ID: 900575931

View in Genome Browser
Species Human (GRCh38)
Location 1:3382444-3382466
Sequence GACACAGCTGTGCCCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 505}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900575931_900575934 0 Left 900575931 1:3382444-3382466 CCTGCCTGGGGCACAGCTGTGTC 0: 1
1: 0
2: 4
3: 46
4: 505
Right 900575934 1:3382467-3382489 TGCAGAAGCTGGTAACACAGAGG 0: 1
1: 1
2: 1
3: 16
4: 263
900575931_900575936 13 Left 900575931 1:3382444-3382466 CCTGCCTGGGGCACAGCTGTGTC 0: 1
1: 0
2: 4
3: 46
4: 505
Right 900575936 1:3382480-3382502 AACACAGAGGCTGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 20
4: 224
900575931_900575935 12 Left 900575931 1:3382444-3382466 CCTGCCTGGGGCACAGCTGTGTC 0: 1
1: 0
2: 4
3: 46
4: 505
Right 900575935 1:3382479-3382501 TAACACAGAGGCTGTCTCCCTGG 0: 1
1: 0
2: 0
3: 28
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900575931 Original CRISPR GACACAGCTGTGCCCCAGGC AGG (reversed) Intronic
900083820 1:877230-877252 TCCACAGCTGTGCTCCAGGTGGG - Intergenic
900575931 1:3382444-3382466 GACACAGCTGTGCCCCAGGCAGG - Intronic
900710015 1:4107756-4107778 GACCCAGCTGTCCTCCTGGCTGG - Intergenic
900974814 1:6010542-6010564 GACACAGCTGTGGCTCATCCAGG - Intronic
900997819 1:6131859-6131881 GAGACAGCTGGGACCCAGGCAGG + Intronic
901062925 1:6481499-6481521 GACGGAGTTTTGCCCCAGGCTGG - Intronic
901594305 1:10372657-10372679 GACAGAGCTGTCACCCAAGCTGG + Intronic
901630249 1:10644445-10644467 GGGACAGCTGTGTGCCAGGCTGG - Intronic
901736881 1:11318347-11318369 GACAGAGTTTTGCTCCAGGCTGG + Intergenic
902167763 1:14586008-14586030 GACACAGCTGTTCCCTAGTGGGG + Intergenic
902630472 1:17701640-17701662 GAGGCAGCTGTGAGCCAGGCCGG + Intergenic
903251907 1:22060305-22060327 GTCTCAGCTGTCACCCAGGCTGG - Intronic
903492385 1:23739389-23739411 GAGACAGTTGTTGCCCAGGCTGG + Intergenic
903492413 1:23739552-23739574 GAGACAGTTGTTGCCCAGGCTGG + Intergenic
903774447 1:25783647-25783669 GAGATACCTGTGCCCCACGCAGG - Exonic
903869352 1:26422050-26422072 CACACAACTGTGCTCCAGGCTGG - Intronic
904165897 1:28554812-28554834 GTCTCAGCTGTCGCCCAGGCTGG - Intronic
904167309 1:28565741-28565763 CACACAACTGTGCTCCAGCCTGG + Intronic
904807500 1:33142209-33142231 AACAGAGCTGGGACCCAGGCAGG + Intergenic
904936260 1:34131796-34131818 GACAGAGCTGTGCCACTGGATGG - Intronic
905277145 1:36825620-36825642 GACACAGCTGACCCCCAGGTAGG + Exonic
905443481 1:38009278-38009300 GACACACCTGTTTCCCAGGGAGG - Intronic
905480672 1:38259805-38259827 GACACATGAGTGCTCCAGGCAGG - Intergenic
906162295 1:43659247-43659269 CACACCACTGTGCTCCAGGCTGG + Intronic
907394027 1:54177245-54177267 GCTGCAGCTGTGGCCCAGGCAGG + Intronic
910258744 1:85276267-85276289 AACGCAGCTGTGCCCAGGGCGGG - Intronic
910688223 1:89939852-89939874 CACACAGCTGGGGCCAAGGCAGG - Intergenic
910866596 1:91793760-91793782 CACACAACTGTGCTCCAGCCTGG + Intronic
912008347 1:104931311-104931333 CACACGGCTGTACCCCAGCCTGG + Intergenic
912558460 1:110533292-110533314 GCCACAGCTATGCTCCAGGATGG - Intergenic
913184545 1:116357379-116357401 CACACCGCTGTGCTCCAGCCTGG - Intergenic
913539244 1:119803131-119803153 GACCCAGCTGTGCTCCTGGATGG - Exonic
914892625 1:151640419-151640441 CACACCACTGTACCCCAGGCTGG - Intronic
915932761 1:160070195-160070217 GGCCCAGCTCTGCCCCCGGCCGG - Exonic
916169071 1:161987059-161987081 GCTATAGATGTGCCCCAGGCTGG + Intronic
917457745 1:175200133-175200155 GACTGAGCTGGGACCCAGGCAGG - Intergenic
917508071 1:175647092-175647114 CACACAATTTTGCCCCAGGCAGG + Intronic
918372564 1:183875847-183875869 GACAGAGCTGTCGCCCAGGCTGG - Intronic
919748497 1:201023033-201023055 CACCCAGCTCTGGCCCAGGCCGG - Intronic
919748583 1:201023357-201023379 GACGCAGCAGTCCCCCTGGCCGG + Exonic
919793175 1:201305485-201305507 GACAGATCTGTAGCCCAGGCTGG - Intronic
920326741 1:205170842-205170864 GTCACATCTGTGCTCCAAGCAGG - Intronic
920581357 1:207111134-207111156 GAGACAGCTGAGAGCCAGGCAGG - Intronic
921049970 1:211504310-211504332 GCCAGACCTGTCCCCCAGGCAGG + Intergenic
921327737 1:214004181-214004203 GTCACATCTGTGCCGCAGCCTGG - Intronic
922490480 1:226012481-226012503 GAGACGGCTGTCGCCCAGGCTGG - Intergenic
922531152 1:226346216-226346238 GTCACACTTGTCCCCCAGGCTGG - Intergenic
922966014 1:229691495-229691517 GATACATCAGTGTCCCAGGCGGG + Intergenic
923002631 1:230020237-230020259 GACACAGCTGGTCACCGGGCAGG - Intergenic
923271367 1:232358114-232358136 GGCACAGCTGTCCACCAGGCAGG + Intergenic
923423539 1:233844819-233844841 GACATAGCTGTGGCCAAGACTGG - Intergenic
923499338 1:234551311-234551333 GAGACAGCTAGGCCCCATGCTGG + Intergenic
1062819910 10:527018-527040 CAGACAGCTGTCCCCCAGGACGG - Intronic
1063448850 10:6137630-6137652 GACAGGACTGTGGCCCAGGCTGG - Intergenic
1063456388 10:6185558-6185580 GACCCAGATGAGCCCCTGGCTGG - Intronic
1064410247 10:15098252-15098274 GACATAGCAGTCGCCCAGGCTGG + Intronic
1064524560 10:16240453-16240475 GTCTCAGCTGTTGCCCAGGCTGG - Intergenic
1065803913 10:29377444-29377466 CACACAGCTGTACTCCAGCCTGG + Intergenic
