ID: 900583497

View in Genome Browser
Species Human (GRCh38)
Location 1:3421052-3421074
Sequence GGCACAGTTGTGCTTCCATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900583489_900583497 16 Left 900583489 1:3421013-3421035 CCATCCTGCCTTCTGTGTGAAGC 0: 1
1: 0
2: 4
3: 33
4: 317
Right 900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 131
900583487_900583497 24 Left 900583487 1:3421005-3421027 CCCAGGCTCCATCCTGCCTTCTG 0: 1
1: 0
2: 5
3: 59
4: 609
Right 900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 131
900583488_900583497 23 Left 900583488 1:3421006-3421028 CCAGGCTCCATCCTGCCTTCTGT 0: 1
1: 0
2: 6
3: 59
4: 619
Right 900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 131
900583492_900583497 8 Left 900583492 1:3421021-3421043 CCTTCTGTGTGAAGCTGGAGCGT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 131
900583486_900583497 25 Left 900583486 1:3421004-3421026 CCCCAGGCTCCATCCTGCCTTCT 0: 1
1: 0
2: 4
3: 73
4: 600
Right 900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 131
900583491_900583497 12 Left 900583491 1:3421017-3421039 CCTGCCTTCTGTGTGAAGCTGGA 0: 1
1: 0
2: 3
3: 25
4: 244
Right 900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900583497 Original CRISPR GGCACAGTTGTGCTTCCATC GGG Intronic
900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG + Intronic
900844153 1:5082775-5082797 GGCACAGGTGAGCTTCCCTGTGG + Intergenic
907580573 1:55568600-55568622 AGGACTGTTGTGATTCCATCTGG - Intergenic
908588175 1:65597389-65597411 GGAACTGTTCTGCTTGCATCAGG + Intronic
910910321 1:92227201-92227223 GGCATCTTTGTGCTTCCATGTGG + Intronic
911912218 1:103651229-103651251 GGCACTGCTATTCTTCCATCTGG + Intergenic
911916236 1:103700719-103700741 GGCACTGCTATTCTTCCATCTGG - Intronic
911919633 1:103745367-103745389 GGCACTGCTATTCTTCCATCTGG + Intronic
916526286 1:165612495-165612517 GGCACAGTTGTGAATAAATCAGG - Intergenic
918164501 1:181931449-181931471 GGCTCAGTTGTCCTGCCAGCAGG - Intergenic
920147089 1:203871419-203871441 GGCACAGCTCTGCTTCCACAGGG - Intergenic
922697732 1:227739974-227739996 GGCACAGCTCTGTTTCCATGTGG + Intronic
922863300 1:228837809-228837831 TGCACTGCTGTGCTTCCATGGGG + Intergenic
924097210 1:240564787-240564809 TGCACAGTTTTCCTTGCATCAGG + Intronic
924369186 1:243329423-243329445 TGCATAGTTATGCTTCCCTCTGG - Intronic
1063928961 10:11009988-11010010 GGCACAGTTGTGCCTTTATGCGG + Intronic
1064400070 10:15013819-15013841 GGCACAGCTACGCTCCCATCTGG + Intergenic
1070425605 10:76284256-76284278 GGAACCGTTGTGCTTACCTCAGG - Intronic
1072661702 10:97367274-97367296 GGCCCAGTCATGCTTCCCTCGGG + Intronic
1073285478 10:102385023-102385045 GGCCCTGTTGTACTTCCAGCTGG + Intergenic
1073704337 10:105965720-105965742 GCCACTGTTCTGCTTCCTTCTGG + Intergenic
1073891222 10:108104392-108104414 TCCACAGTTGTGGTTTCATCCGG - Intergenic
1077551096 11:3200655-3200677 GGCAGAGTTGTGCCTCCTTGAGG + Intergenic
1078976078 11:16478838-16478860 TTCACATTTGTGCTGCCATCAGG - Intronic
1079636878 11:22753560-22753582 GGCACAATTTTGCTGCCATGTGG - Intronic
1080292371 11:30685198-30685220 GGCACAGTTCTGCTTACACATGG + Intergenic
1081151810 11:39641929-39641951 GGCAAAGTTCTGCATCCAGCTGG - Intergenic
1085036056 11:73300775-73300797 GTCACAGGTGTGCTTGCAGCTGG + Intergenic
1087369462 11:97264070-97264092 AGCACAGTTTTTCTTCCCTCTGG - Intergenic
1089675526 11:120086084-120086106 GGCACGGTGGTGATTCCATCGGG - Intergenic
1090564140 11:127968326-127968348 AGCACAGCTCTTCTTCCATCGGG - Intergenic
1092294276 12:7185752-7185774 GGCTCAGTTCTGCTTACAGCAGG + Intergenic
1093289353 12:17301934-17301956 GGCACAGCTATTCTTCCATCTGG - Intergenic
1097923579 12:65103923-65103945 GGCACAGTGGTGCATACCTCTGG + Intronic
1099304621 12:80937857-80937879 GGAACAGTTGCGTCTCCATCTGG - Exonic
1099544550 12:83962041-83962063 CGCACAGTTGTGCTATCATGAGG - Intergenic
1102236855 12:111298997-111299019 GGCTCAGAGGTGCTGCCATCTGG + Intronic
1102638207 12:114342993-114343015 GGCACAGAATTGCTTCCTTCTGG + Intergenic
1103548258 12:121717050-121717072 GGCACAGTTGAGTCTCCATGAGG + Intronic
1104428650 12:128698441-128698463 GACACAGCTGTGATACCATCTGG - Intronic
1112780756 13:102898168-102898190 GGCACAGTGGTCCTTACATGAGG - Intergenic
1114985036 14:28216792-28216814 GTCACAGAGGTGCTTGCATCGGG - Intergenic
1117642228 14:57812261-57812283 GGCACAGTTTGGGTTCCAGCTGG - Intronic
1119741482 14:77016509-77016531 GTCACAGGTGTGCATCCACCAGG - Intergenic
1120019890 14:79516466-79516488 TGCACAGATGTGTTTTCATCTGG + Intronic
1121971777 14:98364594-98364616 TGCACAGTTGTGCTTGCACAAGG - Intergenic
1122833473 14:104417558-104417580 AGCACAGTTGTGCTTTCTTTAGG - Intergenic
1123129569 14:105974358-105974380 GGGACAGGTGTGCTTCTCTCAGG - Intergenic
1123129610 14:105974580-105974602 GGGACAGGTGTGCTTCTCTCAGG - Intergenic
1123579819 15:21705182-21705204 GGGACAGGTGTGATTCCCTCAGG - Intergenic
1123616446 15:22147693-22147715 GGGACAGGTGTGATTCCCTCAGG - Intergenic
1125551375 15:40547440-40547462 GGCAGAGTTTGGCTTCCATAGGG - Intronic
1125891606 15:43270824-43270846 GGCACAGCCCTGCTTCCTTCCGG - Intergenic
1127062098 15:55197030-55197052 GGCACAGTCGTGTTCGCATCTGG - Exonic
1202988689 15_KI270727v1_random:439427-439449 GGGACAGGTGTGATTCCCTCAGG - Intergenic
1143393409 17:6573909-6573931 GGCACAGTGGTGCTTAGTTCTGG - Intergenic
1144855907 17:18267679-18267701 GGCACAGTCCTGCTTCCCTTGGG - Intergenic
1144991908 17:19238503-19238525 TTCACAGTTGTGCTTCCCTGGGG + Intronic
1145296164 17:21593866-21593888 GGCCCATCTGTGCCTCCATCAGG + Intergenic
1145367625 17:22278196-22278218 GGCCCAGCTGTGCCTCCATCAGG - Intergenic
1149045047 17:52235588-52235610 AGCTCAGTTGTGCTTCCCTGGGG + Intergenic
1152902453 17:82950865-82950887 TGCACAGATGTGCTGCCACCTGG + Intronic
1156348136 18:36276686-36276708 GGCTGAGTTGTGATTCAATCTGG + Intergenic
1157407592 18:47436105-47436127 TGCACAGTGGTACTGCCATCTGG - Intergenic
1157521071 18:48345814-48345836 GGCCCAGCTCTGCTGCCATCTGG + Intronic
1158953649 18:62520773-62520795 GTCACAGTGGGACTTCCATCGGG + Intergenic
1161133912 19:2608519-2608541 GGCACAGGTGTGCCTGCATCTGG - Intronic
1161448009 19:4328769-4328791 GGAGCAGTTGTGCCTCCAGCCGG + Exonic
1163149563 19:15402958-15402980 CTCACAGGAGTGCTTCCATCAGG + Intronic
1163713592 19:18861390-18861412 GGCACAGCTCTGCCTCCATGAGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
926155034 2:10448728-10448750 TGCACAGCTGTGCTTCCACCTGG + Intergenic
927917355 2:26945668-26945690 AGCACAGTTGAGCTGCCTTCAGG + Intronic
928126129 2:28617930-28617952 GCCACAGCTGGGCTTCCATGTGG + Intronic
928699894 2:33887945-33887967 GGCATAGCTCTGCTTCCATGAGG + Intergenic
931536949 2:63288161-63288183 GGCACAGTTGACATTCCAACTGG + Intronic
934479047 2:94618349-94618371 GGCACTGATGTGATGCCATCAGG + Intergenic
938244226 2:129764968-129764990 GGCAGAGTTCTGCTTTCCTCAGG - Intergenic
940844895 2:158629802-158629824 GGCACAGAACTGCTTCAATCTGG - Intronic
948726910 2:239939774-239939796 GGCATAGCTGTGCTTCCAGTGGG - Intronic
948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG + Intergenic
1173015483 20:39221322-39221344 GGGACATTTGTGCTTGCAGCAGG + Intergenic
1173825513 20:46045378-46045400 GACACACTTATCCTTCCATCTGG - Intronic
1174299201 20:49569211-49569233 GGCAGAGTTGTGCTTACCTCTGG + Intergenic
1174879042 20:54257135-54257157 GAATCAGTTGTACTTCCATCTGG - Intergenic
1175237101 20:57522267-57522289 GGCACAGTTTTCCTTCCTCCTGG - Intronic
1175539410 20:59738953-59738975 GTCACAGTCTTGCTCCCATCTGG + Intronic
1175979906 20:62733401-62733423 GGGACAGTTGTGTTTCCCTTGGG + Intronic
1176003524 20:62846308-62846330 GGTTGAGTTGTGGTTCCATCTGG + Intronic
1179102649 21:38367938-38367960 GCCCCAGTTTTGCTTCCACCAGG - Intergenic
1179594131 21:42430842-42430864 GGCCCAGTGGTGCTGCCCTCTGG - Intronic
1181673562 22:24437423-24437445 GGCTCAGCTGTGATTCCATTTGG + Intronic
1182700560 22:32234003-32234025 GGAACAGGTGTGCTTGCATGGGG + Intronic
1183704226 22:39467013-39467035 GGCACAGCTCTGCTGACATCAGG + Intronic
1184728919 22:46362568-46362590 TGCACAGTTGTACTTGAATCTGG - Exonic
1184739226 22:46417541-46417563 GGCTCAGTTGGGCTTCCAGACGG - Intronic
1184830837 22:46985327-46985349 GGCACAGTTGAGCCGGCATCTGG - Intronic
1185165140 22:49256950-49256972 GGCCCAGCTGTGCTGGCATCTGG - Intergenic
950282079 3:11716913-11716935 GGCTCATTTGTGCTTCTTTCAGG - Intronic
952362023 3:32639995-32640017 TGCTCAGTTGTGCTTTCTTCTGG + Intergenic
954351366 3:50046828-50046850 GGCACAGCTGGACTTACATCTGG - Intronic
956245919 3:67182860-67182882 GGCACAGTGCTGCTTTGATCTGG + Intergenic
957197548 3:77089601-77089623 GGCACTGCTGTGCTTCCAGAAGG + Intronic
958884501 3:99710660-99710682 GGCACAGGTGTGCTAACATGTGG + Intronic
966685511 3:182690045-182690067 TGCACCTTTGAGCTTCCATCTGG - Intergenic
969134868 4:5021398-5021420 GGCACAGATGTGTTTTCTTCTGG + Intergenic
975185920 4:71402616-71402638 TTCACAGATGTGATTCCATCTGG - Intronic
976969981 4:91092676-91092698 GGCACAGCTATTCTTCCATCTGG + Intronic
982488092 4:155993302-155993324 TACACAGATGTGCTTTCATCCGG + Intergenic
983497687 4:168461775-168461797 GTCAATGTTGTGCTTTCATCAGG - Exonic
984445267 4:179828736-179828758 GGCACAGATTTCCTTCCATGTGG + Intergenic
986541815 5:8852500-8852522 ATCACAGTTGTGCTTCCTTGAGG - Intergenic
987129479 5:14847509-14847531 GGCACATTCAGGCTTCCATCAGG + Intronic
987181730 5:15374876-15374898 TGTACAGTTTTGCTCCCATCTGG - Intergenic
993133101 5:83923888-83923910 AGCACAGATGTGGTGCCATCAGG - Intergenic
993320520 5:86463672-86463694 GGCACGGCTATCCTTCCATCTGG - Intergenic
994103367 5:95918538-95918560 AGCAAAGTTGTGTTTCCAGCAGG - Intronic
994733671 5:103524895-103524917 GGCACAGTTGTTCTTACTGCAGG + Intergenic
999774897 5:154804286-154804308 GGCCCCGTACTGCTTCCATCAGG + Exonic
999856130 5:155596216-155596238 GGCTCAGTTGTGGCTCCAACGGG + Intergenic
1002408091 5:179052102-179052124 GGCACAGCTATTCTCCCATCTGG + Intergenic
1005624578 6:27651458-27651480 GTCACAATAGTACTTCCATCTGG + Intergenic
1011419035 6:87152576-87152598 GGGACAGATGTGCTTGCATCCGG - Intergenic
1013391152 6:109687680-109687702 GGCTGAGATGTGCTTCCATCTGG - Intronic
1015678576 6:135779168-135779190 GGCATCTTTGTGCTTCCATGTGG + Intergenic
1022160695 7:27708159-27708181 GGAAAAGTAGTGCTTGCATCAGG + Intergenic
1022717814 7:32914631-32914653 AGCAGAGGTGGGCTTCCATCTGG + Intergenic
1026098479 7:67365517-67365539 GGCACAGTTGTGAATGCATTGGG - Intergenic
1030678852 7:112413106-112413128 GCCACAGTTGGGCTTAAATCTGG + Intergenic
1034400067 7:150856393-150856415 GGCAGAGATGGGCTTCCCTCAGG - Intronic
1037115016 8:15215423-15215445 GGCACTGTTTTACTTCCTTCGGG + Intronic
1049307635 8:141914212-141914234 AGCACAGTTGGGCTTCTTTCTGG - Intergenic
1049346030 8:142139125-142139147 GGCCCAGGTGTCCTCCCATCAGG - Intergenic
1057711391 9:97448803-97448825 GGCACAGTTTTGTTTCCACAGGG - Intronic
1061407741 9:130402154-130402176 ACCACAGTTCTGGTTCCATCTGG + Intronic
1062419781 9:136474722-136474744 ACCACACTTGTGCTTCCAGCAGG + Exonic
1062725668 9:138072082-138072104 GGTACACTTGTGCTGCCCTCTGG + Intronic
1192891974 X:75399656-75399678 GGCACAGTTGGGCTGCCCACTGG - Intronic
1193478454 X:81996486-81996508 AGCACACTTGTTCTTCCATGGGG + Intergenic
1198970118 X:142270269-142270291 GGCACAGCTATTCTCCCATCTGG - Intergenic
1199149680 X:144415666-144415688 GGCACTTTGGTGCTTCCATGTGG + Intergenic
1200925342 Y:8649302-8649324 GGCATGGTTGTTCTTCCCTCTGG - Intergenic