ID: 900587284

View in Genome Browser
Species Human (GRCh38)
Location 1:3439467-3439489
Sequence CTGTAAACACAGAGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 4, 2: 15, 3: 48, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900587284 Original CRISPR CTGTAAACACAGAGGAAGCT GGG Intergenic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
900994484 1:6113038-6113060 CAGAAAACACAGAGGACTCTGGG + Intronic
901447621 1:9317969-9317991 CTGTGGAACCAGAGGAAGCTGGG + Intronic
901881240 1:12194997-12195019 CTGTAAACACAATGGAGGCAAGG - Intronic
902653914 1:17854444-17854466 CTGGACACACAGAGGAGGCGGGG + Intergenic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
902972276 1:20062496-20062518 CTGAAAACTCAGAGCAGGCTGGG + Intronic
903050052 1:20593968-20593990 CTGGACACCCAGAGGAAGCCTGG + Intronic
903300563 1:22375765-22375787 CTGGGAACACAGTGGATGCTCGG + Intergenic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907445661 1:54506269-54506291 CAGAAAATACAGAGGAAACTGGG - Intergenic
907989049 1:59561265-59561287 TGGTAAACAAAGAGGAAGCGAGG - Intronic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908388985 1:63668427-63668449 CTGTAAACACTGAAACAGCTGGG + Intergenic
908448916 1:64230502-64230524 ATGTACACACAGAGGATGTTGGG - Intronic
908610606 1:65855962-65855984 CTGTAAACAAAAAGAAAACTGGG - Intronic
908645755 1:66275945-66275967 CTGTGTCCACAGAGTAAGCTGGG + Intronic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
911636281 1:100239306-100239328 CTGTAAACACTTAGGAACTTTGG - Intronic
912327236 1:108778796-108778818 TGGTAAACACAGAGGAGGGTTGG + Intronic
916763839 1:167841373-167841395 ATGTAAAGACAGAGGAAGTGAGG - Intronic
916787216 1:168095385-168095407 CAGTAACCCTAGAGGAAGCTGGG + Intronic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917336071 1:173925497-173925519 CAGTAACCACAGCAGAAGCTGGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
923455046 1:234157551-234157573 CTGAAAACACAGTGCAAGCATGG + Intronic
924640303 1:245827230-245827252 CTGTAGAGTCAGAGGGAGCTGGG - Intronic
1063045954 10:2392730-2392752 CAGCACACACAGAGGATGCTTGG - Intergenic
1063377108 10:5561085-5561107 CTGTAAACACATAGGATGCAGGG - Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1065798368 10:29328270-29328292 CTGTAGACATTCAGGAAGCTTGG + Intergenic
1065888340 10:30098520-30098542 CTGTAAACTCCAAGAAAGCTGGG + Intronic
1067300467 10:45003497-45003519 CAGTAGACTCAGAAGAAGCTTGG + Exonic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070961087 10:80500714-80500736 CAGTAAACACAGAGTCAGCCAGG + Intronic
1071144396 10:82550584-82550606 CTAAAAACACAAAGGAATCTTGG - Intronic
1072236619 10:93459248-93459270 CTGTAACCAGAGAGGAGGATTGG - Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1079109492 11:17596477-17596499 CAGTGCACACAGAGGAGGCTGGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1083919684 11:65775595-65775617 CTGTAAGCACCCAGGAAGCTGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085244334 11:75087248-75087270 ATGTTGACACAGAGGAAGTTAGG + Intergenic
1085674057 11:78498608-78498630 CTGAAATCAAAGTGGAAGCTGGG - Intronic
1088857918 11:113773181-113773203 CTGGAAGCTCCGAGGAAGCTAGG - Intronic
1090367194 11:126216464-126216486 CTGTAAAGACAGAGGAAAAGAGG - Intronic
1091383807 12:79144-79166 CCGAGAACACAGAGGGAGCTGGG + Intronic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1093118259 12:15237006-15237028 TTTTAACCACAGAGGAAACTGGG + Intronic
1094312848 12:29104437-29104459 CTGAAAACACAAAAGAACCTTGG - Intergenic
1095722284 12:45413679-45413701 GTGTCAACACAGAGAAGGCTTGG + Intronic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1100618439 12:96249587-96249609 TTGTAAACACACAGGAGGCCAGG - Intronic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1103103927 12:118205980-118206002 CTGTAACCACAAAGAAGGCTTGG - Intronic
1103870888 12:124090786-124090808 CTATAAAAACAAAGGAAGCCTGG + Intronic
