ID: 900572501

View in Genome Browser
Species Human (GRCh38)
Location 1:3365454-3365476
Sequence CAATATAAGGAGGAAGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 468}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900572501_900572514 19 Left 900572501 1:3365454-3365476 CCCGCCTCTTCCTCCTTATATTG 0: 1
1: 0
2: 2
3: 45
4: 468
Right 900572514 1:3365496-3365518 GCCCCACTGTATTCCACCACAGG 0: 1
1: 0
2: 1
3: 51
4: 1371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900572501 Original CRISPR CAATATAAGGAGGAAGAGGC GGG (reversed) Intronic
900572501 1:3365454-3365476 CAATATAAGGAGGAAGAGGCGGG - Intronic
901251480 1:7783630-7783652 CATTAGAGGGAGGGAGAGGCGGG - Intergenic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
902309772 1:15573010-15573032 CACTTTAAGGAGGCTGAGGCGGG + Exonic
903025531 1:20427524-20427546 CACTAACAGGAGGAAGAGGCAGG - Intergenic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904589358 1:31601468-31601490 GAATGTAAGGAGGAAGGGGGTGG - Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905657460 1:39693958-39693980 AAAAATAAGGAGGCTGAGGCAGG + Intronic
906215442 1:44035640-44035662 CACTGTAGGGAGGAACAGGCTGG + Intergenic
906710455 1:47926202-47926224 AAATAAAAAGAAGAAGAGGCTGG + Intronic
906931729 1:50176780-50176802 CCACATAATCAGGAAGAGGCAGG - Intronic
907259818 1:53209527-53209549 CATTATTAGGAGGCCGAGGCGGG + Intronic
907368491 1:53981845-53981867 TTATAAAAAGAGGAAGAGGCTGG + Intergenic
907804118 1:57801612-57801634 CATGCTAAGGAGGAAGAGGAAGG - Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
909645243 1:77909695-77909717 CAATATAATGGGGGAGAGGATGG - Intronic
910347547 1:86257696-86257718 CAATATTGTGAGTAAGAGGCTGG + Intergenic
910594576 1:88965737-88965759 CAAAATGAGGAGGTAGATGCTGG - Intronic
910666192 1:89728130-89728152 TGAAATAAGGAGGAAGAGGCAGG - Intronic
910693991 1:89993552-89993574 CAAAAGGAAGAGGAAGAGGCTGG + Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
912925637 1:113910740-113910762 CAATTTTAGGAGGCTGAGGCAGG - Intronic
913502441 1:119483537-119483559 CAATATAATAAGTAAGAGCCAGG - Intergenic
913556122 1:119968960-119968982 CAATGTAAGGAGGAAGGTGATGG - Intronic
914453139 1:147811137-147811159 CACTATAAGGAGGGGTAGGCAGG + Intergenic
915069755 1:153257025-153257047 CTATATAGGGTGGCAGAGGCAGG + Intergenic
915151766 1:153838811-153838833 GTATATAAGAAGGCAGAGGCTGG + Intronic
915394709 1:155574109-155574131 CACTTTTAGGAGGCAGAGGCAGG + Intergenic
915482802 1:156198745-156198767 CAAGATACAGAGGAAAAGGCTGG - Intronic
915493642 1:156266038-156266060 GAAGATATGGAGGAAGAGGAGGG - Exonic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
917612231 1:176700258-176700280 CAATATCTGGAGCAGGAGGCTGG + Intronic
917644004 1:177011775-177011797 AACTAGAAGGAGGCAGAGGCTGG + Intronic
917839242 1:178964109-178964131 AAATAAGAGGAGTAAGAGGCTGG - Intergenic
917867778 1:179213680-179213702 CAATATAGGGAGGAAATGGATGG + Intronic
919949998 1:202354322-202354344 CAATAGATGGAGGCTGAGGCAGG + Intronic
921009787 1:211130137-211130159 GAATATAAAGAGAAACAGGCTGG + Intronic
921018873 1:211217830-211217852 CAAAATAAGGATGGAGAGGCAGG + Intergenic
921058597 1:211563683-211563705 TATTTTAAGAAGGAAGAGGCTGG + Intergenic
921454904 1:215359009-215359031 CAATATAAGGTTGTAGAGTCAGG + Intergenic
921730778 1:218575717-218575739 CAAAATGAGGAGGCAGAGGTGGG - Intergenic
922368298 1:224886350-224886372 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
922400408 1:225248385-225248407 CAAAATAAGATGGAAGAGGGGGG + Intronic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923753440 1:236768637-236768659 CAATATAATCAGGAAGAGTTGGG - Intergenic
924278630 1:242413193-242413215 CAAGATAGAGAGGAAAAGGCTGG - Intronic
924622142 1:245671645-245671667 CAATAAAAATAGGAAAAGGCAGG + Intronic
1063024060 10:2160558-2160580 CAATCTAATGAAAAAGAGGCCGG + Intergenic
1063451437 10:6152881-6152903 TAAAAAAAGGAAGAAGAGGCTGG + Intronic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064268336 10:13843215-13843237 CAATATACTGAGTCAGAGGCTGG - Intronic
1065966995 10:30778761-30778783 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1066187775 10:33027112-33027134 CAAAATAAGGAGCAAGATGGGGG + Intergenic
1066418237 10:35240832-35240854 AAATATAAAGAGGGAGAGGCCGG + Intergenic
1067513589 10:46916193-46916215 CAATATAAGTACTATGAGGCTGG - Intronic
1067648663 10:48135641-48135663 CAATATAAGTACTATGAGGCTGG + Intergenic
