ID: 900588524

View in Genome Browser
Species Human (GRCh38)
Location 1:3446179-3446201
Sequence CTAATATTCCTCATGGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900588524_900588526 -3 Left 900588524 1:3446179-3446201 CCTATATCCATGAGGAATATTAG No data
Right 900588526 1:3446199-3446221 TAGTCTATAATTTTGTTTTCTGG No data
900588524_900588529 22 Left 900588524 1:3446179-3446201 CCTATATCCATGAGGAATATTAG No data
Right 900588529 1:3446224-3446246 ACTTTTTAGTATTGGTGTCAGGG No data
900588524_900588528 21 Left 900588524 1:3446179-3446201 CCTATATCCATGAGGAATATTAG No data
Right 900588528 1:3446223-3446245 GACTTTTTAGTATTGGTGTCAGG No data
900588524_900588527 14 Left 900588524 1:3446179-3446201 CCTATATCCATGAGGAATATTAG No data
Right 900588527 1:3446216-3446238 TTCTGGTGACTTTTTAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900588524 Original CRISPR CTAATATTCCTCATGGATAT AGG (reversed) Intergenic
No off target data available for this crispr