1104144485 12:126019307-126019329 ATGGAAACACAAAGGGAGCTGGG + Intergenic
1104408028 12:128534624-128534646 CGGTAAACACTGAGGATGCCTGG - Intronic
1105412764 13:20185025-20185047 CTGTGAACACTGGGGCAGCTGGG + Intergenic
1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG + Intronic
1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG + Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108527888 13:51301257-51301279 ATGTAAACACTGTGGAATCTGGG - Intergenic
1110318860 13:74137185-74137207 CTGCAAACACAGAGGTAGAGAGG - Intergenic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1112398271 13:99053146-99053168 ATGTGAACACAGTGGCAGCTGGG - Intronic
1112407382 13:99133371-99133393 CTGTCAAGCCAGAGGAGGCTTGG + Intergenic
1113096373 13:106668326-106668348 GTGTGAACATAGAGGAAGCTGGG - Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113647451 13:112008985-112009007 CTGTCAGCACGGAGGAATCTAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1116356637 14:43938712-43938734 CTGTAGAGCCAGCGGAAGCTGGG + Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1118375005 14:65169227-65169249 CTTTAGCCACAGAGGAGGCTGGG - Intergenic
1119597237 14:75946590-75946612 CTGAACACACAGAAGATGCTTGG - Intronic
1119671309 14:76520750-76520772 CTGTAATCACAGTGCAAGGTGGG + Intergenic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG + Intronic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123181793 14:106478249-106478271 CTGCAAACACAGAGAAATCCTGG + Intergenic
1202945111 14_KI270726v1_random:18480-18502 CTGCAAACACAGAGAAATCCTGG - Intergenic
1124106764 15:26745365-26745387 ATGTAAACACTGAGAAAACTGGG - Intronic
1125040448 15:35179697-35179719 TTGTAAAGACAGGGGATGCTAGG + Intergenic
1125122833 15:36183111-36183133 CTGTAACCAGAGAGGAAGGTAGG + Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1126434905 15:48626613-48626635 CTATAAAGTCAGAGGAAGTTAGG + Intronic
1126940721 15:53762365-53762387 GTGTAATGACAGAGGAAGCAAGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127290712 15:57568317-57568339 ATGTTAACACAGAGAATGCTTGG - Intergenic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1128791379 15:70436985-70437007 GTGTATACATAGAGGAAGTTTGG + Intergenic
1131167009 15:90149516-90149538 ATGTAAACAAAGAGAAAGCCAGG - Intergenic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133613049 16:7451028-7451050 TGGTAAACTCAGAGGCAGCTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1136383597 16:29909082-29909104 CTTTTCACACAGTGGAAGCTAGG - Intronic
1136451663 16:30357299-30357321 CTGAGAACACAGAGCAAGGTGGG + Exonic
1137714688 16:50591582-50591604 CTGTACAAAAAGAGGAAGCATGG - Intronic
1138272964 16:55709517-55709539 GTGAAAACACAGTGGTAGCTGGG - Intergenic
1141344992 16:83236627-83236649 CTGTTAACATAGTGGTAGCTAGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141445426 16:84054977-84054999 CTCTAAACACAAGGGAAGATGGG + Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142646508 17:1317128-1317150 ATGAAAACACATAGGAAGCCGGG + Intergenic
1143057801 17:4175550-4175572 CTGTACACACGGAGGAACCAGGG - Intronic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1144056484 17:11546548-11546570 GTGCAAACAAAAAGGAAGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148820734 17:50358184-50358206 CTGTAGAGAGAGAGGCAGCTGGG - Intronic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150626328 17:66843589-66843611 GTTTAAACACAGGGGAAGATGGG - Intronic
1150648210 17:66993001-66993023 CTGTAGACACAGCGCACGCTAGG - Intronic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1152110361 17:78354370-78354392 GTGGAAAGACAGAGGAAGGTTGG + Intergenic
1152945710 17:83196384-83196406 TTGGAGACACAGAGGAGGCTGGG + Intergenic
1153700959 18:7692690-7692712 CAGTGAAAACAGAGGAAGATAGG - Intronic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG + Intronic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156612889 18:38748445-38748467 CTGTAAGGACAGAATAAGCTGGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1156684579 18:39629188-39629210 CTGTAAGAACAAAGGAATCTGGG - Intergenic
1158110838 18:53940035-53940057 CTCTAACCACAGGGGAGGCTCGG - Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1159283377 18:66316769-66316791 CTGTAATCACTGTTGAAGCTTGG + Intergenic
1159508954 18:69371315-69371337 CAGCAAAAAAAGAGGAAGCTAGG + Intergenic
1159599771 18:70417821-70417843 CCGTAATCTCAGAGGAAGGTGGG - Intergenic
1160032881 18:75278140-75278162 CTGAAAAGACAGAGTAAACTGGG - Intronic
1160513953 18:79468300-79468322 CTGTACCCACAAAGGAAGCCGGG - Intronic
1161280796 19:3444484-3444506 CTGAACAGACAGAGGATGCTTGG + Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166438024 19:42786080-42786102 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166466926 19:43040743-43040765 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166473057 19:43096818-43096840 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166486729 19:43220357-43220379 CAGTGAACACAGAGGAAGTTTGG - Intronic
1167684635 19:50949107-50949129 CTGAAAACTCTGAGGAAGATGGG + Exonic
924976228 2:178118-178140 ATGAAAACACAGGGGAACCTGGG + Intergenic
925107513 2:1305504-1305526 TTGTAAACATAGAGGAAGCCTGG + Intronic
925724669 2:6861519-6861541 CTGTAGACCCATAGGAAGTTAGG + Intronic
928330102 2:30351213-30351235 CTGCAAACCGAGAGGAGGCTTGG - Intergenic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
930054843 2:47244052-47244074 CTGGAAACACTGAGCAGGCTTGG - Intergenic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
930461525 2:51684239-51684261 CTGTAATGACAAGGGAAGCTGGG + Intergenic
931754372 2:65359335-65359357 GTGTTAAAACTGAGGAAGCTTGG - Intronic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
938614016 2:132979081-132979103 CTGGAAATTCAGTGGAAGCTTGG - Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939908269 2:147946156-147946178 CTATAAATAAAGAGGATGCTGGG - Intronic
940013753 2:149082085-149082107 CTGCAAACATCGAGGAAGTTAGG - Intronic
940081296 2:149805040-149805062 CTGTATTAACTGAGGAAGCTAGG + Intergenic
944781754 2:203025720-203025742 CTGTGAACTCAGAGGACACTTGG + Intronic
944962777 2:204894490-204894512 CTGTTAATAATGAGGAAGCTGGG - Intronic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
946872153 2:224093701-224093723 CTGTAATCACAAAGAAAACTAGG + Intergenic
948292937 2:236840852-236840874 CTATCAACCCAGAGCAAGCTAGG + Intergenic
1168779160 20:473951-473973 CTGTCAACAAAGAGGAAGGGAGG + Intronic
1170498779 20:16953130-16953152 TTGTAATCTCAAAGGAAGCTTGG - Intergenic
1170695913 20:18658628-18658650 ATGTAAACACACAGGTAACTTGG + Intronic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1173661433 20:44736974-44736996 CTGTCTGCACAGTGGAAGCTGGG - Intergenic
1174566723 20:51470008-51470030 CTGACAACACCGAGGAGGCTGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176309609 21:5142669-5142691 CTGTGCACACGGGGGAAGCTGGG + Intronic
1176551330 21:8223762-8223784 CCGGAAACACGGAGGGAGCTTGG + Intergenic
1176570239 21:8406761-8406783 CCGGAAACACGGAGGGAGCTTGG + Intergenic
1176578148 21:8450948-8450970 CCGGAAACACGGAGGGAGCTTGG + Intergenic
1176692260 21:9928631-9928653 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
1178169019 21:30017788-30017810 CCTTAAACAAAGAGGAAACTGGG - Intergenic
1178378376 21:32087611-32087633 ATGTAACCTCAGAGGAGGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179847451 21:44119364-44119386 CTGTGCACACGGGGGAAGCTGGG - Intronic
1180698584 22:17769700-17769722 CTCCACACACAGAGGCAGCTGGG + Intronic
1180805212 22:18658026-18658048 CTGTAATCACAGAGTAATTTGGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183471802 22:38012465-38012487 ATCTTAACATAGAGGAAGCTGGG - Intronic
1183960813 22:41410938-41410960 CTCTAAACACAAAGGAGGCCAGG - Intergenic
1184425347 22:44405980-44406002 CTGTGAACATGGAGGAGGCTGGG - Intergenic
