ID: 900582507

View in Genome Browser
Species Human (GRCh38)
Location 1:3416036-3416058
Sequence TTCTCCCGCCCCTGCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900582507_900582526 22 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582526 1:3416081-3416103 GGGGCTGGAAGGGGCCAGAGGGG 0: 1
1: 0
2: 8
3: 135
4: 999
900582507_900582522 13 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582522 1:3416072-3416094 AGCCTGGGTGGGGCTGGAAGGGG 0: 1
1: 0
2: 1
3: 124
4: 785
900582507_900582521 12 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582521 1:3416071-3416093 CAGCCTGGGTGGGGCTGGAAGGG 0: 1
1: 0
2: 10
3: 79
4: 510
900582507_900582527 25 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582527 1:3416084-3416106 GCTGGAAGGGGCCAGAGGGGAGG 0: 1
1: 0
2: 6
3: 69
4: 778
900582507_900582520 11 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582520 1:3416070-3416092 ACAGCCTGGGTGGGGCTGGAAGG 0: 1
1: 0
2: 6
3: 71
4: 590
900582507_900582514 3 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582514 1:3416062-3416084 TGACCCCCACAGCCTGGGTGGGG 0: 1
1: 0
2: 2
3: 32
4: 303
900582507_900582517 7 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582517 1:3416066-3416088 CCCCACAGCCTGGGTGGGGCTGG 0: 1
1: 0
2: 6
3: 73
4: 559
900582507_900582513 2 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582513 1:3416061-3416083 CTGACCCCCACAGCCTGGGTGGG 0: 1
1: 0
2: 3
3: 35
4: 262
900582507_900582524 20 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582524 1:3416079-3416101 GTGGGGCTGGAAGGGGCCAGAGG 0: 1
1: 0
2: 16
3: 82
4: 806
900582507_900582512 1 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582512 1:3416060-3416082 CCTGACCCCCACAGCCTGGGTGG 0: 1
1: 0
2: 2
3: 35
4: 341
900582507_900582525 21 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582525 1:3416080-3416102 TGGGGCTGGAAGGGGCCAGAGGG 0: 1
1: 1
2: 6
3: 93
4: 662
900582507_900582509 -3 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582509 1:3416056-3416078 GAAGCCTGACCCCCACAGCCTGG 0: 1
1: 0
2: 2
3: 36
4: 242
900582507_900582510 -2 Left 900582507 1:3416036-3416058 CCTGCCTCGCAGGGGCGGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900582510 1:3416057-3416079 AAGCCTGACCCCCACAGCCTGGG 0: 1
1: 0
2: 0
3: 25
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900582507 Original CRISPR TTCTCCCGCCCCTGCGAGGC AGG (reversed) Intronic
900582507 1:3416036-3416058 TTCTCCCGCCCCTGCGAGGCAGG - Intronic
901512013 1:9722180-9722202 TCCTCCCACCCCTGGGAGGCCGG + Intronic
902511794 1:16970627-16970649 TTCTCCCGCTCCACCTAGGCAGG - Exonic
903653391 1:24934393-24934415 TTCTCCCTCCCCTCCAAGTCTGG - Intronic
903738276 1:25543917-25543939 CTTTCCCGGCCCTGCGGGGCAGG + Intronic
904415344 1:30358038-30358060 TTCACCCCCTCCTGGGAGGCAGG - Intergenic
905505516 1:38476301-38476323 TTCTCCTGCTCCCGGGAGGCTGG + Intergenic
905533325 1:38699529-38699551 TTCCCCCACCCCCACGAGGCAGG + Intergenic