1067776636 10:49169038-49169060 CAAGATAAGTGGGAAGTGGCAGG + Intronic
1068926191 10:62541721-62541743 CAAGATAAGGAACAAGAGGAAGG + Intronic
1069025432 10:63535040-63535062 CAATAAAAGTAGGAAGAGAATGG + Intronic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1069926153 10:71851995-71852017 CTATTTCAGGAGGCAGAGGCAGG + Intergenic
1069950687 10:72016202-72016224 GAAAAAAGGGAGGAAGAGGCTGG + Intergenic
1070371062 10:75782499-75782521 CAATATAAAGTGGAAGAAGCCGG - Intronic
1071346512 10:84699047-84699069 CTATTTAGGGAGGAAGAGGCTGG + Intergenic
1071520450 10:86328898-86328920 CTATACAGGGAGGTAGAGGCTGG - Intronic
1072495301 10:95951396-95951418 CCATATAAGGAGGCCGAGGCAGG - Intronic
1073158663 10:101370407-101370429 CAGGATAAGGAAGAAGGGGCGGG - Intronic
1073357312 10:102867334-102867356 CACTTTTAGGAGGCAGAGGCAGG + Intronic
1073773388 10:106760146-106760168 TGATAAGAGGAGGAAGAGGCCGG + Intronic
1074583199 10:114740919-114740941 CACTCTCAGGAGGATGAGGCAGG + Intergenic
1074652918 10:115545121-115545143 CAATTTAGGGAGGCTGAGGCAGG + Intronic
1075237437 10:120743746-120743768 CATGATAAGGAGGCAGAGGCTGG + Intergenic
1075568972 10:123525216-123525238 CATTTTAAGGATAAAGAGGCTGG - Intergenic
1076028679 10:127139681-127139703 CAGCATCAGGTGGAAGAGGCAGG - Intronic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1077110794 11:861158-861180 CAATTAAAACAGGAAGAGGCAGG - Intronic
1077874670 11:6294098-6294120 CAAGAGAAGGAGGCAGGGGCAGG + Intergenic
1078177996 11:8985145-8985167 AAATTCAAGGAGCAAGAGGCCGG - Intronic
1078298017 11:10094748-10094770 CACTTTAAGGAGGCCGAGGCGGG - Intronic
1078555087 11:12318540-12318562 AATTTTAAGGAGGAAAAGGCAGG + Intronic
1079498590 11:21075392-21075414 TAATATCACAAGGAAGAGGCAGG + Intronic
1081005564 11:37732999-37733021 CAAGATAGGGAGGAAGAGAGAGG - Intergenic
1081455349 11:43216652-43216674 CAATTTTTGGAGGAAGAGGGTGG - Intergenic
1081976762 11:47240197-47240219 CACTATGAGGAGGAAGAGGATGG + Exonic
1081982583 11:47277591-47277613 AAATATATGTAGAAAGAGGCTGG - Intronic
1083690094 11:64402530-64402552 AAATAAAATGAGGAAGAGGAGGG - Intergenic
1084427967 11:69095906-69095928 CAGGAGGAGGAGGAAGAGGCTGG + Intergenic
1084612852 11:70214665-70214687 TAATATAAGAAGACAGAGGCCGG - Intergenic
1085632781 11:78133129-78133151 AAGTATTAGGAAGAAGAGGCTGG - Intronic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1089144565 11:116315759-116315781 CACTGAAAGAAGGAAGAGGCTGG + Intergenic
1089146257 11:116331526-116331548 CAAAATAGGCAGGAAGAGGGAGG + Intergenic
1089443744 11:118535291-118535313 CAAGTTAGGGAGGAAGAGGCAGG + Exonic
1089846451 11:121462391-121462413 CACCATAAGGATGAAGAGGGAGG - Intronic
1090360230 11:126167085-126167107 AAATACTTGGAGGAAGAGGCAGG + Intergenic
1090566462 11:127997391-127997413 CATTATATGGAGGAAGAAACTGG - Intergenic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1091774223 12:3173843-3173865 TAATTTAAGGAGGAGGAGGGAGG - Intronic
1092069589 12:5621846-5621868 AAAAAGAAGGAGGAAGAGGGAGG + Intronic
1092458165 12:8663224-8663246 GAATATAAGGAGGCTGAGGCAGG - Intergenic
1093435765 12:19132010-19132032 CAATATACCCAAGAAGAGGCAGG + Intronic
1094740870 12:33287027-33287049 CAAAGAAAGGAGGAAGAGTCTGG - Intergenic
1095537063 12:43261698-43261720 ATATACAAGGAGGAAGAGGAAGG + Intergenic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096498616 12:52052594-52052616 CCACAGGAGGAGGAAGAGGCGGG - Intronic
1096559299 12:52424345-52424367 CACTGTCAGGAGGGAGAGGCTGG + Exonic
1096707079 12:53429095-53429117 CAAAAGAGGGAGGAAGAGCCGGG + Intronic
1096839407 12:54371181-54371203 CAATATGAGGGGGAAGAGGGTGG + Intronic
1097223978 12:57466121-57466143 CACCTCAAGGAGGAAGAGGCAGG - Intronic
1098516852 12:71387488-71387510 CAATACAGGGAGGCTGAGGCAGG - Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1100075787 12:90781183-90781205 GCATTTAAGGAGGAAGAGCCTGG - Intergenic
1100361850 12:93886459-93886481 AAATGTAAGAAGCAAGAGGCAGG - Intronic
1100839350 12:98596433-98596455 AAATATTAGGAGGGAGAGGAAGG + Intronic
1101647337 12:106643369-106643391 CAAGATGAGGTGGGAGAGGCAGG + Intronic
1101875116 12:108592342-108592364 CAACAGAAGGATGAGGAGGCTGG + Exonic
1101992556 12:109499324-109499346 CCATATGAGGATGAAGTGGCAGG - Intronic
1102328090 12:112006235-112006257 AATTAAAAGGAGCAAGAGGCAGG + Intronic
1102847333 12:116199995-116200017 AAATAAAAGGAGGAAAAGTCCGG + Intronic
