ID: 900587224

View in Genome Browser
Species Human (GRCh38)
Location 1:3439066-3439088
Sequence TCCCCACGCTTTTTAGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3383
Summary {0: 1, 1: 2, 2: 101, 3: 1309, 4: 1970}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900587219_900587224 19 Left 900587219 1:3439024-3439046 CCTGTTGGAGGTGCTGGGGGAAC 0: 1
1: 0
2: 2
3: 16
4: 254
Right 900587224 1:3439066-3439088 TCCCCACGCTTTTTAGCACCAGG 0: 1
1: 2
2: 101
3: 1309
4: 1970
900587218_900587224 20 Left 900587218 1:3439023-3439045 CCCTGTTGGAGGTGCTGGGGGAA 0: 1
1: 0
2: 3
3: 44
4: 298
Right 900587224 1:3439066-3439088 TCCCCACGCTTTTTAGCACCAGG 0: 1
1: 2
2: 101
3: 1309
4: 1970
900587221_900587224 -4 Left 900587221 1:3439047-3439069 CCGTCTTCCATGCCAGCAGTCCC 0: 1
1: 0
2: 0
3: 42
4: 438
Right 900587224 1:3439066-3439088 TCCCCACGCTTTTTAGCACCAGG 0: 1
1: 2
2: 101
3: 1309
4: 1970
900587220_900587224 -3 Left 900587220 1:3439046-3439068 CCCGTCTTCCATGCCAGCAGTCC 0: 1
1: 0
2: 0
3: 25
4: 208
Right 900587224 1:3439066-3439088 TCCCCACGCTTTTTAGCACCAGG 0: 1
1: 2
2: 101
3: 1309
4: 1970

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900587224 Original CRISPR TCCCCACGCTTTTTAGCACC AGG Intergenic
Too many off-targets to display for this crispr