1066039990 10:31539504-31539526 GACAGAGCCTTGCTCCAGGCTGG + Intergenic
1066441204 10:35440625-35440647 CACAAAGCTGTGCCCCGGACAGG - Intronic
1067088927 10:43256842-43256864 GAAACAGCTGGGCCCCAAGATGG - Intronic
1067374766 10:45717658-45717680 GACACAGCTGTGAGCCAGTGTGG + Intergenic
1067563710 10:47321861-47321883 GAGGATGCTGTGCCCCAGGCTGG - Intergenic
1067882579 10:50059296-50059318 GACACAGCTGTGAGCCAGTGTGG + Intergenic
1067912321 10:50358500-50358522 GACACAGGTTTTGCCCAGGCTGG - Intronic
1068657978 10:59593836-59593858 GTGGCAGCAGTGCCCCAGGCAGG - Intergenic
1068711573 10:60140949-60140971 AACAAAGCAGTGGCCCAGGCGGG + Intronic
1069751933 10:70750416-70750438 GGCAGAGATGTGCCCCAGTCAGG - Intronic
1070307700 10:75249423-75249445 GACACAGCTGTCTCCCAGGCTGG + Intergenic
1070717265 10:78731810-78731832 GACACTGCAATGCCCAAGGCAGG - Intergenic
1071561225 10:86648415-86648437 GACACAGCCATGCCCCAGAATGG - Intergenic
1072549911 10:96469544-96469566 GTGACAGCTGTCACCCAGGCGGG - Intronic
1072649550 10:97283975-97283997 GACACCACTGTGCTCCAGCCTGG - Intronic
1073061947 10:100738433-100738455 CAGACAGCTGTGTTCCAGGCGGG - Intronic
1073248994 10:102110435-102110457 CTCACAGCTGTTCCCCAGGGAGG - Intronic
1073434948 10:103510691-103510713 GACACAGATGTTTCTCAGGCAGG - Intronic
1075021523 10:118956059-118956081 GATCCAGCTGTGCCTCAAGCTGG + Intergenic
1075120386 10:119660206-119660228 GACCCTTCTGTGCCCCAGCCTGG + Intronic
1075140377 10:119828670-119828692 GAGACAGATGTTTCCCAGGCTGG - Exonic
1075758016 10:124831579-124831601 GAGACTGCTCTGCCCCAGCCAGG - Intronic
1076192998 10:128495965-128495987 GCAACAGCTGGCCCCCAGGCGGG - Intergenic
1076331699 10:129675151-129675173 GACCCAGCTGAGGGCCAGGCGGG + Intronic
1076333724 10:129691231-129691253 GACACAGCTGTGCCACACTGGGG - Intronic
1076536557 10:131181540-131181562 TGCACAGGTGTGCCCCTGGCAGG + Intronic
1076591869 10:131588962-131588984 GAGACAGCTGTCCCACAGGCAGG - Intergenic
1076631886 10:131856542-131856564 GTCACAGCTGTGCCCAGGTCGGG + Intergenic
1077450917 11:2645058-2645080 GACAGAGCTGGGCCACAGGGTGG + Intronic
1080658258 11:34275022-34275044 GACTCACCTGGGCTCCAGGCTGG + Intronic
1081964462 11:47161242-47161264 GACACGGCTGTGCCCCATCTGGG + Intronic
1084386403 11:68845367-68845389 GACTCAGCTGTGCTCTTGGCAGG - Intergenic
1084409875 11:69000632-69000654 GGCAGGGCTGTGCCCAAGGCTGG + Intergenic
1084945970 11:72638631-72638653 AACACTGCTGTGTACCAGGCAGG - Intronic
1085048594 11:73367873-73367895 GGCACATGTGTGCCCCTGGCTGG - Exonic
1085320000 11:75568339-75568361 GGGACAGCTGTGCCCTGGGCAGG - Intronic
1085442938 11:76579714-76579736 GACACAGCTCTGCCCTTGACGGG + Intergenic
1086784850 11:90955428-90955450 GACTGAGCTGTTGCCCAGGCTGG - Intergenic
1088377680 11:109159911-109159933 GACACAGGTGGGACACAGGCTGG + Intergenic
1089055984 11:115585317-115585339 GACCCACCTGAGCCTCAGGCAGG + Intergenic
1089146168 11:116330981-116331003 AACACTGCTGTGCCCAAGACTGG + Intergenic
1089353286 11:117833564-117833586 GTCACAGCTGAGCTCCAGGGGGG - Intronic
1089491714 11:118888073-118888095 GAACCAGCTCAGCCCCAGGCAGG + Intronic
1089689883 11:120180685-120180707 GAGAAAGCTGGGGCCCAGGCTGG - Intronic
1090079435 11:123602004-123602026 GAGGCAGATGTGTCCCAGGCAGG + Intronic
1090184540 11:124728043-124728065 CACACGGTTGTGCCACAGGCTGG + Intergenic
1091227852 11:133968445-133968467 CACACCCGTGTGCCCCAGGCTGG + Intergenic
1091407051 12:215515-215537 GCCACAGCTGACCCCCAGCCCGG - Intergenic
1092004362 12:5056682-5056704 GAGTGAGCTGTGCCCCAGGAGGG + Intergenic
1092126608 12:6079153-6079175 GGCACAGCTGAGAGCCAGGCAGG + Intronic
1093732609 12:22582951-22582973 CACACCACTGTACCCCAGGCTGG + Intergenic
1094197516 12:27764865-27764887 GAGACAGCTGTTACTCAGGCTGG + Intronic
1094525772 12:31229688-31229710 CACACACCAGAGCCCCAGGCTGG + Intergenic
1094813292 12:34162485-34162507 TCCACAGCTGTGCTCCAGGTGGG + Intergenic
1095521709 12:43074413-43074435 GGCACCGCTGTACTCCAGGCTGG - Intergenic
1096527317 12:52218575-52218597 CACACCGCTGTACCCCAGCCTGG - Intergenic
1098148531 12:67522546-67522568 GATACAGGTCTGTCCCAGGCTGG - Intergenic
1099527066 12:83728917-83728939 GGCACCACTGTGCTCCAGGCTGG + Intergenic
1099574436 12:84362299-84362321 GCTACAGCTGTGCCCAGGGCAGG - Intergenic
1100224662 12:92544125-92544147 GGCACTGCTTTGCCCCAGACTGG + Intergenic
1100987399 12:100216197-100216219 CACACCGCTGTGCTCCAGCCTGG - Intronic
1101285677 12:103309844-103309866 GACAAAGCTGTGGCTCAGGAGGG - Intronic
1101911525 12:108863621-108863643 CACAGAGCTGTCACCCAGGCTGG + Intronic
1101943820 12:109120779-109120801 GGCAGAGCTGGGCCCCGGGCTGG - Intronic
1101998389 12:109541262-109541284 GACCAAGCAGTGACCCAGGCCGG + Intergenic
1102257737 12:111425807-111425829 GGCACCGCTGAGCCCCAGGCAGG + Intronic
1102408260 12:112693297-112693319 GACACAGCTGTCACTCTGGCTGG + Intronic
1102413203 12:112738234-112738256 CACACAGCTGTACTCCAGCCTGG - Intronic
1102588900 12:113942637-113942659 GTCATATCTGTCCCCCAGGCTGG + Intronic
1103901382 12:124305310-124305332 GACTCAGCTGTGCCGAAGCCTGG + Intronic
1105005334 12:132717806-132717828 GACACAGCTGCCCCCCGGGGAGG - Intronic
1105355500 13:19655823-19655845 GAAATAGCTGTCACCCAGGCGGG + Intronic
1105802696 13:23922654-23922676 GACACAATTGTGCCCCAGTCTGG - Intergenic
1106999632 13:35527604-35527626 GGCACTGCTGTGACCCAGCCGGG - Intronic
1107767215 13:43749459-43749481 GGCACCTCTGTGCCCAAGGCTGG + Intronic
1108211545 13:48144602-48144624 GACACAGACGTGACCCTGGCAGG + Intergenic
1109779881 13:67095207-67095229 GACACAGCTGTATCCCATGCTGG - Intronic
1110441702 13:75533369-75533391 GACAGGGCTGTTGCCCAGGCTGG - Intronic
1111721925 13:91956472-91956494 GTGACAGCTGTGGGCCAGGCAGG - Intronic
1111735865 13:92138474-92138496 CACACCGCTGCGCTCCAGGCTGG + Intronic
1111857026 13:93651392-93651414 GAAACAGCTGAGCCTCAGGAAGG + Intronic
1112629987 13:101149953-101149975 GACACTGCTGTGGCCAAGGGAGG - Intronic
1113470516 13:110541677-110541699 GAGGAAGCTGAGCCCCAGGCAGG - Intronic
1113592876 13:111513064-111513086 GACATGGGTGTGCCCCTGGCTGG - Intergenic
1113607892 13:111623308-111623330 GACTCAGCTGTGCCGGTGGCTGG - Intronic
1114403040 14:22427541-22427563 GACACAGTGGTGCACAAGGCTGG + Intergenic
1114423552 14:22604001-22604023 GCCACGGCTTTGACCCAGGCTGG - Exonic
1116127506 14:40807417-40807439 GTCTCAGCTGTCACCCAGGCTGG - Intergenic
1117586411 14:57211840-57211862 GACAGAGTCTTGCCCCAGGCTGG - Intronic
1119424339 14:74526068-74526090 GACTCACCTGTGACCCAGGCAGG + Exonic
1119427335 14:74544236-74544258 AGCACAGCTGTTCCCCAAGCTGG + Intronic
1120905704 14:89619210-89619232 GACCCAGCAGGGCTCCAGGCCGG - Intergenic
1121358250 14:93232529-93232551 GACACAGCTTAGTCCCAGGCCGG + Intergenic
1122232580 14:100314075-100314097 GACGCAGCTCTGCCCGATGCCGG - Intergenic
1122239029 14:100349647-100349669 GACCCAGCTCTGCCCCTGCCTGG - Intronic
1122441358 14:101734448-101734470 GACACAGCTGTGCCCTCCACAGG + Intergenic
1122534919 14:102455379-102455401 GACAGAGCTGGGCCCCAGGCGGG + Intronic
1123061659 14:105597306-105597328 GACTCAGCTGTGTCCTGGGCTGG + Intergenic
1123086397 14:105719036-105719058 GACTCAGCTGTGTCCTGGGCTGG + Intergenic
1123117764 14:105902338-105902360 GAGAGTGCTGTGCCCCCGGCAGG - Intergenic
1124253405 15:28122211-28122233 GACCCAGCCGTTCCCCAGGAGGG + Intronic
1124649676 15:31465484-31465506 GGCTCAGCTCTGCCCCAGGCAGG - Intergenic
1125448425 15:39782798-39782820 GAAACAGCGGTCCCACAGGCAGG - Exonic
1125542669 15:40479314-40479336 GACACTGCTGGGCCACTGGCAGG - Intergenic
1125560534 15:40628987-40629009 CACACAACTGTACCCCAGGCTGG + Intronic
1125593780 15:40872007-40872029 GAACCAGCTGAGCCCCAAGCGGG + Intergenic
1127090074 15:55457895-55457917 CACCCAGTTGGGCCCCAGGCTGG - Intronic
1127143626 15:56002455-56002477 GTCCCAGCTGTTGCCCAGGCTGG - Intergenic
1128361937 15:66968417-66968439 GTCACACCTGTCACCCAGGCTGG + Intergenic
1128654469 15:69450394-69450416 GGCACCACTGTGCCCCAGCCTGG + Intergenic
1129245845 15:74278200-74278222 GACACAGCTGAGCCTTGGGCTGG + Intronic
1129922611 15:79332748-79332770 CACCCAGCTGTGCTCCAGGAGGG - Intronic
1130030966 15:80313219-80313241 GATACAGCTCTGCCTGAGGCTGG + Intergenic
1130653001 15:85772902-85772924 GGCACAGAGGTGCCCCAGGCTGG - Intronic
1130725322 15:86433049-86433071 GACTCAGCTGTGCTCAAGCCAGG + Intronic
1130846329 15:87750516-87750538 GACACCACTGTGCTCCAGCCTGG - Intergenic
1131104098 15:89718442-89718464 TAGACAGCTGTCTCCCAGGCTGG - Intronic
1131241957 15:90752875-90752897 GAAACAGCTGAGGCCCAGGGAGG + Intronic
1132219455 15:100094350-100094372 GACAGGGATGTGGCCCAGGCCGG + Intronic
1132400341 15:101501409-101501431 AACACAGACATGCCCCAGGCTGG + Intronic
1132720893 16:1315127-1315149 GACTCAGCTTTGCCCGAGACAGG + Intronic
1133041375 16:3061693-3061715 GACACACCTGTTGCCCAGGGTGG - Intergenic
1133125291 16:3642302-3642324 GACACAGGAGTGCCCAAGGATGG - Intronic
1133221877 16:4322404-4322426 AACCCAGCTGTGCCCCTTGCTGG + Intronic
1133394528 16:5435581-5435603 GACACAGGTGGGACCCAGGAGGG + Intergenic
1134065183 16:11223947-11223969 GTCTCACCTGTCCCCCAGGCTGG - Intergenic
1134070419 16:11256590-11256612 GACAGGGCTCTGCCCCCGGCGGG - Intronic
1134133052 16:11662754-11662776 GAGACAGCTGTGAGCCAGGCAGG - Intergenic
1134206492 16:12242529-12242551 GACACAGCTGAACCCCTGGGAGG - Intronic
1134501345 16:14771302-14771324 GACACCACTGTGCTCCAGCCTGG - Intronic
1134538657 16:15046829-15046851 CACACAACTGTGCTCCAGACAGG + Intronic
1134579227 16:15357612-15357634 GACACCACTGTGCTCCAGCCTGG + Intergenic
1134579239 16:15357738-15357760 GACACCACTGTGCTCCAGCCTGG + Intergenic
1134723346 16:16399815-16399837 GACACCACTGTGCTCCAGCCTGG - Intergenic
1134723358 16:16399941-16399963 GACACCACTGTGCTCCAGCCTGG - Intergenic
1134944070 16:18311929-18311951 GACACCACTGTGCTCCAGCCTGG + Intergenic
1134944082 16:18312055-18312077 GACACCACTGTGCTCCAGCCTGG + Intergenic
1135394361 16:22119624-22119646 GGCACTGCTGTGCTCCAGCCTGG + Intronic
1135530569 16:23249470-23249492 CACACCACTGTGCTCCAGGCTGG + Intergenic
1136415975 16:30104164-30104186 AACACCCCTGTGCTCCAGGCTGG + Intergenic
1138178242 16:54923091-54923113 GACACTACAATGCCCCAGGCTGG + Intergenic
1138396260 16:56707066-56707088 TACACCACTGTGCCCCAGCCTGG - Intronic
1138536233 16:57661844-57661866 GACACTGCTGGGCCTCAGCCTGG + Exonic
1138576226 16:57908833-57908855 GACACAGCAGGGCCCCTTGCTGG + Intronic
1138651116 16:58462475-58462497 GACAAAGCTGTAACCCAAGCGGG + Intergenic
1140068085 16:71626732-71626754 GGGACACCTGTGGCCCAGGCCGG + Intronic
1140195198 16:72849365-72849387 GAGCCGGCTGGGCCCCAGGCTGG - Intronic
1140454814 16:75098826-75098848 GACACAGATCTGCACCTGGCTGG - Intronic
1140476210 16:75240334-75240356 GACACAGATGTCCCGCAGCCAGG + Intronic
1140792523 16:78405807-78405829 GACACAGCTGTGGCTCAGAGGGG + Intronic
1141435795 16:83999070-83999092 GACATGGCTGTGAACCAGGCAGG + Intronic
1141603244 16:85138767-85138789 AGCAGAGCTGTGACCCAGGCTGG + Intergenic
1141734001 16:85840294-85840316 GACACTGCTCTCCCCCAGTCTGG + Intergenic
1141851080 16:86646493-86646515 GACAAAGCTGTGCCCCTCCCAGG - Intergenic
1141974542 16:87506792-87506814 AACACAGCCCTGCCCCAGGTAGG + Intergenic
1142029402 16:87831056-87831078 CACACAGCAATGCACCAGGCAGG + Exonic
1142622665 17:1174885-1174907 GACATACGTGTGCCCCAGGCAGG - Intronic
1142699038 17:1648659-1648681 GACAGATCTGCGCCCCCGGCCGG - Intronic
1142908457 17:3065889-3065911 GACACTGCTGTACTCCAGGCTGG - Intergenic
1142926108 17:3238355-3238377 GACACTGCTGTACTCCAGGCTGG + Intergenic
1143037641 17:4008844-4008866 AACAGAGCTGGCCCCCAGGCTGG - Intronic
1143101728 17:4508238-4508260 GGCACAGCTGTGGCCAGGGCTGG + Intronic
1143145978 17:4775872-4775894 GACGGAGCTGTTGCCCAGGCTGG + Intronic
1143691994 17:8576023-8576045 CACACAACTGTGCTCCAGCCTGG - Intronic
1144297309 17:13888341-13888363 GACACAGCTGAGACTCAAGCTGG + Intergenic
1144795328 17:17887501-17887523 GTCAGAGCTGTCCCCCAGGCTGG + Intronic
1144828234 17:18118428-18118450 GAGCCAGCTGTGGCCCAGGGAGG + Intronic
1144965768 17:19076526-19076548 GGCAGAGCTGGGACCCAGGCGGG + Intergenic
1144982199 17:19175656-19175678 GGCAGAGCTGGGACCCAGGCGGG - Intergenic
1144986024 17:19202583-19202605 GGCAGAGCTGGGACCCAGGCGGG + Intergenic
1145759560 17:27418530-27418552 AACACATCTGTGCCCTAAGCTGG + Intergenic
1145781956 17:27569255-27569277 GACACACCAGTGCCCAAAGCTGG + Intronic
1145787491 17:27603606-27603628 TACACAGCTGTGTCTCAGGAAGG - Intronic
1145799480 17:27673807-27673829 AACACATCTGTGCCCTAAGCTGG - Intergenic
1145911824 17:28547557-28547579 GACACAGAAGAGCCCCAGGGTGG + Intronic
1146530117 17:33601434-33601456 GCCCCAGCTGTGGCTCAGGCAGG + Intronic
1147508892 17:41048227-41048249 GTCCCAGCTGTGCCGGAGGCTGG + Intergenic
1147606980 17:41779355-41779377 GAGACAGATGTCACCCAGGCTGG + Intronic
1148670403 17:49405743-49405765 GACAGCTCTGTGGCCCAGGCTGG - Intronic
1152072638 17:78141548-78141570 CACAGAGCAGGGCCCCAGGCAGG - Exonic
1152322685 17:79616995-79617017 GACACAGCTGAGGCTGAGGCTGG - Intergenic
1152420711 17:80191530-80191552 GACAGAGCTGGGCTCCAGGGTGG + Intronic
1152868112 17:82736126-82736148 GACATGGCTGGGCCCCTGGCAGG + Intronic
1153991957 18:10408272-10408294 GGCTGAGCTGTGCCCAAGGCTGG + Intergenic
1154076185 18:11204075-11204097 ACCACAGCTGTGGACCAGGCAGG - Intergenic
1154386075 18:13892854-13892876 CACACATCTGTTGCCCAGGCTGG + Intronic
1156973288 18:43184268-43184290 GTGGCAGTTGTGCCCCAGGCAGG + Intergenic
1157290320 18:46405429-46405451 GCTACAGCAGTGGCCCAGGCAGG + Intronic
1157600505 18:48890256-48890278 GACACAGCAGGGCCCCAGCAGGG - Intergenic
1157720039 18:49916581-49916603 CACACAGCTGTACCACAGACAGG + Intronic
1157844836 18:50993592-50993614 GAGACAGCCAAGCCCCAGGCAGG + Intronic
1158446169 18:57523597-57523619 CAGACAGCCCTGCCCCAGGCTGG + Intergenic
1160006609 18:75073220-75073242 GTCCAAGCTGTGCCCCAGCCCGG + Intergenic
1160551864 18:79698529-79698551 GACACAGCTGAGGCACAGGAAGG - Intronic
1160664568 19:319025-319047 GTCTCACCTGTGGCCCAGGCTGG - Intronic
1160746496 19:713620-713642 CACACCGCTGTGCTCCAGCCTGG - Intronic
1160932877 19:1578826-1578848 TACACAGCTGAGCCCCGGGGAGG - Intronic
1160992172 19:1864298-1864320 GTCAAAGCAGGGCCCCAGGCCGG - Intergenic
1161257233 19:3316146-3316168 GACACAGCAGTGACCCAGACAGG + Intergenic
1161553939 19:4929842-4929864 CACACGGCTGCACCCCAGGCTGG - Intronic
1161678759 19:5668164-5668186 GCGGCAGCTTTGCCCCAGGCGGG + Exonic
1161785974 19:6325814-6325836 CACACCGCTGTACTCCAGGCAGG + Intronic
1161990773 19:7682909-7682931 GCCACAGCCCTGCCCCAGGCTGG + Exonic
1162495440 19:11020867-11020889 CTCACAGCTGTCACCCAGGCTGG + Intronic
1163790039 19:19301268-19301290 GATTCAGGTGTGCCCCAGTCTGG - Intronic
1164305558 19:24002345-24002367 GACTGTGGTGTGCCCCAGGCTGG - Intergenic
1164936692 19:32220349-32220371 GTCCCATCTGTGCCCCTGGCTGG - Intergenic
1165360435 19:35333288-35333310 GCCTCAGCTCTCCCCCAGGCTGG + Intronic
1165470784 19:36003358-36003380 GACATAGCTGAGCACCAGGTAGG + Exonic
1166895575 19:46019957-46019979 ACCCCAGCTGTGCCCCAGACAGG - Intronic
1166967858 19:46541107-46541129 GGCACAGGTGTTTCCCAGGCAGG + Intronic
1166996715 19:46722992-46723014 GACCCAGCCCTGCCCCAGGGTGG + Intronic
1167089549 19:47334109-47334131 GACACAGCGGCACCCGAGGCTGG + Intronic
1167397855 19:49243300-49243322 CACACAGCCGTTCCCCAGGCTGG + Intergenic
1167449347 19:49557785-49557807 GCAACTGCTGTGCGCCAGGCAGG - Intronic
1167600029 19:50449452-50449474 GAGACTTCTGTGGCCCAGGCTGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925005457 2:439896-439918 GGCCCAGCAGTGCCCCATGCAGG - Intergenic
925491470 2:4399823-4399845 GACACCACTGTGCTCCAGCCTGG + Intergenic
925770548 2:7278409-7278431 GTCTCAGCTGTTGCCCAGGCTGG - Intergenic
927208451 2:20624497-20624519 GTCACACATGTGCCCTAGGCAGG + Intronic
927688838 2:25192935-25192957 CACACCGCTGTACCCCAGCCTGG + Intergenic
929486405 2:42359239-42359261 GAACCAGCTCTGACCCAGGCTGG - Intronic
929951674 2:46414919-46414941 GACAGGGCTGTTCCCCAGGCTGG - Intergenic
930704569 2:54491617-54491639 GACAAGGCTGTCACCCAGGCTGG + Intronic
932084984 2:68750048-68750070 CACACAGCTGTACTCCAGACTGG - Intronic
932466986 2:71930349-71930371 GAAACACCTGTGCCCGATGCAGG + Intergenic
932609917 2:73191285-73191307 GTCTCACCTGTGGCCCAGGCTGG + Intergenic
933748951 2:85590966-85590988 GGCAAAGCTGCCCCCCAGGCTGG + Intronic
935193109 2:100794056-100794078 GACACAGCTGTGACTCCTGCCGG - Intergenic
935271444 2:101437551-101437573 GAAACACCTGTTGCCCAGGCTGG - Intronic
936339397 2:111617985-111618007 GACACTCCAGTGCCACAGGCTGG - Intergenic
937204089 2:120224533-120224555 CTCACAGCACTGCCCCAGGCGGG + Intergenic
937295153 2:120805682-120805704 GACACAGCTGTCCCTCAACCTGG + Intronic
937825453 2:126364234-126364256 GACACAGATGTGCCCCACAATGG + Intergenic
937891516 2:126942684-126942706 CACACATCTATGCTCCAGGCTGG + Intergenic
938225419 2:129611702-129611724 GACACAGATGTGCATCTGGCGGG - Intergenic
939153648 2:138500863-138500885 GACAGGGCTGTCACCCAGGCTGG - Intergenic
939613685 2:144338533-144338555 GACACAGCTTAGCCAGAGGCAGG - Intergenic
940141885 2:150500589-150500611 GACACAGTCTTGCTCCAGGCTGG + Intronic
940971896 2:159904502-159904524 GGCGCAGCCCTGCCCCAGGCTGG + Intronic
941011229 2:160302222-160302244 GACAGATCTGTCACCCAGGCTGG + Intronic
941080427 2:161054535-161054557 GAGACAGCTGTTGCCCAGGCTGG - Intergenic
941930798 2:170936857-170936879 GACGCTGCTGTTACCCAGGCTGG - Intronic
943146724 2:184055356-184055378 GTCTCACCTGTCCCCCAGGCTGG + Intergenic
943600610 2:189916349-189916371 GACAGAGCTGTCGCCCAGGCTGG + Intronic
944992223 2:205250883-205250905 CACACCACTGTGCCCCAGCCTGG + Intronic
946199347 2:218062665-218062687 GGCACTGCTGTGCTCCAGCCTGG + Intronic
946833059 2:223744717-223744739 GACACAGCATGGCCCAAGGCTGG + Intergenic
946869765 2:224075001-224075023 GACACACCTTTGCCCCAGCCTGG - Intergenic
947570603 2:231231411-231231433 GACAGCGCTGTTGCCCAGGCTGG + Intronic
947753028 2:232542572-232542594 GACCCAGCTGTGGTCAAGGCTGG + Intronic
947768386 2:232651958-232651980 CCCGCAGCTCTGCCCCAGGCTGG - Intronic
948167303 2:235872990-235873012 GAACCAGCCGTGCCCCAGGAGGG + Intronic
948776174 2:240290134-240290156 GGAACAGCTGTGCCCCACGCTGG + Intergenic
948828293 2:240584960-240584982 GCCACATCTGTGTCCAAGGCTGG - Intergenic
948910028 2:240998355-240998377 GACACAGGTCTGTCCCAGGACGG + Intergenic
1169044729 20:2526147-2526169 GACGGAGCTGTCACCCAGGCTGG + Intergenic
1169371713 20:5033049-5033071 GGCACCACTGTGCTCCAGGCTGG + Intergenic
1169876669 20:10305496-10305518 CACACCGCTGTTCCCCAGCCTGG + Intronic
1170105573 20:12751312-12751334 GACGCCGCTGTGCTCCAGCCTGG + Intergenic
1170805894 20:19631301-19631323 CACACCGCTGTGCTCCAGCCTGG + Intronic
1170812459 20:19685194-19685216 GGCCCAGCAGTGCCCCAGACAGG + Exonic
1171481290 20:25457773-25457795 AGCACAGCTGTGCCCTATGCAGG - Intronic
1171944218 20:31361630-31361652 GACAGCTCTGTCCCCCAGGCTGG - Intergenic
1171974009 20:31582389-31582411 GAGACAGGTGTTGCCCAGGCTGG - Intergenic
1172047359 20:32089970-32089992 GGCCCAGCTGAGGCCCAGGCAGG - Intronic
1172160957 20:32867665-32867687 TAAACAGCTGGGACCCAGGCTGG - Exonic
1172191333 20:33063608-33063630 GACACAGCTGTGCCCCGTGGTGG + Exonic
1172299233 20:33837222-33837244 GAAATAGCTGTAGCCCAGGCTGG - Intronic
1172308301 20:33897544-33897566 AACACAGCTCTGCCACAGTCAGG + Intergenic
1172617722 20:36300217-36300239 GGCTCAGATGTGCCCCAGCCTGG + Intergenic
1172703734 20:36867883-36867905 GACAGAGCTGTCGCCCAGGCTGG + Intergenic
1172991308 20:39038944-39038966 AACACAGCTGTGGCCCCAGCAGG - Exonic
1173468287 20:43301898-43301920 AACTCAGCCCTGCCCCAGGCAGG + Intergenic
1173805807 20:45924600-45924622 AACCCAGCTGGGACCCAGGCTGG + Intergenic
1173936399 20:46869879-46869901 GATTCAGCTGTGACCCAGGCTGG - Intergenic
1173946037 20:46951733-46951755 GACTAATCTGTGGCCCAGGCAGG + Intronic
1174402624 20:50284044-50284066 CCCACAGCTGTGACCAAGGCAGG + Intergenic
1174558844 20:51415590-51415612 GGCCCAGCTGTGAGCCAGGCTGG - Intronic
1175208176 20:57327957-57327979 GACACAGCTGTGAACAAGGCAGG - Intergenic
1175371603 20:58496348-58496370 GCCACAACCCTGCCCCAGGCTGG - Intronic
1175880189 20:62253527-62253549 GCTACAGCAGTGCCACAGGCTGG + Intronic