1103518131 12:121520669-121520691 CCACGTGAGGAGGAAGAGGCAGG + Intronic
1103832336 12:123789721-123789743 CAATGTGGGGAGGAACAGGCAGG + Intronic
1104092699 12:125529081-125529103 CAAAAGAAGAAGGAAGAGGAAGG - Intronic
1104300082 12:127557058-127557080 GAATAAAAGGAAGAAGGGGCAGG + Intergenic
1106654907 13:31732699-31732721 GAATAGGAGGAGGAAGTGGCTGG + Intergenic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108373563 13:49793123-49793145 CCCTATCAGGAGGAAGAGGGCGG + Intergenic
1108529341 13:51314446-51314468 AAATAAAAGTTGGAAGAGGCCGG + Intergenic
1109081548 13:57908365-57908387 GAATATAAGGTGGGAGTGGCAGG + Intergenic
1109641581 13:65198770-65198792 TAAAATAAGCAGGAAGAGGTAGG - Intergenic
1110018029 13:70433558-70433580 GAAGGAAAGGAGGAAGAGGCAGG + Intergenic
1110153824 13:72289291-72289313 CAACATAAGCTGGAAAAGGCAGG - Intergenic
1110342559 13:74409811-74409833 CAATAAGAGGAGGAACAAGCAGG + Intergenic
1111476112 13:88750179-88750201 CATTAAAAGGAGGCTGAGGCAGG + Intergenic
1111874082 13:93871086-93871108 CTCTAAAATGAGGAAGAGGCAGG + Intronic
1112185157 13:97120894-97120916 CAATATAAGAACAAAGAGGCTGG - Intergenic
1113429267 13:110235352-110235374 CAATAAAAGAAAGAAGATGCCGG + Intronic
1115023025 14:28706148-28706170 CACTTTTAGGAGGTAGAGGCAGG + Intergenic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1117670769 14:58103261-58103283 CACTAGAAGCTGGAAGAGGCAGG + Intronic
1118335601 14:64851202-64851224 CAGTACAAGGATTAAGAGGCAGG + Intronic
1118486839 14:66222430-66222452 TAATACAAGGAAGAAGAGGAAGG - Intergenic
1118814865 14:69303755-69303777 CAATAAAGGGAGGAAAGGGCAGG - Intronic
1119089335 14:71765888-71765910 CAATAAAAGGAAGAAAAGGAAGG - Intergenic
1119592793 14:75905867-75905889 AAATAAAAGGAGGGAGAGGTTGG - Intronic
1120815939 14:88858206-88858228 CACTTTAAGGAGGCTGAGGCGGG - Intronic
1121748419 14:96322631-96322653 CACTACCAGGAGGAAGAGGAAGG - Exonic
1123905797 15:24920148-24920170 GAAGGTAAGGAGGAAGAGGCTGG - Intronic
1124013840 15:25860433-25860455 GAATAGAAGGAGGAGGAGGCTGG - Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124492345 15:30165758-30165780 CCAGAGCAGGAGGAAGAGGCAGG - Intergenic
1124751191 15:32372559-32372581 CCAGAGCAGGAGGAAGAGGCAGG + Intergenic
1124898482 15:33799538-33799560 CAAGGTATGGGGGAAGAGGCAGG - Intronic
1125141229 15:36410202-36410224 GAGTATAAGGAAGAAGAGGAAGG - Intergenic
1125310221 15:38371196-38371218 AAAAAGAAGGTGGAAGAGGCTGG + Intergenic
1125409901 15:39395254-39395276 CAATGGAAGGAGAAAGAGGAAGG + Intergenic
1125751143 15:42029891-42029913 CAATTTAAGTTGGATGAGGCAGG + Intronic
1126212279 15:46113363-46113385 GAGTATAAGCAGGAAGAGGCTGG - Intergenic
1126870936 15:52986532-52986554 GAATATAAAGAGGAAGGGGAAGG + Intergenic
1127568528 15:60216883-60216905 CATTAGAGGCAGGAAGAGGCAGG - Intergenic
1128243449 15:66117159-66117181 GAAGATAAAGAGGAAGAAGCTGG + Intronic
1128463603 15:67890150-67890172 CAATATAATGAGGAAGAGAGGGG + Intergenic
1128668157 15:69553728-69553750 GAAGAGAAGGAAGAAGAGGCAGG - Intergenic
1128806407 15:70534290-70534312 CAACAGAAGGAAGAAGAGGAGGG + Intergenic
1128998690 15:72315924-72315946 CAGCCTGAGGAGGAAGAGGCTGG + Exonic
1129436111 15:75541816-75541838 CAATCTCAGGAGGCTGAGGCAGG - Intronic
1130121357 15:81050442-81050464 CAAGATAAGGCTGGAGAGGCAGG + Intronic
1130286670 15:82561095-82561117 CAATATAAACACGAAGAGGTGGG + Intronic
1130626886 15:85524468-85524490 TAATAAAAGCAAGAAGAGGCTGG - Intronic
1130801900 15:87273268-87273290 CACTACAAGCTGGAAGAGGCAGG + Intergenic
1131077282 15:89503290-89503312 ACATTTTAGGAGGAAGAGGCCGG - Intergenic
1131310303 15:91284522-91284544 CAATAATCGGATGAAGAGGCAGG - Intronic
1131364597 15:91827596-91827618 CAATGAAAGGAGGAAGGGGAGGG + Intergenic
1131553098 15:93374740-93374762 GAGGATAAGGAGGCAGAGGCAGG + Intergenic
1132940524 16:2504981-2505003 GAATTTAGGGAGGCAGAGGCGGG - Intronic
1133101718 16:3484076-3484098 AAAGTTAAGGAGGAAGAAGCAGG - Intronic
1133749148 16:8711358-8711380 CAAAGTAAGGAGGGAGAGGGTGG + Intronic
1134060005 16:11193696-11193718 CAGGATGAGGAGGAAGAGGGAGG - Intergenic
1134265068 16:12685671-12685693 CAAAATCAGGAGGAAAAGGGAGG - Intronic
1134491679 16:14700555-14700577 CAATAGAAGGAGGCAGAGAGAGG - Intergenic
1134497060 16:14739673-14739695 CAATAGAAGGAGGCAGAGAGAGG - Intronic
1136078578 16:27836455-27836477 GAAGAAAAGGAGGAAGAGGATGG - Intronic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136182391 16:28562654-28562676 CACTTTAAGGAGGCTGAGGCGGG + Intronic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136265272 16:29113377-29113399 CACTAGAAGCTGGAAGAGGCAGG - Intergenic
