ID: 900589007

View in Genome Browser
Species Human (GRCh38)
Location 1:3451249-3451271
Sequence GCCAGGGACCAACAGCGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900589007_900589012 26 Left 900589007 1:3451249-3451271 CCTGGTCGCTGTTGGTCCCTGGC No data
Right 900589012 1:3451298-3451320 ACAGTTCAGTATTCAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900589007 Original CRISPR GCCAGGGACCAACAGCGACC AGG (reversed) Intergenic
No off target data available for this crispr