ID: 900592557

View in Genome Browser
Species Human (GRCh38)
Location 1:3466567-3466589
Sequence GCTGAAGGGGAGCCATGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900592552_900592557 -8 Left 900592552 1:3466552-3466574 CCCGGACTCTTCGAGGCTGAAGG 0: 1
1: 0
2: 1
3: 35
4: 855
Right 900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 170
900592549_900592557 9 Left 900592549 1:3466535-3466557 CCACACCGCGGGCTCTGCCCGGA 0: 1
1: 0
2: 3
3: 18
4: 141
Right 900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 170
900592550_900592557 4 Left 900592550 1:3466540-3466562 CCGCGGGCTCTGCCCGGACTCTT 0: 1
1: 0
2: 0
3: 5
4: 130
Right 900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 170
900592542_900592557 30 Left 900592542 1:3466514-3466536 CCAGATCAGAGGGCACCGGCCCC 0: 1
1: 0
2: 0
3: 12
4: 114
Right 900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 170
900592547_900592557 10 Left 900592547 1:3466534-3466556 CCCACACCGCGGGCTCTGCCCGG 0: 1
1: 0
2: 1
3: 18
4: 155
Right 900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 170
900592545_900592557 15 Left 900592545 1:3466529-3466551 CCGGCCCCACACCGCGGGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 349
Right 900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 170
900592554_900592557 -9 Left 900592554 1:3466553-3466575 CCGGACTCTTCGAGGCTGAAGGG 0: 1
1: 0
2: 1
3: 5
4: 97
Right 900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 170
900592546_900592557 11 Left 900592546 1:3466533-3466555 CCCCACACCGCGGGCTCTGCCCG 0: 1
1: 1
2: 2
3: 12
4: 153
Right 900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900592557 Original CRISPR GCTGAAGGGGAGCCATGTGT TGG Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
900661289 1:3785342-3785364 GTTGGAGGGGAGCCCTGTCTCGG - Intronic
902038283 1:13473462-13473484 GCTGAAGGGGAGAAAAGAGTGGG + Intergenic
902337477 1:15761958-15761980 GCTGAGGTGGGGCCATGGGTGGG - Intronic
902925592 1:19693876-19693898 GCTGTTGGGGAGCCCTGGGTGGG + Intronic
903845896 1:26279895-26279917 GCAGAAGGGGCGCCCTGCGTGGG + Exonic
904082554 1:27881467-27881489 GTTGAAGGGAAAGCATGTGTGGG + Intronic
904759371 1:32790668-32790690 TCTGAAGGTAAGCCATGTTTGGG + Intronic
905091759 1:35435935-35435957 GCTGAGGGGGTGCCACCTGTTGG - Intronic
906534549 1:46544282-46544304 GTTGAAGGGGAGCTGTGGGTCGG - Intergenic
906797896 1:48712109-48712131 GGAGAAGGGGAGCCTTGAGTTGG - Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
907729209 1:57049691-57049713 GGTTAAGGGGAGGCATGTGAGGG - Intronic
907911928 1:58834489-58834511 GCTGGAGGGTAGGCATGTGTAGG - Intergenic
910932837 1:92459579-92459601 GCTGATGGGAGCCCATGTGTTGG - Intergenic
914422680 1:147543470-147543492 GCTGAAGGAAAGCCATTAGTTGG + Intronic
915191466 1:154154509-154154531 GGTAAAGGGAAGCCCTGTGTTGG - Intronic
915506165 1:156357669-156357691 GCTGGAGGAGAGCGAGGTGTTGG + Intronic
916548557 1:165828446-165828468 GGGGAAGGGGAGCCCAGTGTGGG + Intronic
920903600 1:210137195-210137217 TCTGAAGAGGAGGCAGGTGTGGG + Intronic
921985023 1:221303452-221303474 GGGGAAGGCGAGGCATGTGTGGG + Intergenic
922225198 1:223640043-223640065 GCTGATGAGAAGCTATGTGTAGG - Intronic
923240291 1:232077978-232078000 GCTGGAGGGAATCCATTTGTGGG + Intergenic
924835830 1:247646227-247646249 GCTGGAGGGGAGCAATGTCAAGG + Intergenic
1064136054 10:12751788-12751810 GCAGCAGGGAAGCCATGTGGTGG + Intronic
1069833045 10:71292610-71292632 TTAGAAGGGGAGCCACGTGTGGG - Intronic
1069878922 10:71579742-71579764 GCAGAAGGGGAGGCCTGTCTTGG + Intronic
1070697813 10:78575711-78575733 GGTGAAGGGGGGCGATGTGGTGG + Intergenic
1071275234 10:84048296-84048318 ACTGAAGGGGAGGCAAGAGTGGG - Intergenic
1073608269 10:104917631-104917653 GTTAAAGGGGAGGCATGTTTGGG - Intronic
1077405210 11:2379513-2379535 GCTGAAGGGGAGTCACGGGAGGG + Intronic
1077411616 11:2406383-2406405 GCTGGAGGGAAGCCAGGGGTGGG + Intronic
1078106708 11:8362421-8362443 GGTCACGGGGAGCCGTGTGTGGG - Intergenic
1078146749 11:8726934-8726956 GCTGAAGGGAAGCCTGGTCTTGG - Intronic
1079590458 11:22176997-22177019 CCTGGAGGGGAGCTATTTGTGGG + Intergenic
1083014546 11:59439606-59439628 GCTGCAGGGCATCCATATGTGGG + Intergenic
1083080364 11:60086231-60086253 GCTGAAGGGAACCAAAGTGTGGG + Intergenic
1085028828 11:73257615-73257637 GGCAAAGGGGAGCCATGTGGGGG + Intergenic
1085313678 11:75530872-75530894 GGTGGAGGGGAGCCATGGGAGGG + Intergenic
1091611998 12:2018592-2018614 GCTGAGATGGAGCCATGCGTGGG + Intronic
1091624906 12:2114302-2114324 GCTGAAAGGCTGCCTTGTGTGGG + Intronic
1091909515 12:4217662-4217684 GATGAAGAAGAACCATGTGTTGG - Intergenic
1097008168 12:55933524-55933546 GCTGAAGGGCAGCAAACTGTGGG - Intronic
1097223149 12:57461978-57462000 CCTGAAGGGGAGATATGGGTGGG + Intronic
1098722197 12:73914260-73914282 CCTGAAGGGAACCTATGTGTGGG + Intergenic
1098801075 12:74958938-74958960 ACTGAAGGGCAGCCATTTCTTGG + Intergenic
1098998357 12:77147839-77147861 GCAGTAGGGAATCCATGTGTGGG - Intergenic
1099233637 12:80056338-80056360 GCTGAACAGGCCCCATGTGTCGG - Intergenic
1101696149 12:107129112-107129134 GATTAAGGGGAGCCTTGTTTTGG + Intergenic
1102520017 12:113472264-113472286 GGAGAAGGGGAGCGAAGTGTGGG - Intronic
1103039558 12:117684106-117684128 GCTCTAGGGGAGCCAGGTGATGG - Intronic
1103516197 12:121509877-121509899 GGTGAAGTGGAGCCATCGGTGGG + Exonic
1104578049 12:129986384-129986406 GCTGTAGGGAAGCCCTGTGTAGG + Intergenic
1104742332 12:131187880-131187902 AGTGAAGGGGAGCCAGGTGAAGG + Intergenic
1106903982 13:34385847-34385869 GCTGCAAGGGAGCCATGAATAGG + Intergenic
1110169561 13:72484567-72484589 CCTGAGGGAGAGCCATGGGTGGG - Intergenic
1113436881 13:110299373-110299395 GCTGAAGGAGATCCTTGTGTGGG + Intronic
1113467041 13:110520081-110520103 GCTGGGGGGGAGCCGTGTGCTGG + Intergenic
1114552262 14:23539624-23539646 GCTGAAGAGGAGCCATGTCGTGG + Intronic
1122957483 14:105077643-105077665 GCTGGCCTGGAGCCATGTGTGGG - Intergenic
1123112923 14:105881413-105881435 CCTGGAGGGGAGACATCTGTTGG + Intergenic
1123700411 15:22910519-22910541 GCTGAAGCAGAGGCATGTGCAGG - Exonic
1124622000 15:31279115-31279137 GCCGAAGGGGTGGCATGCGTGGG - Intergenic
1129771673 15:78206872-78206894 GCAGGAAGGGAGCCATTTGTGGG - Intronic
1131405860 15:92163847-92163869 CCTGAGGGGGAGCCAGGTGGGGG + Exonic
1132756211 16:1486712-1486734 GCTGCAGGGGAGCCATCGGCAGG - Intronic
1136076445 16:27820501-27820523 GCTGTGGGGGAGCCTTGTGAAGG - Intronic
1137343979 16:47637365-47637387 GCCGAGGGTGAGCCAGGTGTTGG - Intronic
1139428172 16:66895932-66895954 GGTGAGGGGGAGCCATGGTTCGG - Intergenic
1142302202 16:89265342-89265364 CCTGAGGGGGAACCCTGTGTCGG + Intergenic
1142482612 17:228104-228126 GCTGGAGGGGAGCCTGGGGTGGG + Intronic
1145018994 17:19415605-19415627 GCTGCACGGGAGGCAGGTGTGGG + Intronic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1148766965 17:50045189-50045211 GCTGAAGGTGAGCCCTGAGAAGG + Intergenic
1149526923 17:57363826-57363848 GCTGATGGGAAGCCTTATGTGGG + Intronic
1149867774 17:60160233-60160255 GGTGAAAGGGTGTCATGTGTGGG + Intronic
1152911948 17:83010083-83010105 GCTGCAGGGGACCCTGGTGTGGG + Intronic
1153247591 18:3088209-3088231 GCAGAAGGCGAGGGATGTGTGGG + Intronic
1154346736 18:13548812-13548834 GCAGCAGGGGAGGCATGGGTGGG - Intronic
1155179787 18:23334394-23334416 GTTGAAGGGGAGGATTGTGTGGG - Intronic
1158522014 18:58179521-58179543 GCAGGAGGTGAGCCATGGGTAGG + Intronic
1159036734 18:63285083-63285105 GCTGCAGGTGAGCCAGCTGTGGG - Intronic
1162269287 19:9600929-9600951 AATGAAGGGGAGCCAGATGTGGG - Intergenic
1165074546 19:33273599-33273621 GCCGCGGGGGAGCCGTGTGTGGG + Intergenic
1166104757 19:40591815-40591837 GTTGCAGGGGAGGAATGTGTTGG + Intergenic
1166135913 19:40777151-40777173 GCTGCCAGGGAGCCAAGTGTGGG - Intronic
1167118857 19:47504531-47504553 GCAGAAGGAGGGCCAGGTGTGGG + Intronic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
928370533 2:30737069-30737091 CTGGAAGGGGAGCCATGAGTAGG + Intronic
929205387 2:39286135-39286157 GTTGAAGGGGAGGGATGTTTTGG + Intronic
929797981 2:45074940-45074962 GCTGAAAGGCCGTCATGTGTGGG + Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
933437029 2:82261163-82261185 GAGGAAGGGGATCCAGGTGTGGG - Intergenic
933564624 2:83934932-83934954 GCTGAAGGGCAGGCTTTTGTTGG + Intergenic
936236069 2:110743833-110743855 GCAGAAGAGGAGAAATGTGTAGG - Intronic
937907451 2:127059096-127059118 GCGGCAGGGGAGCCATCTGGAGG + Exonic
938402564 2:131005369-131005391 GCTGGAGGGCAGCCCTGTGTGGG - Intronic
940353197 2:152711894-152711916 TCTGAAGGGGAGGTATATGTTGG + Intronic
942402078 2:175613261-175613283 TCTGATGGAGAGCCATTTGTTGG + Intergenic
945045121 2:205775051-205775073 CCAGCAGGGGAGCCATGGGTGGG - Intronic
945082111 2:206096821-206096843 GCTGAAGGGGAGAAAGTTGTGGG - Intergenic
946482482 2:220070410-220070432 GCTGAAGGGGAGCAAGGGGTTGG - Intergenic