1137038068 16:35583961-35583983 TAAGAAAAGGAGGATGAGGCTGG + Intergenic
1137042788 16:35628677-35628699 CTATATAAGGAGGCAGAGTTAGG + Intergenic
1137644657 16:50063538-50063560 CAATATAAGGAGAAAGGTGGAGG + Intergenic
1137706943 16:50542132-50542154 AAAAATAAGCAGGAAGAAGCAGG - Intergenic
1137725445 16:50653657-50653679 CCAGCTAAGGAGGAAGAGGAAGG + Intergenic
1137763408 16:50959005-50959027 AAATAAAAGGAGGAAGACGCAGG - Intergenic
1138341947 16:56295758-56295780 GAATATTGGGAGGAAGAGGCAGG - Intronic
1138472655 16:57250412-57250434 CACCATAAGGATGAAGTGGCTGG + Exonic
1138989326 16:62371720-62371742 AAATAAAAGGAGGAAGAGAAGGG - Intergenic
1139509395 16:67418102-67418124 CACTTTAAGGAGGCTGAGGCAGG + Intergenic
1139946386 16:70645155-70645177 GAAGAGAAGGAGGAAGAGGAAGG + Intronic
1140926086 16:79585288-79585310 CAATACAAGGAAGAAGGGGAAGG - Intergenic
1140953274 16:79839341-79839363 AAAGATAGGGAGGTAGAGGCTGG - Intergenic
1141106361 16:81237053-81237075 AAACATACGGAGGCAGAGGCGGG - Intergenic
1141381868 16:83584215-83584237 CAAACTAAGGAGGCTGAGGCAGG + Intronic
1141414185 16:83857369-83857391 CAAGATAAGGAAGAAGGGGAAGG + Intergenic
1141571892 16:84939233-84939255 AAATACACGGAGGAAGAGGTAGG + Intergenic
1141942488 16:87286897-87286919 AAACACAAGGAGGAAGGGGCAGG + Intronic
1142054076 16:87981309-87981331 CACTAGAAGCTGGAAGAGGCAGG - Intronic
1143494202 17:7302055-7302077 TAAGACAAGGAGGTAGAGGCTGG - Intergenic
1143543898 17:7585288-7585310 CACTTTAAGGAGGCTGAGGCAGG + Intronic
1144161879 17:12568130-12568152 CAATGCAAGAAGGAATAGGCAGG + Intergenic
1144247711 17:13384068-13384090 CAATATTGGGAGGCCGAGGCAGG + Intergenic
1144310398 17:14008604-14008626 CAATATAAGAAGTACGAGCCTGG - Intergenic
1144958304 17:19030750-19030772 CAATTTTAGGAGGAAGGGACTGG - Intronic
1144976854 17:19143774-19143796 CAATTTTAGGAGGAAGGGACTGG + Intronic
1145251359 17:21298537-21298559 CAATGGAAGGAGTGAGAGGCAGG + Intronic
1145281897 17:21474152-21474174 CTGTATAAGGAAGAAGAGGGTGG - Intergenic
1145395552 17:22491468-22491490 CTGTATAAGGAAGAAGAGGGTGG + Intergenic
1146332696 17:31941211-31941233 AAAAATAAGGAGGCTGAGGCAGG - Intronic
1147636089 17:41965236-41965258 CAAGATCAGGAGAAACAGGCAGG + Exonic
1148067596 17:44883968-44883990 CTAAAAAAGGAAGAAGAGGCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148891105 17:50807797-50807819 CAATAGAAGCTGGAAGAGCCAGG + Intergenic
1149535551 17:57430913-57430935 CAAATTCAGGAAGAAGAGGCGGG - Intronic
1149765861 17:59277832-59277854 CAAAATAAAAAAGAAGAGGCCGG + Intergenic
1150050999 17:61962772-61962794 TGATATGAGGAGGAAGAGTCTGG + Exonic
1150296257 17:64009320-64009342 CAGTAGCAGGAGGAAGATGCTGG - Intronic
1151074408 17:71254656-71254678 CAAAATGAGGAGGAACAGGATGG - Intergenic
1151507190 17:74537130-74537152 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1155118742 18:22797016-22797038 TTATAAAAAGAGGAAGAGGCCGG - Intergenic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155735967 18:29222624-29222646 TAATATATGGAGAAAGAAGCAGG - Intergenic
1156587771 18:38450966-38450988 GATGATAAGGAGGAACAGGCCGG - Intergenic
1157302726 18:46491035-46491057 GAATATAGGAAGGAAGAGACAGG + Intronic
1158899062 18:61944950-61944972 AAAAATATGGAGGTAGAGGCTGG - Intergenic
1159072351 18:63640121-63640143 AAATAAAAGTAGGAAGAGGAGGG - Intronic
1159251878 18:65890028-65890050 GTATTTAAGGAGGCAGAGGCAGG - Exonic
1159621372 18:70642670-70642692 AAATAAGAGGAGGAAGAGGGAGG - Exonic
1161822259 19:6537066-6537088 CATAAAAAGGAAGAAGAGGCCGG - Intergenic
1164292689 19:23881819-23881841 TAAGAGAAGGAGGAAGAGGAGGG + Intergenic
1164691565 19:30214547-30214569 CAACATTAGGAGGCCGAGGCAGG - Intergenic
1164813002 19:31172914-31172936 GAATACAAGGAGGGAGTGGCAGG + Intergenic
1165303424 19:34987840-34987862 CAACAGAAGCTGGAAGAGGCAGG + Intergenic
1165386211 19:35511979-35512001 AAAAAAAAGGAGGAAGAGACGGG - Intronic
1165434328 19:35788106-35788128 GAAGAGGAGGAGGAAGAGGCAGG - Exonic
1165957750 19:39512333-39512355 CCATATAAGAAGCCAGAGGCTGG + Intergenic
1166037500 19:40179645-40179667 AAATGTGAGGAGGAAGAGGTAGG - Intergenic
1166231317 19:41427144-41427166 CAATAAATGGAGGGAGAGGGAGG - Intronic
1166607281 19:44155505-44155527 AATTATAAGGAGGAAGAGGAGGG + Intronic
1166778222 19:45325120-45325142 CAAAACAAGGAGGCTGAGGCAGG + Intergenic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167691916 19:50990626-50990648 GAATCTAAGGATGAAGATGCAGG - Intergenic
1167948707 19:53009773-53009795 CGATACAAGGAGGAAGGAGCTGG - Intergenic
925940417 2:8811855-8811877 GAAGCTGAGGAGGAAGAGGCGGG + Intronic
926997405 2:18751323-18751345 CAATACAAGAAGGCAAAGGCAGG - Intergenic
928702393 2:33912244-33912266 CAATTTAAGGATGGATAGGCTGG - Intergenic
929035610 2:37688597-37688619 GAATATATGAAGGAAGGGGCTGG - Intronic
929217354 2:39429246-39429268 CAATATTAGTAGGAAAAGCCAGG + Intronic
929590332 2:43141524-43141546 AAATATGAGGAGGCTGAGGCAGG - Intergenic
930237335 2:48900620-48900642 CCATGGAAGGAGGGAGAGGCTGG + Intergenic
931890804 2:66670002-66670024 AAATATAAGGAGGCCGAGGCAGG - Intergenic
933080498 2:77978657-77978679 CATTATAAGAAAGAAGCGGCTGG + Intergenic
933818887 2:86091815-86091837 CAATAAAAGTAGAAATAGGCCGG + Intronic
934037460 2:88100060-88100082 GAAAACAAGGAGGAAGAGGGGGG - Intronic
934574769 2:95392925-95392947 CAGGATGAGGAGGAAGGGGCTGG + Intergenic
935406012 2:102709383-102709405 CAATACTAGGAGGAGGAGGCAGG + Exonic
935868030 2:107413010-107413032 CAATACTAGGAGAAAGAGACGGG + Intergenic
936344034 2:111661665-111661687 GAATATTAGTAGGAAGGGGCTGG - Intergenic
936515918 2:113181587-113181609 CCTTCTAGGGAGGAAGAGGCTGG - Intronic
937546703 2:123030894-123030916 GAAGAGAAGGAGGAAGAGGAGGG - Intergenic
939320184 2:140609945-140609967 CGAGATAAGGTGGAAGAAGCAGG - Intronic
940595809 2:155791187-155791209 CAATATAAGGAGGGTGAGTCTGG - Intergenic
941192037 2:162396952-162396974 AAATATAAAGAAAAAGAGGCGGG + Intronic
942522334 2:176817489-176817511 CAGTCTGAGGAGCAAGAGGCTGG + Intergenic
942565068 2:177257888-177257910 CCATAGAAGGAGGTAGAGGATGG - Intronic
943033743 2:182715978-182716000 CAACGGAAGCAGGAAGAGGCGGG + Intergenic
943354681 2:186837195-186837217 CAGTATATGCAGGAAGAGGGAGG + Intronic
944146679 2:196514169-196514191 CACTAGAAGCAGGGAGAGGCCGG - Intronic
944191894 2:197012025-197012047 CACTATGAGGAGCAAGAGCCAGG - Intronic
944553932 2:200869537-200869559 CCAAAAAAGGAGGAAGGGGCAGG + Intergenic
944701651 2:202251239-202251261 AAAAAAAAGGAGGAAGAGGCCGG + Intergenic
944758362 2:202787351-202787373 CAAGTTATGGAGGAAGAGGGAGG + Intronic
946224189 2:218253922-218253944 GAATAAGAGGAGGAAGCGGCTGG + Exonic
946796727 2:223362329-223362351 CAATAGCAGGAAGAAGAAGCAGG - Intergenic
946960192 2:224976822-224976844 CAAAAGAAGGAGGAAGAGGGTGG - Intronic
947810371 2:233000391-233000413 TCATAAAAAGAGGAAGAGGCTGG - Intronic
948634171 2:239323714-239323736 GGATTTAAGGAGGAAGATGCCGG + Intronic
949048617 2:241884899-241884921 AAATTTTAGGAGGCAGAGGCAGG + Intergenic
1168912251 20:1458206-1458228 GAAGATGAGGAGGAAGAGGAAGG - Exonic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1169742117 20:8906328-8906350 AAATTCAAGGAGGAAGATGCAGG - Intronic
1170158570 20:13290257-13290279 CAATATGAGGAGGAGGAAGAGGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1172575948 20:36008723-36008745 CCATTTAAGGAAGAAGGGGCTGG + Intronic
1172925059 20:38526398-38526420 CAAGAAGAAGAGGAAGAGGCAGG - Intronic
1173674035 20:44818317-44818339 CACAAAATGGAGGAAGAGGCAGG + Intergenic
1174813315 20:53665829-53665851 CAAAAAAAAAAGGAAGAGGCCGG - Intergenic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1177676135 21:24302195-24302217 CAATATAAGTTGGAACAGGAAGG - Intergenic
1177902129 21:26929727-26929749 AAATATGAGAAGGAAGAGACAGG - Intronic
1180854228 22:19036223-19036245 CAGGCTAAGGTGGAAGAGGCTGG - Intergenic
1181943473 22:26497050-26497072 CAAGAGAACAAGGAAGAGGCAGG - Intronic
1182166916 22:28184341-28184363 TAATATAATGAGGAAGAAGGAGG - Intronic
1182640699 22:31764710-31764732 GAATTTAAGAAGGAAGAGGCTGG - Intronic
1182654971 22:31882918-31882940 CAAGAAAAGGAAGAACAGGCCGG - Intronic
1182928118 22:34146487-34146509 CAATTTTTGGAGGAAGAGGTAGG + Intergenic
1183226465 22:36553562-36553584 CAGGATAAGGTGGAAGAGGTGGG - Intergenic
1183564257 22:38601840-38601862 CAATCTGGGGAGGAACAGGCTGG + Intronic
949113442 3:291166-291188 CAAGGTAAAGAGGAAGAGGTTGG + Intronic
951185352 3:19706206-19706228 CTAGTTAAGGAGGAAGAGGAAGG + Intergenic
951781521 3:26368581-26368603 CAGTAAAAGGAGGAAGTGGGGGG + Intergenic
952367386 3:32686714-32686736 TAAAATAAGGAGGAAGATGTTGG - Intronic
952959056 3:38578406-38578428 CTATATAAGGAGAAACAGGCTGG - Intronic
