ID: 900577711

View in Genome Browser
Species Human (GRCh38)
Location 1:3391893-3391915
Sequence AATCGGGGTGCTGCCCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900577708_900577711 -10 Left 900577708 1:3391880-3391902 CCCCAGCGCTGCAAATCGGGGTG 0: 1
1: 0
2: 1
3: 3
4: 72
Right 900577711 1:3391893-3391915 AATCGGGGTGCTGCCCCTGCTGG 0: 1
1: 1
2: 0
3: 9
4: 96
900577704_900577711 -5 Left 900577704 1:3391875-3391897 CCAAACCCCAGCGCTGCAAATCG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 900577711 1:3391893-3391915 AATCGGGGTGCTGCCCCTGCTGG 0: 1
1: 1
2: 0
3: 9
4: 96
900577702_900577711 0 Left 900577702 1:3391870-3391892 CCTGCCCAAACCCCAGCGCTGCA 0: 1
1: 0
2: 2
3: 26
4: 336
Right 900577711 1:3391893-3391915 AATCGGGGTGCTGCCCCTGCTGG 0: 1
1: 1
2: 0
3: 9
4: 96
900577700_900577711 2 Left 900577700 1:3391868-3391890 CCCCTGCCCAAACCCCAGCGCTG 0: 1
1: 0
2: 2
3: 45
4: 435
Right 900577711 1:3391893-3391915 AATCGGGGTGCTGCCCCTGCTGG 0: 1
1: 1
2: 0
3: 9
4: 96
900577701_900577711 1 Left 900577701 1:3391869-3391891 CCCTGCCCAAACCCCAGCGCTGC 0: 1
1: 0
2: 1
3: 28
4: 454
Right 900577711 1:3391893-3391915 AATCGGGGTGCTGCCCCTGCTGG 0: 1
1: 1
2: 0
3: 9
4: 96
900577703_900577711 -4 Left 900577703 1:3391874-3391896 CCCAAACCCCAGCGCTGCAAATC 0: 1
1: 0
2: 1
3: 11
4: 136
Right 900577711 1:3391893-3391915 AATCGGGGTGCTGCCCCTGCTGG 0: 1
1: 1
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900577711 Original CRISPR AATCGGGGTGCTGCCCCTGC TGG Intronic
900205777 1:1431359-1431381 AGGTGGGGTCCTGCCCCTGCAGG - Intergenic
900287228 1:1907511-1907533 AGCAGGGGTGCTGCCCCTCCTGG + Intergenic
900577711 1:3391893-3391915 AATCGGGGTGCTGCCCCTGCTGG + Intronic
901066517 1:6497142-6497164 AAGCGGGGTGCTGCCGAGGCAGG + Intronic
901242442 1:7703465-7703487 AAGCTGGGTCCTGCCCATGCCGG - Intronic
902516778 1:16993781-16993803 GATGGGGGTGGTGCCCCTGAAGG - Exonic
903440965 1:23387554-23387576 ATTCCGGGTCCTGCCCCAGCTGG + Intronic
904481043 1:30793543-30793565 CATCGGGGTCCTGCCCCAGCGGG - Intergenic
904594591 1:31635389-31635411 TATGGGGGTCCTGCCCCTGGAGG - Exonic
904612487 1:31733103-31733125 CTGCGTGGTGCTGCCCCTGCTGG - Exonic
905371803 1:37486402-37486424 ACTCAGGGTTCGGCCCCTGCTGG - Intergenic
912710096 1:111943929-111943951 AATCAGTGTGCGGCCCCGGCTGG - Intronic
913491406 1:119383333-119383355 AACAGGGGTGCTGGCCCTTCTGG + Intronic
913531155 1:119735250-119735272 GATCCTGGTGCTGCCCCAGCAGG + Intronic
915497397 1:156291744-156291766 AATCGGAGTTCTCCCCTTGCCGG + Exonic
920238941 1:204529536-204529558 TATGGGGGTCCTGCCCCTGGAGG - Intronic
922418955 1:225446810-225446832 AAGATGGTTGCTGCCCCTGCTGG + Intergenic
1063159655 10:3410009-3410031 AATCCTGGGGCTGACCCTGCAGG + Intergenic
1071337635 10:84613876-84613898 AGTAGGGGTGCTGCTCCTGGCGG - Intergenic
1072955202 10:99882002-99882024 TTACGGGGTGCTGACCCTGCTGG - Intronic
1074560694 10:114532831-114532853 AATCTGGGTTGTGCCTCTGCTGG - Intronic
1074765684 10:116698548-116698570 TCTCGGGCTGCTGCACCTGCTGG - Intronic
1075613314 10:123871019-123871041 AATCGGGTTCCAGCCCATGCTGG + Intronic
1077500612 11:2908289-2908311 CTTCGGGGTGCTGCAGCTGCTGG + Exonic
1077768651 11:5190527-5190549 CATGAGGGTTCTGCCCCTGCAGG - Intergenic
1079690035 11:23406348-23406370 GACCTGGCTGCTGCCCCTGCTGG - Intergenic
1084013293 11:66364391-66364413 CAGCCGGCTGCTGCCCCTGCTGG - Exonic
1088920192 11:114254910-114254932 AAGAGGGGTGCAGGCCCTGCAGG + Intergenic
1091754081 12:3040544-3040566 CTTCAGGGGGCTGCCCCTGCAGG - Exonic
1096194881 12:49643340-49643362 AGTGGGGGTGCTGCCCTTGGAGG + Exonic
1096503579 12:52079896-52079918 GCTCGGCGTGCTGTCCCTGCTGG + Intergenic
1097022434 12:56029870-56029892 AAAGGGGCTGCTCCCCCTGCTGG + Intronic
1098861009 12:75709981-75710003 ATTCTCTGTGCTGCCCCTGCAGG + Intergenic
1100581501 12:95943752-95943774 CATCAGGGTCCTGCCTCTGCTGG + Intronic
1105327272 13:19382220-19382242 CATTGGGGTGCGGGCCCTGCGGG + Intergenic
1106436654 13:29729417-29729439 AAAAGGGGTGTTGCCTCTGCTGG + Intergenic
1113742133 13:112718545-112718567 TAGCTGGGTGCTGCCTCTGCGGG - Intronic
1117348157 14:54854391-54854413 AGTGGGGGTGCTGCACCTGCCGG + Intronic
1117953904 14:61108157-61108179 GATGCGGGTGCTGCTCCTGCAGG - Intergenic
1123674683 15:22698452-22698474 AATCGCTCTGTTGCCCCTGCTGG - Intergenic
1124326696 15:28771433-28771455 AATCGCTCTGTTGCCCCTGCTGG - Intergenic
1124477105 15:30044842-30044864 CATCGGGGTGCTGGCCTTCCTGG + Intergenic
1127359418 15:58231867-58231889 AATCCTGGTCCTGGCCCTGCTGG - Intronic
1132522822 16:399259-399281 GGTGGGGGTGCTGCCCATGCTGG + Intronic
1136931527 16:34422114-34422136 AATGGTGGGGCTGCCACTGCGGG + Intergenic
1142140766 16:88471818-88471840 AATCGGGGCGAGGCCCCCGCGGG + Intronic
1143508162 17:7380977-7380999 ACTCGGGGTGCGGCCCTCGCCGG + Exonic
1150577922 17:66446356-66446378 AATGGGGGTGCTGCACCTTAAGG - Intronic
1152078124 17:78170936-78170958 CATCGGGGTGCTGGCCTTCCTGG + Exonic
1152228550 17:79103630-79103652 GATGGGTGGGCTGCCCCTGCAGG - Intronic
1152677271 17:81648120-81648142 AATCGCGGTGGTGCTGCTGCAGG + Exonic
1157392541 18:47314790-47314812 GATCAGGGTGCTGACACTGCTGG - Intergenic
1159511670 18:69402581-69402603 ACTCTTGGTGCTGCCTCTGCTGG + Intronic
1160162251 18:76482448-76482470 GATCGCGGGGCTGCCGCTGCCGG - Intronic
1160901148 19:1429343-1429365 AATCGGGGTGCTGCCCCTGGGGG + Intronic
1161808343 19:6457974-6457996 TATCGGGGTTCTGCCCCAGTAGG + Intronic
1162689054 19:12413874-12413896 AGTCTGGGTCCTGCCCCAGCTGG + Intronic
1163152334 19:15422812-15422834 GACCTGGCTGCTGCCCCTGCTGG + Exonic
1163441595 19:17324790-17324812 AACCCGGCTGCTGCCACTGCTGG + Exonic
1164450831 19:28362958-28362980 AATCGGGGAACTGAGCCTGCAGG + Intergenic
1166676622 19:44745296-44745318 CATCCAGGGGCTGCCCCTGCGGG + Intergenic
1166792335 19:45405566-45405588 CACCGGGGTGCAGCCCCTGCGGG - Intronic
926120695 2:10239856-10239878 ACTGCGTGTGCTGCCCCTGCTGG + Intergenic
934767657 2:96889041-96889063 GATCTGGGTGGTGCCCCCGCAGG + Intronic
935783843 2:106531519-106531541 AGCCAGGATGCTGCCCCTGCAGG + Intergenic
937895929 2:126976793-126976815 AGAGGGGGAGCTGCCCCTGCTGG + Intergenic
946068913 2:217014544-217014566 AAGTGGGGTGAGGCCCCTGCAGG - Intergenic
948777846 2:240299151-240299173 AAGCTGGGTGCAGCCCCTGCAGG - Intergenic
1168980127 20:1996886-1996908 AATCATGGTGCTGGCCCTGTGGG + Intergenic
1170496675 20:16931369-16931391 CATCGGGTTGGTGCCCCTGGAGG + Intergenic
1171442933 20:25180091-25180113 AATGTGTGTGCTGCACCTGCTGG - Intergenic
1175168805 20:57065409-57065431 AATCTGGCTGCTGCCCCAGAGGG - Intergenic
1180835256 22:18926508-18926530 AATGGGGGTGCTGGCCAGGCGGG - Intronic
1203285344 22_KI270734v1_random:151807-151829 AATGGGGGTGCTGGCCAGGCGGG - Intergenic
950499094 3:13352738-13352760 ACTCGGGGTGCAGCAACTGCCGG + Intronic
950651849 3:14412140-14412162 ACACGGGGTGCTGTTCCTGCGGG + Intronic
953993226 3:47499789-47499811 AGTTGGGGTTCTGTCCCTGCTGG + Intronic
954803788 3:53203163-53203185 CAGCGGGGTGCTGCACCTGCAGG + Intergenic
960575633 3:119226832-119226854 AATCCAGCTGCTGCCTCTGCAGG + Exonic
960732518 3:120742664-120742686 TAGCGGGGTGCTTCCCCAGCTGG + Intronic
961707602 3:128800402-128800424 AATCAGAGTTCGGCCCCTGCTGG + Intronic
963916329 3:150861942-150861964 ATTTGTGGTGCTGCCCCAGCTGG - Intergenic
964525419 3:157611543-157611565 AGTCGGGCTGCTGCACATGCAGG - Intronic
964646733 3:158966657-158966679 AGTCTGGGTGCTGCTCCTGCTGG + Intronic
965342902 3:167512069-167512091 AATGGGTGTGCTGCCCTGGCGGG - Intronic
969494854 4:7520666-7520688 CCTAGGGGTGCTGCCCCTGTGGG + Intronic
986013896 5:3740785-3740807 GGTGGGGGTGCAGCCCCTGCAGG + Intergenic
987143176 5:14966197-14966219 AATGGGGGTCCTGCCCCTGGAGG - Intergenic
993036285 5:82761046-82761068 ACACGGAGTTCTGCCCCTGCTGG + Intergenic
998413368 5:141928037-141928059 AGTCGGGGAGCTGCCCCACCTGG + Intronic
1001397876 5:171429642-171429664 AGTCTGGGGGCTGCCCCTCCTGG + Intronic
1006837176 6:37005985-37006007 GAACGCGGGGCTGCCCCTGCAGG - Intronic
1015466263 6:133552001-133552023 TATTGGGGTGCTGCCTCAGCTGG + Intergenic
1017985518 6:159440003-159440025 AATAGGGGAGCTGACCCTGCAGG + Intergenic
1018346479 6:162904388-162904410 AGTCGGGGAACAGCCCCTGCTGG + Intronic
1019729629 7:2622921-2622943 AATGGGGGTCCTGGGCCTGCAGG + Intergenic
1034866911 7:154649718-154649740 AGTCAGGCTGCTGCTCCTGCAGG - Intronic
1037527563 8:19741598-19741620 AGTCGGGGAGCTGATCCTGCTGG + Intronic
1037608872 8:20459631-20459653 AAAGGGGGTGCTGTCCCTCCAGG - Intergenic
1049450630 8:142659596-142659618 AATCTGGGTATGGCCCCTGCTGG - Intronic
1049778790 8:144418131-144418153 GGTCAGGGTGCTTCCCCTGCCGG + Intergenic
1049787654 8:144458764-144458786 AGTGGGGGCGCTGCCTCTGCCGG + Intronic
1186292902 X:8119784-8119806 AGTCTGGCTGTTGCCCCTGCTGG + Intergenic
1186363533 X:8868218-8868240 ACATGGGGTGCTGGCCCTGCTGG - Intergenic
1186643196 X:11479310-11479332 AACCGGGATGTTGCCCTTGCTGG - Intronic
1193130074 X:77910595-77910617 CTTCCGGGTGATGCCCCTGCCGG - Intergenic
1200234600 X:154462193-154462215 GATCGAGGGGCTGCCCCTGCTGG + Exonic