1175915865 20:62425496-62425518 GGCCCAGCTGTGGCCCTGGCAGG + Intronic
1175960054 20:62631407-62631429 GGCACAGCTGGCCCCCAGGGTGG - Intergenic
1175976698 20:62714068-62714090 GAGACAGTTGTCACCCAGGCTGG - Intronic
1175994918 20:62807734-62807756 TACCAGGCTGTGCCCCAGGCAGG - Intronic
1179208213 21:39303473-39303495 CACACAACTGCGCCCCAGCCTGG + Intronic
1179908692 21:44436964-44436986 GACACTGCCCCGCCCCAGGCAGG + Intronic
1180002157 21:45000099-45000121 GTCACAGCGGCGCCCCACGCAGG + Intergenic
1180021326 21:45129612-45129634 GACACAGCCGTGCTCCCGCCTGG + Intronic
1180299733 22:11027327-11027349 CACACCGCTGTGCTCCAGCCTGG + Intergenic
1180594128 22:16962578-16962600 GGCACAGGTGGGCCCCAAGCAGG + Exonic
1180927708 22:19567548-19567570 GACACATCTATGCCCTATGCAGG - Intergenic
1181029984 22:20145018-20145040 AGCACAGCTGCTCCCCAGGCAGG + Intronic
1181045994 22:20214495-20214517 CAGGCAGCTGTGCCCCATGCTGG - Intergenic
1181049951 22:20233745-20233767 GACACAGCAGTTCCCCAGAGGGG - Intergenic
1181069343 22:20322743-20322765 GACACAGCTGTGTCAGAGACAGG - Intergenic
1181175578 22:21032892-21032914 CACCCAGCTGGGCCCCAGACAGG + Intergenic
1181300316 22:21875373-21875395 GAGACAGGTGTTGCCCAGGCTGG + Intergenic
1181310280 22:21940940-21940962 TGCACAGCTGTGCTCCAGCCTGG - Intronic
1181377623 22:22472610-22472632 AACACTGCTGTCGCCCAGGCAGG + Intergenic
1181458270 22:23071460-23071482 GAGACAGCTGAGCCCCTGACCGG + Intronic
1181513281 22:23398295-23398317 GGCACAGCCGCTCCCCAGGCAGG - Intergenic
1181521469 22:23450894-23450916 GACAGAGCTGTGCCCCACCTGGG + Intergenic
1181988005 22:26815128-26815150 GACACTGCGGTGCACCAGACAGG + Intergenic
1182324064 22:29498452-29498474 CACACTACTGTGCTCCAGGCTGG - Intergenic
1183009390 22:34932418-34932440 CACACAGCTTTCCCTCAGGCTGG - Intergenic
1183361502 22:37385530-37385552 GGCACAGCAGTGGCACAGGCCGG + Intronic
1183775409 22:39960973-39960995 GAGACAGCTGTTGCCCAGGCTGG + Intronic
1184187643 22:42875577-42875599 CACACCACTGTACCCCAGGCTGG - Intronic
1184507469 22:44913236-44913258 GAAGTAGCTGTGCCCCAGGCTGG - Intronic
1185330444 22:50249844-50249866 TACACAGGTGTGTGCCAGGCTGG - Exonic
949871388 3:8592706-8592728 GACTCACCTGTCACCCAGGCCGG + Intergenic
950138837 3:10601443-10601465 GGCCTGGCTGTGCCCCAGGCTGG + Intronic
950583115 3:13875912-13875934 GAGACAGCTGTGCACCTGACAGG + Intronic
950656865 3:14441900-14441922 GACACAGTTGTGAGCAAGGCAGG + Intronic
951113912 3:18837494-18837516 GGCATAGCTGTGGACCAGGCTGG - Intergenic
951618848 3:24579094-24579116 GAGACATCTGTGCCCCAGTGTGG - Intergenic
951975395 3:28501776-28501798 GACAAGGCTGTCGCCCAGGCTGG + Intronic
953006553 3:38984538-38984560 CACACTCCTGTCCCCCAGGCTGG + Intergenic
953565836 3:44031478-44031500 GACAGGGCTTTGCCCCAGGCTGG + Intergenic
953911886 3:46897403-46897425 GGGACAGGTGTGCCCCAAGCAGG - Intronic
954409253 3:50363193-50363215 GACACAGCTGGCATCCAGGCCGG + Intronic
954429390 3:50461903-50461925 GACACATTGGTGCCGCAGGCTGG + Intronic
954751567 3:52817081-52817103 GTCATAGCTGGGCCCCAGCCAGG + Intronic
954881810 3:53841447-53841469 GACACCTCTGTCACCCAGGCTGG + Intronic
955182667 3:56686231-56686253 GACGGAGCTGTTGCCCAGGCTGG - Intergenic
955738029 3:62060098-62060120 GCCCCAGCTATTCCCCAGGCAGG + Intronic
957178669 3:76847765-76847787 GAAAAAGCTTTGCCACAGGCTGG - Intronic
959430281 3:106246206-106246228 GTCACCTCTGTTCCCCAGGCTGG + Intergenic
961475141 3:127141370-127141392 GACACCTCTGAGCACCAGGCTGG - Intergenic
961487305 3:127226038-127226060 GTGACAGCTGTGAGCCAGGCTGG + Intergenic
961534510 3:127561641-127561663 AACCCAGCTGCTCCCCAGGCTGG + Intergenic
962252520 3:133844897-133844919 GACACTACTGTACTCCAGGCTGG + Intronic
963039542 3:141058656-141058678 GACACAGCAGTGGCCAAGTCGGG - Intronic
963958335 3:151280228-151280250 GACACAACTGTCCCCCTGGGTGG - Intronic
965537098 3:169834330-169834352 GAGACAGCTGTTGCCCAGGCTGG - Intronic
967748643 3:193087926-193087948 GAGACACCTGTTGCCCAGGCTGG - Intergenic
968257559 3:197290717-197290739 GAGACAGGTGTTGCCCAGGCTGG - Intronic
968358007 3:198123202-198123224 TCCACAGCTGTGCTCCAGGTGGG - Intergenic
968904073 4:3443672-3443694 CACACAGGCGTGCCCCAGGCAGG + Intronic
969093768 4:4717229-4717251 GACACAGCTGTGCACCAGCCCGG + Intergenic
969222920 4:5773064-5773086 GACACTGCGGTGACCGAGGCAGG - Intronic
969570798 4:8006941-8006963 TACAAAGCTGCACCCCAGGCGGG + Intronic
969574487 4:8029060-8029082 TACACAGCTGGGCGCCAGGCAGG + Intronic
969601543 4:8179435-8179457 GACACAGCTCAGCCCCGGGAGGG + Intergenic
969611013 4:8227862-8227884 GACACAGCTCAGCACCAGGTGGG - Exonic
969712250 4:8850932-8850954 GACACAGCTGCCCCCTTGGCCGG + Intronic
970423615 4:15927167-15927189 GCCACAGCTGCACTCCAGGCTGG + Intergenic
971284457 4:25274295-25274317 GTGACAGCTGTGGTCCAGGCAGG - Intronic
972336538 4:38111899-38111921 CTCACAGCTGTTCCCCAGCCTGG + Intronic
972638513 4:40905251-40905273 GAGACAGAGGTGACCCAGGCTGG - Intronic
973642213 4:52914568-52914590 GACACAAGTGTGCCCGAGACAGG - Intronic
975554343 4:75645835-75645857 GTCTCAGCTGTCACCCAGGCTGG + Intronic
975720002 4:77240216-77240238 GACACAGCAGTTCCCCACTCTGG - Intronic
976297947 4:83490501-83490523 CACACAGCTGTACTCCAGCCTGG - Intronic
976319756 4:83700246-83700268 CACCCAGCTGTCACCCAGGCTGG + Intergenic
977530882 4:98199470-98199492 GGCACAGATGTGGCCCAGGCAGG + Intergenic
977877877 4:102169926-102169948 GCTACAGCTGTGCCTGAGGCTGG + Intergenic
981727147 4:147860410-147860432 GACGGAGCTGTCGCCCAGGCTGG - Intronic
983077640 4:163344389-163344411 GACAAAGCGCTGCCCCCGGCTGG + Exonic
984504551 4:180600505-180600527 GACACCACTGTTCCCCAGCCTGG + Intergenic
984797880 4:183681748-183681770 GACAGAGTTGTCGCCCAGGCTGG - Intronic
985440446 4:189979887-189979909 TCCACAGCTGTGCTCCAGGTGGG + Intergenic
985479875 5:102849-102871 CACACAGATGTCGCCCAGGCAGG - Intergenic
985538298 5:476399-476421 GTCACAGCTGTGCCCACCGCCGG + Intronic
985706398 5:1403664-1403686 GACACAACTGTGACCCATGCGGG + Intronic
985912952 5:2897369-2897391 GACACAGGTGTGCTTCAGGGCGG - Intergenic
986684496 5:10264243-10264265 GAGACAGGTGTCACCCAGGCTGG - Intronic
988600998 5:32639389-32639411 GACACAAAGATGCCCCAGGCAGG - Intergenic
993172035 5:84431327-84431349 GATACAGCTGTGCCCCTTCCTGG - Intergenic
993300989 5:86209728-86209750 CACACTGCTGTGCTCCAGACTGG + Intergenic
993726584 5:91374854-91374876 GAAACACCTGTCACCCAGGCTGG - Intronic
995024455 5:107403060-107403082 GCCACAGCTGTGCCAGAGACTGG + Intronic
995736852 5:115310767-115310789 GACACAGGGGTGCCCCATGGAGG - Intergenic
995804789 5:116039118-116039140 GACTCAGTTGTACCCCAGGAGGG + Intronic
997599721 5:135130987-135131009 GGCACAGTTCTGTCCCAGGCTGG + Intronic
998971304 5:147595418-147595440 GACACAGCTTTGCCCCCTCCAGG + Intronic
999230150 5:150057104-150057126 GAGAAAGCTGTGCCCAGGGCTGG - Intronic
999777578 5:154823354-154823376 GAGCCAGCTGTGCCTCAGGCAGG + Intronic
1001453829 5:171845961-171845983 GAGACTGCTTTGCCCCAGGAAGG + Intergenic
1001717143 5:173825493-173825515 GAGACAGCTGTGGACCAGCCTGG + Intergenic
1002476062 5:179466989-179467011 TCCACTGCTGTGGCCCAGGCTGG + Intergenic
1002648250 5:180673018-180673040 GTCACACCTGTCGCCCAGGCTGG + Intergenic
1002690801 5:181048685-181048707 GACAGAGTTGTCACCCAGGCTGG - Intronic
1002884917 6:1285085-1285107 GACCCAGCTCAGCCCCAGGTAGG + Intergenic
1003174643 6:3745699-3745721 GACCCAGCTGTGTCCCAGGTGGG + Intronic
1003751556 6:9064043-9064065 GACATAGGTGTTCCCCATGCTGG + Intergenic
1004382214 6:15142300-15142322 GACACCACTGTGCTCCAGCCTGG - Intergenic
1004708632 6:18149332-18149354 CACACTACTGTACCCCAGGCTGG - Intronic
1005990836 6:30900759-30900781 CACACAACTGTGCTCCAGCCTGG + Intergenic
1007119602 6:39369019-39369041 GAGACAGCTGAGCCCCAAGGAGG - Intronic
1010198742 6:73264460-73264482 GCCACAGCTTTGCCCCAAGAGGG - Intronic
1010914152 6:81595129-81595151 GACCCAGGTGTGACCCCGGCTGG + Intronic
1011066077 6:83327459-83327481 GAGACAGGTGTGCCCCGGGGGGG - Intronic
1012629163 6:101442123-101442145 GACACATCTGTGGCCAAAGCCGG - Intronic
1012831693 6:104211339-104211361 GACACAGCTGGCCCATAGGCTGG + Intergenic
1013328925 6:109078336-109078358 CACACTGCTGTGCTCCAGCCTGG + Intronic
1013853533 6:114543481-114543503 GACATAGTTGTTGCCCAGGCTGG - Intergenic
1015771831 6:136776271-136776293 GACATTGCTGTCACCCAGGCTGG + Intronic
1015791199 6:136966180-136966202 GACAGAGCTGGGGCCCAGGTAGG + Intergenic
1016990526 6:149925120-149925142 GAGTCAGCTCTGCTCCAGGCAGG + Intergenic
1017059657 6:150470187-150470209 GAGACAGCTTTGCCCCACTCAGG - Intergenic
1019338281 7:495233-495255 GAGTGAGCTGTGCCCCTGGCAGG - Intergenic
1019339063 7:499748-499770 ACCACATCTGTGCTCCAGGCTGG - Intronic
1019569730 7:1705216-1705238 GGCACAGCTGTGCGGGAGGCTGG + Intronic
1019589871 7:1825588-1825610 GACAGAGCTGTGCCCCACCTGGG - Intronic
1019902922 7:4038021-4038043 GACACAGCTGTCCCCAGTGCTGG + Intronic
1019996760 7:4729557-4729579 CACACACCTGAGCCCCAGGGAGG + Intronic
1021173993 7:17428704-17428726 CACACAACTGTACCCCAGCCTGG + Intergenic
1021598906 7:22344422-22344444 GACACAGCTGTACTGGAGGCTGG + Intronic
1021940903 7:25678240-25678262 GCCACAGTGGTGGCCCAGGCTGG - Intergenic
1023096830 7:36669959-36669981 GACCCAGCTGTGTCACTGGCTGG + Intronic
1023263145 7:38378397-38378419 GGCCAGGCTGTGCCCCAGGCAGG - Intergenic
1024262153 7:47581288-47581310 CACACAGCTGGCCCCCAGCCTGG + Intronic
1024365260 7:48513085-48513107 GAGACAGCAGTTCCCCAGACCGG - Intronic
1025230734 7:57201883-57201905 GACACAGCTGTGCAGCACACTGG - Intergenic
1025729434 7:64097024-64097046 GTCACCTCTGTGGCCCAGGCTGG + Intronic
1026204752 7:68247089-68247111 GACACATCTCTGCCCCAAACGGG + Intergenic
1026801135 7:73400688-73400710 GTCTCACCTGTGGCCCAGGCTGG - Intergenic
1029457488 7:100678615-100678637 GTGACAGCTGGGGCCCAGGCTGG + Intronic
1029703449 7:102262712-102262734 GGGCCAGCTGTGCCCCAGCCTGG + Intronic
1029714631 7:102319234-102319256 GACCCAGCTGTGCCCTGCGCAGG + Intronic
1030716830 7:112817595-112817617 GACCTAGCTGTCACCCAGGCTGG + Intergenic
1032595728 7:133237876-133237898 CACCCAGCTGTCACCCAGGCTGG - Intergenic
1032848901 7:135775605-135775627 GAGACTGCTGTTGCCCAGGCTGG + Intergenic