953546745 3:43869119-43869141 CAATCTTATGAAGAAGAGGCAGG + Intergenic
954867031 3:53738353-53738375 CAATATAAAGAGGAAGGCACTGG + Intronic
954944875 3:54413528-54413550 AAATATAAAGAGAAAGGGGCAGG - Intronic
955012304 3:55030209-55030231 CAATACAGGGAGGATGTGGCTGG - Intronic
955020065 3:55111248-55111270 AGGTATAAGGAGGCAGAGGCTGG - Intergenic
955833638 3:63030420-63030442 CAAGAAGAGGAGGAAGAGGAAGG + Intergenic
956383348 3:68689326-68689348 TAAGATAAGGAGGAAGAGAAGGG - Intergenic
956865198 3:73362675-73362697 CAATATGTGGGGGAAGAGGCTGG - Intergenic
957720793 3:83995718-83995740 CAGTAGCAGGAGGAAGGGGCAGG + Intergenic
957772185 3:84708045-84708067 CTGTTTAAGGAGGAAGAGGCGGG - Intergenic
959409754 3:106006282-106006304 CAATATATGTGGGGAGAGGCTGG - Intergenic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959686637 3:109154507-109154529 CATTATCAGGAGGCTGAGGCAGG + Intergenic
960331842 3:116369565-116369587 AAAGAAAAGGAGGAAGAGGAGGG + Intronic
962368202 3:134799695-134799717 CAATAGAAGGCAGAAGGGGCTGG - Intronic
963166739 3:142211951-142211973 GAATGTAAGGAGGAATGGGCTGG - Intronic
963238970 3:142984086-142984108 GCATATAACGAGGAAGAGGTGGG + Intronic
963756820 3:149243091-149243113 CAATCCAAGGAGGATGACGCGGG - Intergenic
963855287 3:150247180-150247202 ACATATAAGAAGGAATAGGCTGG - Intergenic
963949782 3:151186447-151186469 CAAGATGAGGTGGAAAAGGCAGG - Intronic
964337008 3:155665613-155665635 CAATCTAAGGAAGAAGAGGCTGG + Intronic
964658414 3:159093578-159093600 CATGATGAGGAGGTAGAGGCTGG + Intronic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
964824402 3:160809358-160809380 CCATGTAGGGAGGAAGAGGGAGG - Intronic
966473868 3:180322456-180322478 GAATATAAGCAGGCAGAGGCTGG - Intergenic
967121873 3:186389416-186389438 CAATATAAGGAGGCAGAAACTGG + Intergenic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
967542620 3:190684997-190685019 CATTATACAGAGGAGGAGGCTGG - Intergenic
967687807 3:192437899-192437921 CAAAAGAAGGAAGGAGAGGCAGG - Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968979051 4:3836906-3836928 CAACATCAGGAGGCAGAGCCTGG - Intergenic
969092413 4:4704871-4704893 CAATCTCAGGAGGCTGAGGCAGG - Intergenic
969938662 4:10708096-10708118 CAATGACAGGAGGAAGTGGCAGG + Intergenic
969944779 4:10772041-10772063 AAATATAAGAATGAAGAGACAGG + Intergenic
969967055 4:11007908-11007930 CAATAGAAAGATGAAGAAGCAGG + Intergenic
970372244 4:15419632-15419654 AAATATCAGGAGGAAAAGGTAGG - Intronic
970672688 4:18414668-18414690 CAATGAAAGGGGGAAGAGGGAGG + Intergenic
971040373 4:22745062-22745084 CAGTATAAGGAGGAATAGAATGG - Intergenic
971202959 4:24529833-24529855 CTACATAATTAGGAAGAGGCAGG + Intronic
971802863 4:31315687-31315709 CTATAGAAGGTGGTAGAGGCAGG - Intergenic
972144936 4:36011659-36011681 CAATATAAGGAGGAGAATGAGGG - Intronic
972422286 4:38899986-38900008 CTATCTAAGCAGAAAGAGGCTGG + Intronic
972633987 4:40866484-40866506 CAAAGTGAGGAGGAAGAGGGAGG - Intronic
972695601 4:41442781-41442803 CAATAGAGGGAGGAAGGGGTAGG - Intronic
973063648 4:45761716-45761738 CAATAAAAGAATGAAGAGGGCGG + Intergenic
973272668 4:48277671-48277693 AAATACAAGAAGGAAGTGGCAGG + Intergenic
974042624 4:56870600-56870622 CAATATTAAGGAGAAGAGGCTGG + Intergenic
974506669 4:62783058-62783080 CATTAAAAGGAAGATGAGGCAGG + Intergenic
974723754 4:65773694-65773716 CAGTATAGGGAGGAAGTGGGTGG + Intergenic
974907430 4:68075696-68075718 CAACATAAGAAAGAATAGGCTGG + Intronic
975730012 4:77328604-77328626 GAATATAAGGAGTAAAATGCAGG - Intronic
976633486 4:87263947-87263969 CAGTATCAGGAGGCAGAGGCAGG - Intergenic
976851901 4:89557335-89557357 AAAGATAAGGAGGAGCAGGCAGG + Intergenic
977269362 4:94897224-94897246 CTATATAAGCAGGAAGAGCTGGG - Intronic
977901139 4:102423757-102423779 AAATATAAGGAGGAATAAGGTGG - Intronic
978243894 4:106549209-106549231 CACTTTGAGGAGGAGGAGGCAGG - Intergenic
978665710 4:111178574-111178596 CAAGAGAAGGAGAAAGAAGCAGG - Intergenic
978830820 4:113082383-113082405 AAATTTAGGGAAGAAGAGGCAGG - Intronic
980714228 4:136611178-136611200 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
981125470 4:141101397-141101419 CAATATATGGAGGTAGAGGACGG - Intronic
981327185 4:143463374-143463396 CACTTTAAGGAGGCCGAGGCAGG + Intronic
981492159 4:145351074-145351096 CGATATAAGTAACAAGAGGCGGG + Intergenic
982003767 4:151045589-151045611 GCATTTAAGGAGGCAGAGGCAGG + Intergenic
982752389 4:159177975-159177997 AAACATAAGGAGGAAGAGAAAGG - Intronic
984428730 4:179621380-179621402 CAATAAAAAGAGTGAGAGGCAGG - Intergenic
984931417 4:184850852-184850874 AAGTATAAGAAGGCAGAGGCTGG - Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
986050394 5:4084548-4084570 CAAAATCAGGAGGGAGAAGCTGG - Intergenic
986454162 5:7899042-7899064 CAAGAGAGGGAGCAAGAGGCAGG + Intronic
986698410 5:10379202-10379224 AAATAAAAGGATAAAGAGGCAGG - Intronic
987065355 5:14284912-14284934 CAGCCTAAGCAGGAAGAGGCAGG - Intronic
987614452 5:20254356-20254378 CAACTTTAGGAGGATGAGGCAGG - Intronic
988449860 5:31330769-31330791 CAAACTAACTAGGAAGAGGCAGG + Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988721374 5:33882478-33882500 CAAAATAAGGAGGTAGTGGTAGG - Intronic
988888445 5:35585948-35585970 AAATTGAAGGAGGATGAGGCAGG + Intergenic
988983514 5:36595342-36595364 CAACTTTAAGAGGAAGAGGCCGG + Intergenic
989310863 5:40016342-40016364 AAATATAGGGAGGCTGAGGCAGG + Intergenic
989370623 5:40703604-40703626 AAAATTTAGGAGGAAGAGGCCGG + Intergenic
991106085 5:62843569-62843591 CAAGATAATGAGGAAATGGCTGG + Intergenic
992307207 5:75453945-75453967 CAACATCTGGAGGAAGAGGTCGG - Intronic
992309222 5:75478014-75478036 GAAGATTAGAAGGAAGAGGCCGG + Intronic
994032101 5:95155274-95155296 TATTATAAGGAAGGAGAGGCAGG + Intronic
994497158 5:100527933-100527955 CAACAAAAGGTGGAAGAGGAAGG + Intergenic
995992727 5:118262602-118262624 CATTTTAAAGAAGAAGAGGCGGG - Intergenic
997006862 5:129827412-129827434 GAATACAAGAGGGAAGAGGCAGG + Intergenic
997044841 5:130302581-130302603 AAAAATAATGAGGAAGTGGCCGG + Intergenic
997063040 5:130529690-130529712 CACCATAAGGATGAAGTGGCTGG + Intergenic
998540995 5:142981458-142981480 GAATATAGGGAGGCAGAGGAAGG - Intronic
998597683 5:143550767-143550789 AAAAAGAAGGAGGAAGAGGAGGG - Intergenic
998642274 5:144024599-144024621 CAAGATGAGGAGGAAGAGTCAGG + Intergenic
999390196 5:151184071-151184093 CAATATAGGGAGGAGGAAACAGG - Intronic
999909560 5:156182914-156182936 CAAGAGCAGGAGGAAGAGGAAGG - Intronic
1000824117 5:166022799-166022821 TCAGATAAGGAGGAAGAGACAGG - Intergenic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1003123680 6:3338439-3338461 CCAGCTAAGGAGGATGAGGCAGG - Intronic
1003393219 6:5731270-5731292 GAAGAGAAGGAGGAAGAGGAAGG - Intronic
1004066112 6:12246086-12246108 CCATATGAGTAGGAAGAGGGAGG - Intergenic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005434840 6:25797842-25797864 AAAAATAGGGAGGACGAGGCGGG - Intronic
1005468677 6:26140675-26140697 CAGATTAAGGATGAAGAGGCTGG + Intergenic
1005492461 6:26359408-26359430 CAATAAAAGAAGAAAGAGGCTGG - Intergenic
1005904179 6:30246487-30246509 CAATATAAGAAAAAATAGGCTGG - Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1007208096 6:40169173-40169195 AAGTTTAAGGAGGAAGAGGATGG - Intergenic
1007547846 6:42707956-42707978 AAATATAAGGAAGCAGAGGCAGG - Intronic
1007906645 6:45467927-45467949 AACTTTAAGGAGAAAGAGGCTGG - Intronic
1008179690 6:48313004-48313026 AAATAGAAGGAGGAAGAGGCAGG + Intergenic
1008539397 6:52533793-52533815 TACTATAAAGAGGAAAAGGCCGG + Intronic
1009392003 6:63155757-63155779 TAGTATAGGGAGGATGAGGCAGG - Intergenic
1010074288 6:71782979-71783001 CAAGAGAAGGAGGAAGAGCGAGG + Intergenic
1010764067 6:79758489-79758511 CAATATAAAGAGGAACAAGGTGG - Intergenic
1011261264 6:85472162-85472184 CAAGGAAAGGAAGAAGAGGCTGG + Intronic
1011543006 6:88453161-88453183 AAATATAAAGATGAACAGGCTGG - Intergenic
1011899772 6:92277557-92277579 CAAGAAGAGGAGGCAGAGGCAGG - Intergenic
1012272211 6:97227396-97227418 CAAAACAAGAAGGAAGAGGAGGG - Intronic
1012893565 6:104924043-104924065 CAATACATTGAGGAAGAGACTGG + Intergenic
1012984862 6:105865236-105865258 CAATAGAAAGAGCAAGAAGCTGG + Intergenic
1015206909 6:130650527-130650549 CAAAATAAGTAGCAAGAGGAAGG + Intergenic
1015468300 6:133573480-133573502 CAAAAGAAGGAGGCATAGGCGGG + Intergenic
1015521885 6:134139899-134139921 GAAGAGAAGGAGGAAGAGGAAGG - Intergenic
1015686664 6:135870829-135870851 CAATGTAAAGAGGAAGAGGGTGG + Intronic
1015796235 6:137014704-137014726 TAATATAAGGTGGAAAAGGGGGG - Intronic
1017086985 6:150722646-150722668 TTAAAAAAGGAGGAAGAGGCAGG - Intronic
1017089162 6:150743221-150743243 AAAAATAAAAAGGAAGAGGCTGG + Intronic
1017149020 6:151261258-151261280 CAATCTCAGGAGGCTGAGGCAGG + Intronic
1017388741 6:153914844-153914866 CTTTATAAGGAGGTTGAGGCAGG - Intergenic
1017585460 6:155917045-155917067 CAATATGATGAGAAAGAGGCAGG + Intergenic
1017595355 6:156022345-156022367 AAATTAAAGGAGGCAGAGGCGGG + Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017763287 6:157587623-157587645 CAATGGCAGGAGGAAGAAGCAGG - Intronic
1017898561 6:158701853-158701875 CACTAGAAGCAGGAAGAGGGAGG - Intronic
1020164955 7:5800495-5800517 AAAGGTAAGGAGGCAGAGGCAGG - Intergenic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020811643 7:12856224-12856246 CAAAAGAAGGAGGAAGTGGAGGG + Intergenic
1020937377 7:14484506-14484528 CAATAGCAGGAGCAAGAGGTGGG - Intronic
1022037810 7:26550571-26550593 AAAAATGAGGAGGAAGAGGGAGG + Intergenic
1023149145 7:37183407-37183429 GACAATGAGGAGGAAGAGGCAGG + Intronic
1023532738 7:41175397-41175419 CAAGAGAGGGAGGAAGAAGCTGG - Intergenic
1026775189 7:73226788-73226810 CTCCAGAAGGAGGAAGAGGCCGG + Intergenic
1026876646 7:73883023-73883045 CAAAATAAGGGGGTTGAGGCTGG + Intergenic
1027016046 7:74780159-74780181 CTCCAGAAGGAGGAAGAGGCCGG + Intronic
1027071983 7:75165778-75165800 CTCCAGAAGGAGGAAGAGGCCGG - Intergenic
1027364236 7:77440648-77440670 GGAAATAAGGATGAAGAGGCAGG + Intergenic
1027764176 7:82318841-82318863 CAATAGAAAGAGGAAGAAGAAGG + Intronic
1027942649 7:84704583-84704605 CACTAGAAGCTGGAAGAGGCAGG - Intergenic
1028256235 7:88601312-88601334 GGATATAAGGAGGGAGAGGAAGG - Intergenic
1029191441 7:98774991-98775013 CACTAGAAGCTGGAAGAGGCAGG + Intergenic
1030713552 7:112782918-112782940 CAATGGGAGGAGGAAGAGGCTGG - Intronic
1035099648 7:156385966-156385988 CAAGAAAAGGAGTAAAAGGCAGG + Intergenic
1035161494 7:156953527-156953549 CAATACAAGGGGGAAGGGGGTGG - Intronic
1038016127 8:23516732-23516754 CAATATCAGCAGGAAGGGGGTGG - Intergenic
1038422443 8:27442036-27442058 AACTCTAAGGAGGAAGAGTCAGG - Intronic
1039345371 8:36698122-36698144 CACTAGTAGGAGAAAGAGGCGGG + Intergenic
1040435465 8:47386848-47386870 GAAAATAAGGAGGAAGTGGGGGG + Intronic
1040596034 8:48838671-48838693 CAATGCAAGGAGGAAGTGCCTGG - Intergenic
1040754627 8:50757973-50757995 TAATAGAAGGAAGGAGAGGCAGG - Intronic
1041187130 8:55312859-55312881 CAAGACAAGGAGAAAGAGACTGG + Intronic
1041465083 8:58150510-58150532 AAATGGAATGAGGAAGAGGCCGG - Intronic
1042037981 8:64558272-64558294 CAATATAAGAAGTAAGATGTGGG - Intergenic
1042991079 8:74640537-74640559 CAATTCAAAGAGAAAGAGGCAGG + Intronic
1044140058 8:88639245-88639267 CACTATAAGGAGGCCAAGGCGGG - Intergenic
1047203861 8:122787865-122787887 TAAGTTAAGGAGGAAGTGGCAGG + Intronic
1047792271 8:128216388-128216410 CAATGAAAGGTGGAAGAGGGAGG - Intergenic
1050335906 9:4589877-4589899 TAATATAAAGAAGAAGAAGCAGG + Intronic
1050639625 9:7653433-7653455 CAATATCCGGAGGGAAAGGCCGG - Intergenic
1050846207 9:10223221-10223243 TAAGAAAAGGAGGAAGAGGAAGG - Intronic
1050964815 9:11785762-11785784 CAATATCATAAGGAAGATGCAGG - Intergenic
1051642669 9:19238376-19238398 CACTAGAAATAGGAAGAGGCTGG - Intronic
1051975688 9:22945234-22945256 CAATATTTGGAGCAAGAAGCAGG - Intergenic
1052730394 9:32278535-32278557 CATTATCAGAGGGAAGAGGCTGG - Intergenic
1052842021 9:33300170-33300192 TAATCCAAGGAGGATGAGGCAGG - Intronic
1055599560 9:77901519-77901541 CGGCCTAAGGAGGAAGAGGCAGG - Intronic
1056186708 9:84142165-84142187 CACCAGAAGGTGGAAGAGGCGGG + Intergenic
1057230005 9:93316036-93316058 CAATATGGAGAGGAAGGGGCTGG - Intronic
1058360536 9:104141698-104141720 TAAAATACGGAGGAAGAGACAGG + Intergenic
1059100300 9:111465024-111465046 AAATACAAGGAGGCTGAGGCAGG + Intronic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059815050 9:117902946-117902968 CAATAGCAGGAGGAAGAGGTAGG + Intergenic
1061615360 9:131775477-131775499 TAACAGAAGGAGGAAGTGGCAGG - Intergenic
1061634112 9:131895173-131895195 CAATATACGGATGAAGACGAGGG + Intronic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1187469731 X:19558561-19558583 GAATTTAAGGAGGAAAAGGAAGG - Intronic
1187909594 X:24098789-24098811 GAATTTAGGGAGGCAGAGGCAGG + Intergenic
1188748823 X:33880810-33880832 AAATATAAGCATGATGAGGCCGG - Intergenic
1190272736 X:48879001-48879023 AAATAAAAAGATGAAGAGGCTGG + Intergenic
1190386459 X:49886495-49886517 CAATATCAGGAGGCTGAGGTGGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1193949975 X:87785758-87785780 CAATATAAAGAGCAAGAGAGAGG + Intergenic
1197679564 X:129367774-129367796 CTAACTAATGAGGAAGAGGCAGG + Intergenic
1198463925 X:136888015-136888037 AAAAAAAAGGAAGAAGAGGCTGG - Intergenic
1199784097 X:151088963-151088985 GAATATAAGGAGAAAGAGTAGGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic