826 17:47299539-47299561 GGAGTCTGGAGAGAGCCGGGAGG + Intronic
1150463234 17:65370675-65370697 CGAGTCTCCCCAGAGCGGGTCGG + Intergenic
1151748893 17:76025866-76025888 CTGGGCTCCAGAGAGCCGGGTGG + Intronic
1152716244 17:81902168-81902190 CGAGGCTGCGGAGGGCCGGGAGG - Exonic
1155152906 18:23136262-23136284 CGAGTCCCCTGGGCGCCGGCCGG + Exonic
1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG + Intronic
1159167231 18:64719285-64719307 CCAGTCTCCTGAGATTTGGGGGG - Intergenic
1160383468 18:78478610-78478632 CGAGTCTCCTGAGTCCCTGCTGG + Intergenic
1161981033 19:7630502-7630524 AGAGGCTCCTCAGAGCCTGGGGG - Intronic
1162573959 19:11487817-11487839 GGAGTCTCCTGAGGGCCAGCCGG - Exonic
1162578058 19:11510851-11510873 CGTGTCTCCTGGCAGCCGTGTGG - Intronic
1163427630 19:17247891-17247913 CGAGGCAGCTGAGAGCTGGGTGG + Intronic
1167426307 19:49431469-49431491 CGCGTCTCCTGAGTGTCGGCCGG + Intronic
931219254 2:60274392-60274414 GGTGTCTCCTGAGAGCCAGGTGG - Intergenic
932399301 2:71468719-71468741 AGAGACTCTTGAGAGCCAGGGGG - Intronic
934113875 2:88765846-88765868 CGTTTCTGCTGAGAGGCGGGAGG + Intergenic
934636150 2:95991831-95991853 CGTTTCTGCTGAGAGGCGGGAGG - Intronic
934797499 2:97113595-97113617 CGTTTCTGCTGAGAGGCGGGAGG + Exonic
937988717 2:127650428-127650450 TGAGGCTCCTCAGAGCTGGGAGG - Intronic
946614512 2:221495332-221495354 CCTGTCTCCTGACAGCCGTGGGG + Intronic
948615427 2:239195427-239195449 TGAGGATCCTGGGAGCCGGGTGG + Intronic
948632235 2:239309696-239309718 CAAGTATCCTGGGAGCTGGGGGG + Intronic
1175162875 20:57021863-57021885 CGACTCTCATGAGAGCCCCGTGG + Intergenic
1175957203 20:62617507-62617529 GGGGTCTCATGAGAGCAGGGAGG - Intergenic
1177871015 21:26573028-26573050 CAGCGCTCCTGAGAGCCGGGTGG + Exonic
1178950324 21:36980604-36980626 CGAGTCCCCAGAGCCCCGGGCGG + Intronic
1179726143 21:43342147-43342169 CGAGTCTTCTGAGAGCCACATGG + Intergenic
1180066137 21:45413462-45413484 GAAGTCTCCTGACAGCCGAGGGG - Intronic
1181594425 22:23905152-23905174 CTAGTGTCCTGAGAGCCAGTGGG + Intergenic
1183420567 22:37709312-37709334 CAGCTCACCTGAGAGCCGGGAGG - Intronic
1184062393 22:42091322-42091344 CGCGTCTCCAGAGCCCCGGGAGG + Intergenic
950464321 3:13144350-13144372 TGAGTCTCCTGACAGCCACGTGG - Intergenic
951980557 3:28561699-28561721 TCAGTCTCCTGAGATCCTGGAGG + Intergenic
952252242 3:31665988-31666010 AGAGTCACTTGAGAGCAGGGAGG + Intronic
954110045 3:48428821-48428843 CGAGCCTCCTGACCCCCGGGCGG - Intronic
957048665 3:75395702-75395724 CGTTTCTGCTGAGAGGCGGGAGG - Intergenic
966849703 3:184156733-184156755 CCAGTCTCCTGGGAGTTGGGGGG - Intronic
967290530 3:187915304-187915326 GGAGGCTCTTGAGAGCAGGGTGG + Intergenic
967854378 3:194105485-194105507 CAAGGTCCCTGAGAGCCGGGTGG - Intergenic