906447014 1:45909918-45909940 TTCTCCTGCCTCAGCCAGGCTGG + Intronic
908409405 1:63847598-63847620 TTCTGTCTGCCCTGCGAGGCTGG + Intronic
910495344 1:87820561-87820583 TTCTCCCTCCCTTGTGAGACAGG - Intergenic
911993685 1:104735938-104735960 TTCTCAAGTCCCTGCGAAGCTGG + Intergenic
912619362 1:111139893-111139915 GTCTCGCGCGCCTGCGACGCGGG + Exonic
921068680 1:211641259-211641281 TTTTCCCGCCCCTGAGCTGCTGG + Intergenic
921953455 1:220957720-220957742 TTCTTCTGCCCCTGCTAGGTAGG + Intergenic
1065107165 10:22401288-22401310 TTCTTCCTCCCCTTAGAGGCTGG - Intronic
1067801599 10:49362956-49362978 TACCCCTGCCCCTGCCAGGCCGG + Intergenic
1068690327 10:59906935-59906957 GTCCCCGGCACCTGCGAGGCTGG - Intergenic
1069810515 10:71155941-71155963 TTCTCCTGCCCCTGCTTGACTGG - Intergenic
1069885034 10:71618341-71618363 TACGCCCGCCCCTGTGATGCAGG - Intronic
1070314392 10:75296241-75296263 TTGTCCAGCCCCTGGGAGGATGG + Intergenic
1070679568 10:78439137-78439159 TTCTCCCTCTCTAGCGAGGCAGG + Intergenic
1070850621 10:79559342-79559364 CTCTCCCGTCCCTGCCTGGCAGG + Exonic
1070856597 10:79611945-79611967 CTCTCCCGTCCCTGCCTGGCAGG - Exonic
1072733854 10:97866029-97866051 CTCTCCCAACCCTGCGAGGGGGG + Exonic
1073065517 10:100756796-100756818 TTCCCCCGCCCCTCCAAGCCAGG + Intronic
1073325968 10:102644122-102644144 GGCTCCGGCCCCTGCGAGGGAGG + Intergenic
1073584705 10:104698722-104698744 TTGTCCCTACCCTGAGAGGCTGG + Intronic
1075566062 10:123505205-123505227 TTCTCCTGCCCCTGCCTGTCTGG + Intergenic
1075835500 10:125449443-125449465 CTCTCCCAACCCTGTGAGGCAGG + Intergenic
1077516716 11:3006696-3006718 CTCCCCTGCCCCTGCCAGGCTGG + Intronic
1079603789 11:22341860-22341882 TTCCCCCGCCACTGAGAGGAAGG + Intronic
1081716250 11:45252500-45252522 TTCTCCCGTCACAGCGTGGCCGG - Exonic
1083310676 11:61782097-61782119 TTATACAGCCCCTCCGAGGCAGG + Intronic
1084089538 11:66870882-66870904 TCCTCCAGCTCCTGCGAGGGCGG + Exonic
1084174672 11:67417131-67417153 CCCTCCCGCCCCTGCCATGCTGG - Intronic
1084544036 11:69805068-69805090 TCCTTCCACCCCTGGGAGGCAGG + Intergenic
1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG + Exonic
1087083587 11:94195057-94195079 TTCTGCCACCCCAGCCAGGCAGG - Intergenic
1090235951 11:125147207-125147229 CCCTCCCTCCCCTGCCAGGCAGG + Intergenic
1092002770 12:5045177-5045199 TTCGCCTGCCCCAGCAAGGCAGG + Exonic
1092538011 12:9404764-9404786 GCCTCCCGCCCCTGCGATGGGGG - Intergenic
1094489734 12:30952196-30952218 GTCTCCCTCCCCTCCCAGGCAGG - Intronic
1096840924 12:54378977-54378999 CCCGCCCGCCCCTGCGGGGCTGG - Intronic
1097811929 12:64028419-64028441 TTCTCACACACCTGAGAGGCCGG - Intronic
1099825392 12:87770722-87770744 TTCTCCTGCCTCAGCGAGCCAGG + Intergenic
1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG + Intergenic
1102442958 12:112977729-112977751 TTTTCTTGCCCTTGCGAGGCTGG + Intergenic
1106021017 13:25915510-25915532 TGCTCCCGCCCCTGCTGGACTGG - Intronic
1107460758 13:40599714-40599736 CTCTACCACCCCTCCGAGGCCGG - Intronic
1112370472 13:98788772-98788794 TTCCCCCTCCCCAGTGAGGCAGG + Intergenic
1113466689 13:110518265-110518287 TTCACCAGCCCCTGTGTGGCGGG - Intergenic
1113841904 13:113365291-113365313 TTCTCCAGCCCTTGCAAGACCGG + Intergenic
1117315447 14:54567271-54567293 TCCTCCCGCACCTGGGAAGCAGG + Intronic
1117723115 14:58646388-58646410 TTCTCCAGCCCCTGGAGGGCTGG - Exonic
1118005070 14:61558293-61558315 CTCTCCCAACCCTGAGAGGCTGG + Intronic
1118818251 14:69327733-69327755 TTCTCCTGCCCCTGCCAGAGTGG - Intronic
1118992376 14:70808801-70808823 TTCTCCAGCCGCTGCCAGCCCGG - Exonic
1121565845 14:94908531-94908553 TTCTCCCACCTCTGGGAGGCTGG + Intergenic
1121718613 14:96093986-96094008 TTTTCCTGCCCCACCGAGGCAGG + Exonic
1122133673 14:99620487-99620509 TTCTCGTGCCCCTCAGAGGCTGG - Intergenic
1122414993 14:101545160-101545182 CTCTCCAGCCCCTTCCAGGCAGG + Intergenic
1122588125 14:102825421-102825443 TTCTGCCACCCCTTGGAGGCAGG + Intronic
1125452138 15:39820131-39820153 TTCTCCTGTCCCTGCAAGGAAGG + Intronic
1125675510 15:41500401-41500423 TTCTCCAGGCCCTGCCAGGCTGG + Intronic
1128650813 15:69411715-69411737 TTCTCCTGCCTCAGCCAGGCTGG - Intergenic
1132690397 16:1179373-1179395 CTCTCCTGCCCCCGCGAGGTTGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132915305 16:2340653-2340675 TGCCGCCGCCACTGCGAGGCTGG - Exonic
1138576984 16:57914292-57914314 CTCTGCAGCCCCTGGGAGGCTGG + Intronic
1139964127 16:70736135-70736157 TCCTACTGCCCCTGTGAGGCTGG - Intronic
1141554249 16:84826623-84826645 TTCCCCGGGACCTGCGAGGCTGG + Intronic
1141693389 16:85608709-85608731 CCCTCCCGGCCCTGCAAGGCAGG - Intergenic
1141694307 16:85612531-85612553 TTCTCCAGCCCCTGGGCCGCGGG + Intronic
1144338977 17:14297500-14297522 CTGTCCCGCAGCTGCGAGGCCGG + Intergenic
1144582090 17:16464826-16464848 TCCTCCCGCCTCAGGGAGGCAGG - Intronic
1147013979 17:37475578-37475600 TTCTCCTGCCCCTGAGTAGCTGG + Intronic
1147367305 17:39967445-39967467 CTCTTCCGCCCCTGCTATGCTGG - Intronic
1149604403 17:57914665-57914687 TTCTCTCTCCCCTGGGAGTCTGG - Intronic
1151429492 17:74052852-74052874 TTCACCCTCACCTGTGAGGCAGG + Intergenic
1152680263 17:81664258-81664280 ATCTGCAGCCCCTGCCAGGCTGG + Intergenic
1152738948 17:82010847-82010869 TTCTTCCGCCCCAGCGAGACAGG + Exonic
1153654916 18:7273715-7273737 CTCTCCCGCCACTGCTAGGCTGG - Intergenic
1160130786 18:76223187-76223209 TTCCCCAGCACCGGCGAGGCCGG + Intergenic
1160748521 19:722827-722849 TTCTCCCTCCTCAGGGAGGCTGG - Intronic
1160879340 19:1312483-1312505 TTCCCCAGCACCTGGGAGGCAGG - Intergenic
1160895951 19:1401823-1401845 TTCTCACACCCCAGCGAGGAGGG - Intergenic
1161203754 19:3029490-3029512 TTCTCCCGCCCCTCCGGGAGGGG - Intronic
1162054256 19:8053234-8053256 TTCTCCCGCTCCTGACATGCAGG + Intronic
1162974992 19:14203459-14203481 TCCTCCCTACCCTGCCAGGCTGG - Intronic
1165378459 19:35460569-35460591 TTCTCCTGCCCCTGAGTAGCTGG - Intergenic
1166792278 19:45405309-45405331 GTCTCCAGCCACAGCGAGGCAGG - Intronic
1167079193 19:47267646-47267668 TTTCCCCGCCCCAGTGAGGCGGG - Intronic
1167472825 19:49684909-49684931 TTCTCCCACCCTGGGGAGGCAGG - Exonic
1167794021 19:51697489-51697511 CTCTACCGGCCCTGTGAGGCTGG + Intergenic
1168269552 19:55242096-55242118 CTCTCCGGCCCCTCAGAGGCGGG - Intronic
1168346802 19:55653869-55653891 GTCTGCCGCGCCTGCGCGGCGGG + Intergenic
929074832 2:38072278-38072300 TTCTCCCGCCGCTGTCTGGCAGG - Intronic
932699562 2:73984186-73984208 TTCCCCCTCCTCTGGGAGGCAGG + Intergenic
932838710 2:75061246-75061268 TCCTCCCTCCCCTCAGAGGCAGG - Intronic
935783416 2:106527845-106527867 TTCTCTCCTCCCTGCGAGGCTGG - Intergenic
936548981 2:113418412-113418434 TTATCCAGCCTCTGCCAGGCTGG - Intergenic
937226933 2:120375502-120375524 TTCTCCAGCCCCTGGGGGGCGGG - Intergenic
937799727 2:126069167-126069189 GGCTCCTGCCCCAGCGAGGCTGG - Intergenic
937882739 2:126880664-126880686 TTCTTCCACCCCTGCCAGGCTGG - Intergenic
944667929 2:201972325-201972347 TCCTCCTGTCCCTGGGAGGCAGG + Intergenic
946408067 2:219502698-219502720 TACTCCCACCCCAGCAAGGCTGG - Intronic
948478798 2:238238068-238238090 TTCTGCCCCCCATGCTAGGCAGG - Intergenic
948601815 2:239111750-239111772 GTCTCCCGCCCCTGGGCTGCAGG + Intronic
948770751 2:240250306-240250328 CTCTCCCGCCTCTACCAGGCAGG + Intergenic
948969610 2:241414869-241414891 TTCTCCCTCCCTTCCCAGGCTGG - Intronic
1168876619 20:1176343-1176365 TTCTCCTCCCCAGGCGAGGCTGG - Intronic
1170893617 20:20395762-20395784 TTCACCCTCCTCTGCTAGGCAGG - Intronic
1174658573 20:52191745-52191767 TTCTCCCAACTCTGCGAGGCGGG + Exonic
1175187599 20:57189474-57189496 TTCACCCACACCTGTGAGGCTGG + Intronic
1178406866 21:32331783-32331805 GACTCCCACCCCTGCCAGGCTGG + Intronic
1178416972 21:32412370-32412392 TTCTGCCGCCAGGGCGAGGCTGG + Exonic
1178887139 21:36493313-36493335 TTCTGCCTTCCCTGGGAGGCAGG + Intronic
1179773484 21:43642905-43642927 TTCTCCTGCCTCAGCCAGGCTGG + Intronic
1179841863 21:44081632-44081654 TTCTGCCTGCCCTGGGAGGCCGG + Intronic
1182620624 22:31616642-31616664 TTCCCCCACCCCTGCAGGGCAGG + Intronic
950932358 3:16803172-16803194 TTCTCTCACCCCAGTGAGGCAGG - Intronic
953829155 3:46280600-46280622 TTCCCCCGCCCCTTTGAGACAGG + Intergenic
954371703 3:50172401-50172423 CTCTCCCTCCCCTTGGAGGCAGG + Intronic
960569668 3:119173452-119173474 CTCCCCCGCCTCAGCGAGGCAGG + Intronic
961319198 3:126061328-126061350 TTGTCCACCCCCTGCCAGGCTGG + Intronic
961823760 3:129588264-129588286 TTCTCACACCCCTGCAAGGGAGG - Intronic
969673349 4:8601732-8601754 GTCTCCAGCCCCTTAGAGGCAGG + Intronic
975444401 4:74445503-74445525 TTCCCCCGACCCTGCGCCGCAGG + Intronic
976398095 4:84579557-84579579 TTCTTCCGCCCCTGGCAAGCTGG + Intergenic
982208982 4:153019870-153019892 TTCTCCCACCCCTGTGCTGCAGG + Intergenic
984584794 4:181551095-181551117 TTCCCCCACCCCTGGGAAGCAGG + Intergenic
985092835 4:186381690-186381712 TTCTCTCGCAGCTGGGAGGCGGG + Intergenic
985217820 4:187672157-187672179 TTCTCTCGCAGCTGGGAGGCGGG - Intergenic
985769401 5:1799554-1799576 TTCTCCCGCCCCGGGGTCGCTGG + Intronic
986581030 5:9265758-9265780 TTCTCCCTACCCTGCAAGTCTGG + Intronic
988395616 5:30694119-30694141 CTCTGCCGCCCCCGCAAGGCTGG - Intergenic
992482853 5:77168504-77168526 TCCTCCTGCCCCTCTGAGGCAGG + Intergenic
994971851 5:106749206-106749228 TTCTGCTGTCCCTGCGAGGGAGG - Intergenic
1002888705 6:1316828-1316850 TCCTCCCGCGCCTGCGAGGAAGG - Intergenic
1004615176 6:17281922-17281944 TTCTCCGAACCCCGCGAGGCTGG - Intronic
1006796939 6:36737893-36737915 CTCTCCCGCCCCTTCCAGGCAGG + Intergenic
1007644965 6:43372680-43372702 CTCTCCCGCCCCAGAGTGGCAGG + Intergenic
1016900663 6:149097518-149097540 TTCTCAGGCCCCTGGGAAGCTGG - Intergenic
1017137478 6:151161104-151161126 TTCTCTGGCACCTGCAAGGCAGG - Intergenic
1024225935 7:47327040-47327062 TGCTCCCTCCTCTGCGTGGCTGG - Intronic
1026019724 7:66697703-66697725 TTCTCCGGCCTCAGCGAGGTGGG + Intronic
1026880659 7:73904879-73904901 TTCTCCGGCCTCAGCGAGGTTGG - Intergenic
1034303849 7:150036078-150036100 TGCTCCCCCCCCTGCGATGGGGG + Intergenic
1034457624 7:151179788-151179810 TCCTCCCGCCCCTGCCTGCCAGG + Intronic
1036698193 8:10993200-10993222 CTCTCGCGCCCAGGCGAGGCTGG + Intronic
1042200258 8:66274571-66274593 TTCTCCAGGCTCTGTGAGGCAGG - Intergenic
1044593936 8:93940629-93940651 TTCTCTCCTCCCTGCGTGGCTGG + Intergenic
1044999775 8:97869304-97869326 TTCCCCCGGCTCTGCGCGGCCGG + Intronic
1048214340 8:132481134-132481156 TTGTCCCGCCCCGTCGCGGCGGG + Intergenic
1048543491 8:135364735-135364757 GTCTCCCACCCCTGTGAGACAGG - Intergenic
1049203865 8:141354372-141354394 TTCACTGGCCCCAGCGAGGCGGG + Intergenic
1049371529 8:142270182-142270204 ATCTCCAGTCCCTGCGCGGCAGG - Intronic
1049578341 8:143399885-143399907 TTCACCCTCCCCTGCCAGCCGGG + Intergenic
1049761234 8:144332825-144332847 TTCTCCCGCCTCTGCGCCCCTGG - Exonic
1049850425 8:144827448-144827470 TTCTCCGGAGCCTGGGAGGCGGG + Intronic
1049903960 9:198438-198460 TTATCCAGCCTCTGCCAGGCTGG + Intergenic
1053117142 9:35514962-35514984 TTCTCCCTCCCCTGCAAGTAGGG - Intronic
1053746971 9:41208739-41208761 TTTTCCAGCCTCTGCCAGGCTGG + Intergenic
1054480315 9:65656620-65656642 TTTTCCAGCCTCTGCCAGGCTGG - Intergenic
1058908090 9:109497901-109497923 TGCGCCCGCCCCTGCCCGGCTGG + Intronic
1059414838 9:114156127-114156149 TTCCTGCGCCCCCGCGAGGCGGG + Intronic
1060920477 9:127417257-127417279 TTCTCCAGCCTCTGCAAAGCAGG + Intergenic
1061058184 9:128235742-128235764 CTCTGTCGCCCCTGCTAGGCAGG + Intronic
1061990094 9:134154154-134154176 TTATCCATCCCCTGTGAGGCAGG + Intronic
1062244951 9:135561506-135561528 TGCTCCCGCCGCTGCCAGCCTGG + Intergenic
1062696989 9:137880582-137880604 CCCTCCCACACCTGCGAGGCAGG - Intronic
1185446447 X:260326-260348 TTCTCCTGCCTCAGCCAGGCTGG - Intergenic
1189143719 X:38634788-38634810 TTCTCATACCCCTGAGAGGCTGG - Intronic
1190303078 X:49067575-49067597 TTCCACCGCCACTGCGGGGCAGG - Exonic
1193135104 X:77962186-77962208 TTCTGCCGTCCCAGTGAGGCTGG + Intronic
1200097983 X:153673144-153673166 TCCTCCACCCCCTGCCAGGCAGG + Intronic
1202026115 Y:20525701-20525723 TTCTCCCCTCCCTGCTGGGCTGG - Intergenic