ID: 900577237

View in Genome Browser
Species Human (GRCh38)
Location 1:3389408-3389430
Sequence AAGAGCTATCCCTATGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 25}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900577226_900577237 21 Left 900577226 1:3389364-3389386 CCCATCTCAGGCCCCATGGGAAT 0: 1
1: 0
2: 0
3: 12
4: 171
Right 900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 25
900577230_900577237 9 Left 900577230 1:3389376-3389398 CCCATGGGAATCGGACCGTCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 25
900577233_900577237 -10 Left 900577233 1:3389395-3389417 CCTCTCCATGAACAAGAGCTATC 0: 1
1: 0
2: 4
3: 76
4: 441
Right 900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 25
900577225_900577237 22 Left 900577225 1:3389363-3389385 CCCCATCTCAGGCCCCATGGGAA 0: 1
1: 0
2: 1
3: 16
4: 237
Right 900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 25
900577227_900577237 20 Left 900577227 1:3389365-3389387 CCATCTCAGGCCCCATGGGAATC 0: 1
1: 0
2: 0
3: 10
4: 259
Right 900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 25
900577232_900577237 -6 Left 900577232 1:3389391-3389413 CCGTCCTCTCCATGAACAAGAGC 0: 1
1: 0
2: 2
3: 14
4: 224
Right 900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 25
900577222_900577237 26 Left 900577222 1:3389359-3389381 CCTTCCCCATCTCAGGCCCCATG 0: 1
1: 0
2: 7
3: 63
4: 655
Right 900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 25
900577231_900577237 8 Left 900577231 1:3389377-3389399 CCATGGGAATCGGACCGTCCTCT 0: 1
1: 0
2: 0
3: 2
4: 52
Right 900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 25
900577229_900577237 10 Left 900577229 1:3389375-3389397 CCCCATGGGAATCGGACCGTCCT 0: 1
1: 0
2: 0
3: 3
4: 28
Right 900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900577237 Original CRISPR AAGAGCTATCCCTATGGCGT GGG Intronic
900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG + Intronic
914354042 1:146866523-146866545 AAAAGCTATCCCTATGAGGGGGG - Intergenic
922097207 1:222452585-222452607 AAGAGCGATCCCTTTGGGGTGGG - Intergenic
924447267 1:244145103-244145125 AAGAGCAGTCCCTGTGGCTTTGG + Intergenic
1067261428 10:44696416-44696438 AAGAGGTATCTCTGTGGGGTGGG - Intergenic
1072553710 10:96498274-96498296 AAGAGCTATTCAGATGGCCTTGG + Intronic
1102693672 12:114781392-114781414 AAGACCTGTCCCTCTGGCCTGGG - Intergenic
1107161217 13:37230341-37230363 AAAAGCTATCTCTATTGAGTAGG - Intergenic
1110750103 13:79103569-79103591 AACTGCTATCCCTGTGGTGTTGG + Intergenic
1115813924 14:37142296-37142318 AAGAGCTACCACTCTGGAGTTGG - Intronic
1130605666 15:85314310-85314332 AAGAGGAATTCCTATGGGGTAGG + Intergenic
1139979977 16:70849014-70849036 AAAAGCTATCCCTATGAGGGGGG + Intronic
1151444914 17:74157081-74157103 AAGAGCAATGCCAATGGGGTAGG + Intergenic
1159341865 18:67145062-67145084 AGGAGCTATCCTTATGACATGGG + Intergenic
930437686 2:51366035-51366057 AATAGCCATCACTATGGCATTGG + Intergenic
935339178 2:102044682-102044704 AGGAGCTCTCCATATGGGGTTGG + Intergenic
946787882 2:223266992-223267014 AATAGTTATCCCTATGTCCTGGG + Intergenic
1172919946 20:38472971-38472993 AAGCGCCAGCCCTATGGCGCGGG + Exonic
953188818 3:40664341-40664363 AAGAGCTATACCAATGCCTTAGG - Intergenic
955609095 3:60738595-60738617 AAGAGCTATCCCTGAGACATTGG + Intronic
963570004 3:146981878-146981900 AAGAGCTATCCCTGGAGCCTGGG + Intergenic
997190674 5:131931936-131931958 AAGTGGTATCCCTATGGCCTAGG + Intronic
1002824216 6:758113-758135 AAGAGCGCTCCCCATGGCGCTGG + Intergenic
1006205085 6:32333623-32333645 AACAGCTATCCCTCTGCTGTGGG - Intronic
1007034526 6:38661081-38661103 AAGAGCTATCCTAGTGGCGTAGG + Intergenic
1007986988 6:46216977-46216999 CAGAGCTATCCCTGTGGGATAGG - Intergenic
1013361595 6:109398438-109398460 AATAATTATCCCTATGGAGTGGG + Intronic
1029199785 7:98831211-98831233 AGCAGCTATCACTATGGTGTTGG + Intergenic
1052698497 9:31909171-31909193 AAGATCTGTCCCTATGTCATGGG - Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic