ID: 900587781

View in Genome Browser
Species Human (GRCh38)
Location 1:3441530-3441552
Sequence CAGGCTGAACAAAGATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900587781_900587791 13 Left 900587781 1:3441530-3441552 CCTTCCCATCTTTGTTCAGCCTG No data
Right 900587791 1:3441566-3441588 TCATTAGCCCTGGAGGGGAGAGG No data
900587781_900587788 7 Left 900587781 1:3441530-3441552 CCTTCCCATCTTTGTTCAGCCTG No data
Right 900587788 1:3441560-3441582 TTCTCCTCATTAGCCCTGGAGGG No data
900587781_900587786 3 Left 900587781 1:3441530-3441552 CCTTCCCATCTTTGTTCAGCCTG No data
Right 900587786 1:3441556-3441578 AACTTTCTCCTCATTAGCCCTGG No data
900587781_900587789 8 Left 900587781 1:3441530-3441552 CCTTCCCATCTTTGTTCAGCCTG No data
Right 900587789 1:3441561-3441583 TCTCCTCATTAGCCCTGGAGGGG No data
900587781_900587794 25 Left 900587781 1:3441530-3441552 CCTTCCCATCTTTGTTCAGCCTG No data
Right 900587794 1:3441578-3441600 GAGGGGAGAGGAAAAATCTATGG No data
900587781_900587787 6 Left 900587781 1:3441530-3441552 CCTTCCCATCTTTGTTCAGCCTG No data
Right 900587787 1:3441559-3441581 TTTCTCCTCATTAGCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900587781 Original CRISPR CAGGCTGAACAAAGATGGGA AGG (reversed) Intergenic
No off target data available for this crispr