1203256353 22_KI270733v1_random:140706-140728 CCGGAAACACGGAGGGAGCTTGG + Intergenic
949529254 3:4937953-4937975 CTGTAAAACCAAAGAAAGCTTGG + Intergenic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
951379839 3:21969440-21969462 CTGAAGACAAAGAGAAAGCTAGG - Intronic
952941627 3:38449551-38449573 ATGAAAACACAGAGTAAGCTGGG - Intergenic
953373986 3:42413249-42413271 CTGTATACACTGAGTAAACTGGG + Intergenic
954895997 3:53975320-53975342 CTTTAAACAGAGAGGTACCTTGG + Intergenic
955087344 3:55716093-55716115 CTGTCAACACAAAGTCAGCTTGG - Intronic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
959612204 3:108307668-108307690 ATGTTAACAAAGTGGAAGCTGGG - Intronic
961640101 3:128359875-128359897 CTGTGAGCACGGAGGCAGCTGGG - Intronic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
962900917 3:139760758-139760780 TTGTTAACACAGAGAAAGGTAGG + Intergenic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964719966 3:159761608-159761630 CTGGAAACAGAAAGGAAACTGGG + Intronic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
966161245 3:176970834-176970856 CTGTAAACAAAGAGGATGTGAGG - Intergenic
966606957 3:181831241-181831263 CTCTAAACAGAAAGGAAGGTTGG - Intergenic
969202753 4:5618706-5618728 CTCTTAACACAGAGAAAGCCTGG + Intronic
969595968 4:8149474-8149496 CTGTGGACACAGACCAAGCTGGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
973938410 4:55876523-55876545 CTGAAAACTCAGACTAAGCTTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978160644 4:105543500-105543522 TTGCAAACACAGAGGATGGTTGG + Intergenic
979389571 4:120112238-120112260 CTGTAAGGACAGGGGAAGCAAGG + Intergenic
979519860 4:121653514-121653536 CTGGTCACACAGAGGAATCTAGG + Intergenic
979994962 4:127420684-127420706 CTGAAAATACAGTGCAAGCTTGG + Intergenic
980364854 4:131788874-131788896 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981402404 4:144328824-144328846 ATGTCAACAGGGAGGAAGCTAGG + Intergenic
981689955 4:147497448-147497470 TAGAAAACACAGAGGAATCTAGG + Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983030149 4:162790562-162790584 CTGCCTACACAGAGGTAGCTAGG + Intergenic
984427885 4:179611477-179611499 CTGTAAAAACAGAGTATTCTGGG - Intergenic
984923129 4:184783303-184783325 GTATAAGCACAAAGGAAGCTGGG - Intronic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
988506770 5:31830588-31830610 CTGTGATGACAGAGGAATCTGGG - Intronic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
990128068 5:52543506-52543528 TTGTAAAGACAGAGAAAGCCAGG - Intergenic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
992963090 5:81974774-81974796 CTTAAAACTCAAAGGAAGCTTGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995817456 5:116187927-116187949 CTGTAATCACAGAAGCAGTTTGG + Intronic
997605678 5:135174243-135174265 CTCTTAACACAGAAGAGGCTGGG - Intronic
997886836 5:137637746-137637768 CTGCTAAGATAGAGGAAGCTGGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1000172844 5:158720415-158720437 GAATAAACACAAAGGAAGCTGGG - Intronic
1000276077 5:159735852-159735874 CTGTAAAAACAGAGGAGCCAAGG - Intergenic
1000850569 5:166335151-166335173 CTGAAAACACTGAGGTAGCTGGG - Intergenic
1001917811 5:175576104-175576126 CTGAGAACCCAGAGGAAGTTGGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006386688 6:33734915-33734937 CTGTAAACACAGGGCAAAATGGG - Intronic
1006388687 6:33746404-33746426 CTGGGACTACAGAGGAAGCTGGG - Intronic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1007944580 6:45814103-45814125 CTGTAAACACAAAGCAAATTAGG + Intergenic
1008819157 6:55609596-55609618 CTGCAAGCTCTGAGGAAGCTGGG + Intergenic
1010288441 6:74107573-74107595 CTGTCACCACAGAGCAAGCCAGG - Intergenic
1011843088 6:91526648-91526670 CTGTACAAAAAGAGGTAGCTGGG - Intergenic
1012542388 6:100376352-100376374 AAGTAAACACAGAGGCACCTTGG + Intergenic
1013085714 6:106855384-106855406 CTGTCATCAAAGATGAAGCTTGG - Intergenic