968921465 4:3524237-3524259 GGTGTGTCCTCAGAGCCGGGAGG - Intronic
969437867 4:7199089-7199111 TGATTCTCCTGTGAGCCGGGAGG + Intronic
969733455 4:8971319-8971341 AGGGGCTCCTAAGAGCCGGGGGG - Intergenic
977586923 4:98784329-98784351 AGAGTCTGCAGAGGGCCGGGTGG + Intergenic
982226900 4:153174587-153174609 ACAGTTTCCTGAGAGCAGGGCGG + Intronic
985492559 5:188024-188046 GGGGGCTCCTGAGAGCAGGGCGG - Exonic
985812827 5:2102918-2102940 CGACTTTCCAGAGAGCCGTGTGG + Intergenic
988263986 5:28927591-28927613 CGTTTCTGCTGAGAGGCGGGAGG - Intergenic
997891287 5:137679375-137679397 GGACTCTCCTGAGAACCGTGTGG - Intronic
999111093 5:149121977-149121999 TGAGTGTCCTGAGTGCCAGGAGG + Intergenic
1000303075 5:159972689-159972711 CGAGCATGCTGAGAGCCTGGGGG + Intergenic
1000719917 5:164693509-164693531 CCAGTCTCCTCAGAGCCAGCAGG - Intergenic
1002339567 5:178506084-178506106 CGGGTCTGCTGAAGGCCGGGAGG + Intronic
1002590961 5:180291655-180291677 CGGGGCTGCTGACAGCCGGGCGG + Intronic
1006175890 6:32121272-32121294 GGAGTCGGCTGAGAGCAGGGAGG + Exonic
1006406898 6:33850777-33850799 CCAGTCTCCTGAGAGGCTGTGGG + Intergenic
1006806373 6:36792235-36792257 AGAGTCTCCTGAGATCCTTGTGG + Intronic
1011112552 6:83853976-83853998 CGAGGCTGCTGAGAGCCCTGGGG + Intronic
1014968960 6:127791358-127791380 CCTGTCTCCTGAGAGCTGAGTGG - Intronic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018629508 6:165810010-165810032 GGATCCTCCTGAGAGCCGGGAGG - Intronic
1029106203 7:98178515-98178537 AGAGCCTTCTGAGAGCCGGGCGG + Intronic
1035629680 8:1097893-1097915 CGACTCTCCTGAGCGCAGGGAGG - Intergenic
1038650130 8:29394942-29394964 AGATTCTCCTGAGATCCTGGAGG + Intergenic
1042857235 8:73279768-73279790 TGAGTGTCCTGAGAGCCAAGTGG - Intergenic
1047586149 8:126275303-126275325 AAACTCTCCTGAGAGCCAGGAGG - Intergenic
1049511150 8:143027203-143027225 GGTGGCTCCTGAGAGCAGGGAGG + Intergenic
1054798135 9:69321563-69321585 CCAGGCTCCTGGGAGCCTGGAGG + Intergenic
1056554489 9:87677385-87677407 CGAGTCTCCTGAGAGTGGAAGGG + Intronic
1058852635 9:109027480-109027502 CCAGCCTCCTGGGAGCCAGGAGG - Intronic
1060414593 9:123421390-123421412 CGGGTCTCCTGGGAGCAGCGTGG - Intronic
1060725926 9:126005918-126005940 CGAGTGGCCTGAGAGCCCAGGGG + Intergenic
1061588659 9:131584242-131584264 CTAGTCGCCTGAGGGCTGGGCGG + Intronic
1062048812 9:134436877-134436899 AGGGTGTCCTGAGAGCCCGGTGG - Exonic
1190886459 X:54534742-54534764 AGAGGCTCCTGAGTGCTGGGAGG + Intronic
1192368378 X:70494007-70494029 CGAGTCTGCTGAGAGTTGTGTGG - Intronic
1194725525 X:97391259-97391281 TGAGCCTTCTGAGAGCTGGGAGG + Intronic
1199711716 X:150474190-150474212 CCATTCTCCTGAGAGTTGGGGGG + Intronic
1202584618 Y:26409620-26409642 CGTTTCTGCTGAGAGGCGGGAGG + Intergenic