948225853 2:236308935-236308957 GCTGCAGGGGAGCTGTGAGTGGG + Intergenic
1170434253 20:16308912-16308934 GCTGCCTGGGAGACATGTGTTGG - Intronic
1171058914 20:21936945-21936967 GCTTAAGTGGAGCCCTGTGGGGG - Intergenic
1171245302 20:23606014-23606036 GAAGAAGGGAGGCCATGTGTGGG - Intergenic
1173614937 20:44396419-44396441 GCAGTTGGGGAGGCATGTGTAGG - Intronic
1175457092 20:59123673-59123695 GCTCAAGGAGAGCGATGTGGAGG + Intergenic
1176086220 20:63296750-63296772 GCTGAAAGGCAGGAATGTGTGGG - Intronic
1177968599 21:27760094-27760116 GCTGAACAGGAGCCAGGTGTTGG - Intergenic
1179104123 21:38383436-38383458 GCTGGTGGGGAGCCTAGTGTTGG + Exonic
1181636659 22:24177830-24177852 GCTGGGCTGGAGCCATGTGTGGG + Intronic
1181824988 22:25507753-25507775 GCTGAAGGTGAGCCAGGAGGAGG + Intergenic
1181882411 22:25991508-25991530 GTTAAAGGGTAGCAATGTGTAGG + Intronic
1182701690 22:32245348-32245370 GGTGCAGGGAAGCCATGTGCAGG - Intronic
1184512704 22:44942718-44942740 GCTGTCGGGGAGCCACGTGGAGG + Intronic
1185019909 22:48367957-48367979 GCTGTAGGGGAGCCAGGTGGGGG + Intergenic
950685607 3:14616542-14616564 GCTGAAGAGGAGGCACATGTGGG + Intergenic
959008022 3:101042617-101042639 GCTAAAGGGAGGCCATGTGGCGG + Intergenic
961119016 3:124357387-124357409 CCTGATGGGGAGCCATCTATAGG - Intronic
961385953 3:126523771-126523793 GCTGCAGGGTAGCCTTGGGTCGG + Intergenic
974915016 4:68169048-68169070 ACTGAAGGTGCACCATGTGTAGG + Intergenic
976521040 4:86027050-86027072 GCTCTAGGGCAGCCATGTGCTGG - Intronic
978659532 4:111108188-111108210 GCTGGAGGGGAGGCATGGCTTGG + Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
985478545 5:92716-92738 CCTGAAGGGGAGCCAGGGGAGGG + Intergenic
988857292 5:35240607-35240629 TCTGAGGTGGAGCCAGGTGTTGG - Intergenic
989543538 5:42646033-42646055 GTAGAAGGTGAGCCATGTCTAGG - Intronic
990263112 5:54046769-54046791 GCAGAAGGGGAGCCACATGGTGG + Intronic
990847743 5:60162831-60162853 GTAGAAGGGGTGCCAAGTGTTGG - Intronic
993386489 5:87268348-87268370 GCTGAAGGGGAGACGCGTCTGGG + Exonic
994384307 5:99111442-99111464 GCCCCATGGGAGCCATGTGTAGG + Intergenic
996404956 5:123095341-123095363 GCTGAAAGGGAGCGATGGGCGGG - Intronic
996869279 5:128168810-128168832 GCAGAAGGTGAGCCATGGGCAGG - Intronic
998714459 5:144867298-144867320 GGTGAATGGGAACCATGTGAGGG - Intergenic
999263218 5:150250362-150250384 GCTGAAGGGTACCCTTGGGTGGG - Intronic
1000381538 5:160634115-160634137 GCTGAAGGGGAACCACATATGGG + Intronic
1001117110 5:168948971-168948993 CCTGAAGGGCAGCCAGGTGTGGG - Intronic
1003122994 6:3333465-3333487 GCTGAAGTGGAGCGATGGGGCGG - Intronic
1004089888 6:12489986-12490008 ACTGAAGGGAAGAAATGTGTAGG + Intergenic
1005310268 6:24552508-24552530 GGTGAAAGGGAGCCAGGTGCAGG - Intronic
1006114184 6:31766492-31766514 GCTGAGGGGCAGCCCTGTGCAGG + Exonic
1007509777 6:42366065-42366087 GCTGCAGGGGAGGAATGTGCTGG - Intronic
1008946348 6:57101248-57101270 TCTGAAGCGGAGTCATGTGAAGG + Intronic
1010778745 6:79918341-79918363 ACTCAAGGAGAGCCAGGTGTAGG + Intronic
1013419980 6:109958766-109958788 GCAGAAGTTGTGCCATGTGTGGG - Intergenic
1017686644 6:156920170-156920192 GCTGAAGGGGAGGGAGGTGAAGG - Intronic
1018916362 6:168134921-168134943 GCAGAAGAGGAGCCCTGTGGCGG + Intergenic
1019310154 7:356618-356640 GCAGAAGGGGAGGCATCTGCAGG - Intergenic
1020503059 7:8947466-8947488 GCTGTAAGGGAGCCAGGTGGGGG - Intergenic
1020911492 7:14137544-14137566 GCAGAAGGGGAGCTCAGTGTCGG - Intergenic
1022839709 7:34151519-34151541 GCTGAGTGTGAGCCAGGTGTAGG + Intronic
1023647735 7:42336785-42336807 ACTGAAGAAGAGCCATGTGGTGG + Intergenic
1029701839 7:102252326-102252348 GCTGAAGGGGAGCCATGCCGAGG - Exonic
1030274805 7:107709229-107709251 GCTGCAGGCCAGCCATGTGTGGG + Intronic
1031011051 7:116525730-116525752 GCTGAAGGGCAGCTACGTGTTGG - Intronic
1032277769 7:130474797-130474819 GCTGACTGGGAACCCTGTGTTGG + Intergenic
1033413943 7:141145960-141145982 GCTGAAGGGTAACTATTTGTTGG + Intronic
1034820181 7:154210081-154210103 GGTGAAGAGGAGTCATTTGTTGG + Intronic
1037810428 8:22083236-22083258 GCTGGAGCAGAACCATGTGTGGG + Intergenic
1040872292 8:52113197-52113219 AGTGAAGGGTATCCATGTGTAGG - Exonic
1042762218 8:72283248-72283270 GCTGGAGAGGAGCACTGTGTAGG - Intergenic
1047129997 8:122008356-122008378 ACTGTAGGGGAGCCAGGTATAGG + Intergenic
1047919779 8:129622849-129622871 GTTGAAGGGGAAACCTGTGTAGG + Intergenic
1048926881 8:139279358-139279380 GCAGAAGGAAAGCCATGTATGGG + Intergenic
1049320832 8:141995315-141995337 GGTGAGGTGGAGCCATGTGCTGG + Intergenic
1049370802 8:142265210-142265232 GCTGCAGGAGAGCCTTGTGGTGG - Intronic
1049824003 8:144655250-144655272 GCTGATGGGTGGCCATGGGTGGG - Intergenic
1050034144 9:1417292-1417314 GATGAAGCGGAGCCATTTCTTGG - Intergenic
1052096531 9:24390999-24391021 GCAGAGCGTGAGCCATGTGTCGG + Intergenic
1053097979 9:35345741-35345763 GCTGAAAGGGAGCCCTGGGCAGG + Intronic
1053540332 9:38967205-38967227 GCTGAAGGTGAGACTTGTGGAGG - Intergenic
1053804677 9:41789363-41789385 GCTGAAGGTGAGACTTGTGGAGG - Intergenic
1054140606 9:61526100-61526122 GCTGAAGGTGAGACTTGTGGAGG + Intergenic
1054625810 9:67396718-67396740 GCTGAAGGTGAGACTTGTGGAGG + Intergenic
1057351093 9:94299366-94299388 TCTGAAGGGGAGCCATGCTTTGG - Intronic
1061233317 9:129327642-129327664 GCAGAAGGGAAGGCATTTGTCGG - Intergenic
1062428115 9:136515400-136515422 CCTGAAGGGGTGGCACGTGTCGG + Exonic
1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG + Exonic
1062707404 9:137953148-137953170 GCTGAAGAGATGCCATGTATGGG + Intronic
1203772744 EBV:57864-57886 GCTGAAGGGGGGCGATGGGGCGG + Intergenic
1187504188 X:19865432-19865454 GGAGGAGGGGAGCCATGTGAAGG + Intronic
1195724296 X:107898382-107898404 GCTTAAGGGGAGACAAGTTTAGG - Intronic
1197109261 X:122754053-122754075 GATGCAGGGGATACATGTGTAGG + Intergenic
1197474352 X:126902247-126902269 ACTGATGGGGATCCATTTGTAGG - Intergenic