1033265683 7:139884663-139884685 GAGAGAGCTGTGCACCAGGAAGG + Intronic
1034344153 7:150375723-150375745 GACAGAGTTGTTGCCCAGGCTGG - Intronic
1034557308 7:151858289-151858311 GGGACAGCTGTGGCCGAGGCTGG - Intronic
1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG + Intergenic
1035401226 7:158567250-158567272 CACACAGGTGTGTGCCAGGCAGG - Intronic
1035731175 8:1854330-1854352 CCCACAGCTGTGCCCACGGCGGG - Intronic
1036061650 8:5328413-5328435 GACAGCTCTGTCCCCCAGGCAGG - Intergenic
1036402073 8:8417968-8417990 GGCACATCTGTCACCCAGGCTGG + Intergenic
1036578639 8:10052916-10052938 CACACTGCTGTGCTCCAGCCCGG - Intergenic
1036614512 8:10378163-10378185 GTCTCAGCTCTGCCACAGGCTGG + Intronic
1036643361 8:10597670-10597692 GACTCTGATGTCCCCCAGGCCGG - Intergenic
1036655799 8:10676535-10676557 GACCCAGGTGTGCCTAAGGCTGG - Intronic
1037386694 8:18351329-18351351 GACGCTGCTGTCCACCAGGCTGG + Intergenic
1037820905 8:22134062-22134084 GACACAGCCCTGGCCCAGGCTGG - Intergenic
1037981556 8:23258104-23258126 CCCATAGCAGTGCCCCAGGCAGG + Intronic
1040058556 8:43084026-43084048 CACACCACTGTGCCCCAGCCTGG + Intronic
1040731547 8:50453766-50453788 GACACAGCAGTGCCCACGGAGGG - Intronic
1041189637 8:55340876-55340898 GACACATGTGTGACCCATGCAGG - Intronic
1041903739 8:63009393-63009415 GGCGCAGCTGAGCCCGAGGCTGG + Intergenic
1042924434 8:73952749-73952771 GAGACACCTGTTGCCCAGGCTGG - Intronic
1045345608 8:101290980-101291002 ATCACAGCTTTGCCTCAGGCTGG - Intergenic
1047734944 8:127757028-127757050 GACTCAGTGGTGCCCCAGTCAGG + Intergenic
1047958222 8:129991919-129991941 GACTCTGCTGTTGCCCAGGCTGG - Intronic
1048141898 8:131803015-131803037 GTCTCACCTGTCCCCCAGGCTGG + Intergenic
1048182643 8:132210359-132210381 GACACAGCCTTGCCCATGGCAGG - Intronic
1048291585 8:133185415-133185437 GACACAGAAGTGACCCAAGCCGG + Intergenic
1048319235 8:133385590-133385612 CACACAGCTCAGCCTCAGGCAGG + Intergenic
1048857093 8:138694819-138694841 GACTCACCGGTTCCCCAGGCAGG + Exonic
1049397411 8:142407694-142407716 GACCCAGCTGTGGCCAAGGGGGG - Intergenic
1049797684 8:144504058-144504080 GGAACAGCTCTGCCCCAGGGAGG - Intronic
1050136390 9:2469907-2469929 AACACATCTGTACCCCAGACAGG - Intergenic
1051510997 9:17877838-17877860 GACAGAGCTGGGCCACAGCCAGG + Intergenic
1051740706 9:20248997-20249019 GACACAGCAGAGGCTCAGGCTGG + Intergenic
1052698221 9:31906196-31906218 GACACTGCTGTACTCCAGCCTGG - Intergenic
1053373696 9:37585864-37585886 GACAGAGTTTTGCTCCAGGCTGG - Intronic
1053406396 9:37880122-37880144 GAGACAGTTTTGCGCCAGGCTGG - Intronic
1054789940 9:69247326-69247348 CACACAGCTGTGCTGCAGGGAGG + Intronic
1055271419 9:74563835-74563857 GCCAGAGCTGTGCCAAAGGCAGG + Intronic
1055891941 9:81132993-81133015 GACCCATCTGTGAACCAGGCTGG - Intergenic
1056577498 9:87867729-87867751 GCCACAGAGGGGCCCCAGGCAGG - Intergenic
1056602421 9:88056530-88056552 GAAGCAGTGGTGCCCCAGGCTGG + Intergenic
1056841152 9:89998990-89999012 AGCCCAGCTGTGCCCCAGGAGGG + Intergenic
1057145302 9:92755129-92755151 GAGACAGGTATGCCCCAGGGGGG - Intronic
1057534883 9:95891181-95891203 GACACACTTGTTGCCCAGGCTGG - Intronic
1057948580 9:99351766-99351788 GTGACAGCTGTGCCCCTGGTGGG + Intergenic
1058501804 9:105627000-105627022 GACAGAGTTGTCACCCAGGCTGG + Intronic
1061041370 9:128142690-128142712 GGCTCAGCTGTGTCCCAGGCAGG - Intergenic
1061062968 9:128259974-128259996 GGGTCACCTGTGCCCCAGGCTGG + Intronic
1061805118 9:133133440-133133462 GACCCTGCTCTCCCCCAGGCTGG - Intronic
1062142276 9:134966146-134966168 GGCTCTGCTGTGCCCCATGCTGG - Intergenic
1062295066 9:135820746-135820768 AACACAGATCTGCACCAGGCTGG - Intronic
1062468177 9:136690712-136690734 GGCACAGCTGGGCCTCGGGCTGG + Intergenic
1062741876 9:138179737-138179759 TCCACAGCTGTGCTCCAGGTGGG - Intergenic
1203486091 Un_GL000224v1:56626-56648 GAGACAGCAGTCACCCAGGCTGG + Intergenic
1185862060 X:3588963-3588985 GATGCAGTTGGGCCCCAGGCTGG - Intergenic
1186086502 X:5996261-5996283 GGCACACCTGAGCCACAGGCTGG - Intronic
1186105972 X:6206246-6206268 AACCCAGCTCTGCCCCAAGCTGG + Intronic
1186466618 X:9788537-9788559 GAAACAGCTGTGGCCCAGGCAGG + Intronic
1186793266 X:13019502-13019524 GACAGCTCTGTGGCCCAGGCTGG - Intergenic
1187149386 X:16668216-16668238 CACACCACTGTGCTCCAGGCTGG + Intronic
1187307976 X:18114370-18114392 AACACAGCTCTGCTCCAGGCAGG - Intergenic
1188401574 X:29751886-29751908 CACACAGCTGTGCTCCAGCCTGG + Intronic
1190055485 X:47178998-47179020 GACCCCGCAGTGCCCCAGGAAGG - Intronic
1190077552 X:47328916-47328938 CACACCACTGTGCCCCAGCCTGG - Intergenic
1195242608 X:102967589-102967611 CACACAGCTGTACTCCAGCCTGG - Intergenic
1195666438 X:107435181-107435203 GAGACATCTGTCGCCCAGGCTGG - Intergenic
1196277045 X:113778763-113778785 GAGACAGATGTCACCCAGGCTGG + Intergenic
1197886539 X:131223908-131223930 GACACAGCTGTGGCCCTGAGAGG + Intergenic
1199462402 X:148099123-148099145 GACACAGTGGTGACCCAGGTGGG - Intergenic
1200419973 Y:2954651-2954673 GGCACAGCTGTACCCCAGCCTGG + Intronic
1200789967 Y:7291048-7291070 GACACCGCTGTACTCCAGCCTGG - Intergenic