1016601593 6:145867712-145867734 CTATAACCACAGAGGTAGTTTGG + Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018253662 6:161896679-161896701 TTGTAAACACTTACGAAGCTTGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1022222157 7:28324055-28324077 CTGTAAACACAGAGAAGCTTTGG + Intronic
1022297590 7:29070575-29070597 TTGTAAACACAAAGGAAGAGGGG - Intronic
1023712299 7:43008008-43008030 CTCTAAACACAGAGGTTCCTTGG + Intergenic
1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG + Intergenic
1030925414 7:115447529-115447551 TTATAAACCCAAAGGAAGCTAGG - Intergenic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1031447969 7:121878070-121878092 CTTTAAACACAGAGAAAAATTGG - Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1032626886 7:133601069-133601091 ATATAAACAAAGGGGAAGCTGGG - Intronic
1033236359 7:139640909-139640931 CTTTAAAAAATGAGGAAGCTGGG - Intronic
1034541691 7:151762590-151762612 CCCCAAACACAGAGGATGCTTGG - Intronic
1037063294 8:14543632-14543654 CTGTAAAAACTGAGGAATCACGG + Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1042437490 8:68784185-68784207 CTTTAAACACAGGGAAAGCTTGG - Intronic
1042835003 8:73071779-73071801 CTACACACACAGAGGATGCTGGG - Exonic
1044020167 8:87096002-87096024 ATGTAACCTCAGAGGAAGTTAGG + Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044567817 8:93684097-93684119 CTGACAACACAGAGCTAGCTGGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046664939 8:116990764-116990786 ATGTTAACACAGGGGAAACTGGG + Intronic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG + Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1053629204 9:39914731-39914753 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
1053776560 9:41548840-41548862 CTGGAAACTGAGAGAAAGCTTGG - Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054214683 9:62335971-62335993 CTGGAAACTGAGAGAAAGCTTGG - Intergenic
1054365170 9:64329645-64329667 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1054672798 9:67819378-67819400 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
1054944105 9:70776301-70776323 CTGTAAAGTCGAAGGAAGCTGGG + Intronic
1055002220 9:71464639-71464661 ATGTTAACAATGAGGAAGCTTGG + Intergenic
1055037719 9:71836196-71836218 CTGTAAAGAAAGAGGTAGCCAGG - Intergenic
1055480525 9:76705029-76705051 CTGAAACAATAGAGGAAGCTGGG - Exonic
1056665922 9:88580636-88580658 GTGTAAACACTGGGGAAACTGGG - Intronic
1058140824 9:101355354-101355376 CTGTATCAAAAGAGGAAGCTTGG - Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1059364017 9:113771327-113771349 CTGGCAAGACAGAGGAAGATTGG + Intergenic
1061134348 9:128724556-128724578 CTGTCACCACAGAGCAACCTTGG - Intergenic
1062312170 9:135944756-135944778 GTGGCAACACAGAGGAAACTGGG + Intronic
1203472509 Un_GL000220v1:122406-122428 CCGGAAACACGGAGGGAGCTTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG + Intronic
1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG + Intergenic
1187529048 X:20080088-20080110 TTGTAGAAACACAGGAAGCTAGG - Intronic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1188091631 X:25971482-25971504 CTGTGATCACAGACGATGCTTGG - Intergenic
1188285785 X:28324181-28324203 CTATATACACAGAGGTAACTAGG + Intergenic
1189919000 X:45885147-45885169 CTGTAAACATAAAGCAGGCTGGG + Intergenic
1190376296 X:49791680-49791702 CTTTAAACGCTGAGGAATCTGGG + Intergenic
1191174148 X:57482018-57482040 CTGAAAGCACTGAGGAGGCTGGG - Intronic
1192403273 X:70858619-70858641 TTTTAAACATAGAGGATGCTTGG - Intronic
1194434830 X:93856615-93856637 CAGTGAAGAGAGAGGAAGCTGGG - Intergenic
1194862037 X:99011413-99011435 TTGTAAGCACTGAGGAAGCAGGG - Intergenic
1197538810 X:127728272-127728294 GAGTACACACAGAGGAAACTGGG - Intergenic
1198401766 X:136275554-136275576 CTCTGAACACAGAGAAAGCAGGG - Intergenic
1198831208 X:140752481-140752503 CTGTTCACACAGAGAAAGCCAGG - Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic