ID: 900593210

View in Genome Browser
Species Human (GRCh38)
Location 1:3468897-3468919
Sequence CCTGGACCAGCTCTCCACTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 245}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900593203_900593210 2 Left 900593203 1:3468872-3468894 CCCCCCAGGTGGTGGAATTGGGC 0: 1
1: 0
2: 0
3: 18
4: 165
Right 900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG 0: 1
1: 0
2: 0
3: 22
4: 245
900593207_900593210 -2 Left 900593207 1:3468876-3468898 CCAGGTGGTGGAATTGGGCATCC 0: 1
1: 0
2: 1
3: 5
4: 115
Right 900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG 0: 1
1: 0
2: 0
3: 22
4: 245
900593204_900593210 1 Left 900593204 1:3468873-3468895 CCCCCAGGTGGTGGAATTGGGCA 0: 1
1: 0
2: 0
3: 17
4: 178
Right 900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG 0: 1
1: 0
2: 0
3: 22
4: 245
900593205_900593210 0 Left 900593205 1:3468874-3468896 CCCCAGGTGGTGGAATTGGGCAT 0: 1
1: 0
2: 1
3: 16
4: 150
Right 900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG 0: 1
1: 0
2: 0
3: 22
4: 245
900593197_900593210 15 Left 900593197 1:3468859-3468881 CCTGGGCCTGTGTCCCCCCAGGT 0: 1
1: 0
2: 4
3: 45
4: 377
Right 900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG 0: 1
1: 0
2: 0
3: 22
4: 245
900593206_900593210 -1 Left 900593206 1:3468875-3468897 CCCAGGTGGTGGAATTGGGCATC 0: 1
1: 0
2: 0
3: 15
4: 114
Right 900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG 0: 1
1: 0
2: 0
3: 22
4: 245
900593200_900593210 9 Left 900593200 1:3468865-3468887 CCTGTGTCCCCCCAGGTGGTGGA 0: 1
1: 1
2: 0
3: 15
4: 184
Right 900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG 0: 1
1: 0
2: 0
3: 22
4: 245
900593195_900593210 24 Left 900593195 1:3468850-3468872 CCGAGAGCTCCTGGGCCTGTGTC 0: 1
1: 0
2: 4
3: 54
4: 410
Right 900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG 0: 1
1: 0
2: 0
3: 22
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900593210 Original CRISPR CCTGGACCAGCTCTCCACTG AGG Exonic
900246962 1:1640799-1640821 CCAGGACCAGTTCCCCACAGGGG - Intronic
900258184 1:1707931-1707953 CCAGGACCAGTTCCCCACAGGGG - Intronic
900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG + Exonic
905205401 1:36340412-36340434 CCTGGCCCTGCTCCCCAGTGGGG - Exonic
905486001 1:38297081-38297103 CCTGAGGCAGCTCTACACTGTGG - Intergenic
906026099 1:42675400-42675422 CTTGGTTCATCTCTCCACTGTGG + Intronic
906211328 1:44013812-44013834 CCTTGTCCAGATCTCCTCTGGGG + Intronic
907531411 1:55101674-55101696 ACTGGACCTGCTATCCACTGGGG + Exonic
908116906 1:60949632-60949654 CATGGCCCAGCTCTCCCATGCGG + Intronic
909519653 1:76552310-76552332 CCTGCAAAAGCTCTCCAATGTGG - Intronic
913062152 1:115218379-115218401 CATGGACCAAATCCCCACTGTGG - Intergenic
915279825 1:154814821-154814843 CCTGGCCCAGCTGTGCACAGTGG - Intronic
915620953 1:157083819-157083841 CCTGGAACAACTCTCCTCAGGGG + Intergenic
915725140 1:158011855-158011877 CCTGGACCGGGTCCCCTCTGTGG + Intronic
919958298 1:202439811-202439833 GCTGGGCTAGGTCTCCACTGGGG + Intronic
920581161 1:207109179-207109201 CCTGGATCTGGTCTCCACTGTGG - Intronic
921165479 1:212503839-212503861 CTAGGACCAGCACTCCCCTGGGG + Intergenic
922366876 1:224873939-224873961 CATGGTTCAGCACTCCACTGTGG + Intergenic
923048463 1:230372881-230372903 CCTGGCCCAGCCTTCCTCTGTGG + Intronic
924893358 1:248308564-248308586 CATGGACCAGCACACCTCTGTGG - Intergenic
1062769508 10:87866-87888 CCTGGGTCAGCTCTCAGCTGTGG - Intergenic
1063366870 10:5496358-5496380 TCTTGACCAGCTCAGCACTGAGG + Intergenic
1064034374 10:11903213-11903235 GCTGTACCAGCTTTCCAATGTGG - Intergenic
1064366656 10:14714520-14714542 CCTGGGCCTGCTGTCTACTGAGG - Intronic
1065817519 10:29495578-29495600 CCTGGAGGAGAGCTCCACTGCGG - Intronic
1066091165 10:32022152-32022174 GCTGGACTAGTTCTTCACTGAGG + Exonic
1067494188 10:46747494-46747516 CCTGGAGCAGCTCAACAATGTGG - Intergenic
1067600471 10:47592903-47592925 CCTGGAGCAGCTCAACAATGTGG + Intergenic
1071652005 10:87400775-87400797 CCTGGAGCAGCTCAACAATGTGG + Intergenic
1072757067 10:98028698-98028720 CCAAGACCTTCTCTCCACTGGGG - Intronic
1073205837 10:101768892-101768914 CCTGGGCCAGCTCTGCACTCAGG + Intergenic
1074905833 10:117862635-117862657 CCAGGACCATCTCTGCACTTAGG - Intergenic
1075385215 10:122050670-122050692 CTTGGAACATCTCACCACTGAGG - Intronic
1076174703 10:128359176-128359198 CCTGGATCAGCTCATCCCTGTGG - Intergenic
1077243139 11:1522006-1522028 CCTTGACCACGTCTCCCCTGGGG - Intergenic
1077382139 11:2249123-2249145 CCTGGAGAAGCTCTCCTCAGGGG + Intergenic
1077393429 11:2310062-2310084 CCTGGCCCAGCTCACCACCCTGG - Intronic
1077459996 11:2704269-2704291 CCTGCACCTGCATTCCACTGGGG + Intronic
1077911203 11:6572281-6572303 CCTTGCCCCGCTCTCTACTGTGG + Intronic
1081607737 11:44537732-44537754 CCTTGGCCACCCCTCCACTGTGG - Intergenic
1081757282 11:45553871-45553893 GCTGGAACAGCTCACCTCTGGGG + Intergenic
1083722931 11:64612297-64612319 CATGGTCCAGCTCTACACTAAGG + Intronic
1083986237 11:66217500-66217522 CCTAGGCTAGCTCTGCACTGGGG - Intronic
1084173192 11:67410326-67410348 CCTGGACTCGCCATCCACTGGGG - Intronic
1084176547 11:67425264-67425286 CTGTGACCCGCTCTCCACTGTGG - Exonic
1084840102 11:71839716-71839738 CCAGGACAGGCTCTCCAGTGTGG + Intergenic
1085246670 11:75107506-75107528 CTTGGACCACCTCTTCGCTGGGG - Intronic
1088154709 11:106789695-106789717 CCTGCATTAGCTCTGCACTGGGG + Intronic
1089044410 11:115486945-115486967 CCTGAACCAGTTCTCTGCTGTGG + Intronic
1089330344 11:117685034-117685056 CCTGGTCCAGCTCTGCCCTTGGG - Intronic
1089518315 11:119047775-119047797 GATGGACCAGATCTTCACTGAGG - Exonic
1090653709 11:128826712-128826734 CATTTACCAGCTCACCACTGAGG - Intergenic
1091450758 12:570703-570725 CCCGGACCAGCTCTGCAGGGAGG - Intronic
1091780917 12:3214137-3214159 CTTGGACCAGCTCATCTCTGAGG + Intronic
1092532870 12:9360013-9360035 CCTGGACCCCCTGTCCACAGAGG + Intergenic
1094842769 12:34348936-34348958 CCTGGAGCAGCTCTACCCCGCGG - Intergenic
1095953398 12:47793706-47793728 CCTAGACCTGCTGTCCAGTGGGG + Intronic
1096050817 12:48606022-48606044 CCTTGAGCAGCTCTGCCCTGTGG + Intergenic
1098290391 12:68952270-68952292 CAGGGACCAGCTCTCCCCAGTGG - Intronic
1100218832 12:92482023-92482045 TGTGGACCAGCTCTACACAGTGG - Intergenic
1100265458 12:92971576-92971598 CCTGGACCTGATCATCACTGAGG + Intergenic
1102251342 12:111389620-111389642 CCTGGACCTGCCTTCCAATGTGG - Intergenic
1102431091 12:112883237-112883259 CCAGGACTGGCTCCCCACTGAGG + Intronic
1103009129 12:117444514-117444536 CCTGGAGCTGAGCTCCACTGTGG + Intronic
1104358201 12:128107188-128107210 CCTGGGCAAGCTCTGCTCTGTGG - Intergenic
1104749844 12:131231482-131231504 GCTGGCCCAGCTCTTCCCTGTGG - Intergenic
1105829392 13:24150419-24150441 CCTGAACCAGGTCTCCCCAGAGG - Intronic
1107517965 13:41150104-41150126 TCAGGTCCCGCTCTCCACTGTGG - Intergenic
1109780793 13:67107467-67107489 TCTGGGCCTCCTCTCCACTGAGG + Intronic
1110794420 13:79620235-79620257 ACAGGTCTAGCTCTCCACTGAGG + Intergenic
1113095902 13:106663558-106663580 CCTACAGCAGCTCCCCACTGCGG + Intergenic
1113757935 13:112826870-112826892 CCTGTCCCAGCTCTTCATTGAGG - Exonic
1115071251 14:29324462-29324484 TCTGCCCCAGCACTCCACTGAGG + Intergenic
1117882655 14:60327632-60327654 GCTGGACGAGCCATCCACTGTGG - Intergenic
1118988751 14:70779164-70779186 CCTGCCCCAGCCCTTCACTGCGG - Intronic
1119433306 14:74582301-74582323 ACTGGACCTGCTGACCACTGAGG + Intronic
1121307446 14:92915924-92915946 GCTGCTCCTGCTCTCCACTGAGG - Intergenic
1121868861 14:97388716-97388738 CCTGATCCCTCTCTCCACTGTGG + Intergenic
1122171966 14:99884124-99884146 CGCAGACCAGCTCTGCACTGAGG - Intronic
1122328111 14:100894886-100894908 CCTGGACCCACTGCCCACTGGGG - Intergenic
1122366556 14:101197993-101198015 CCTGGTCCACGTCTTCACTGAGG + Intergenic
1122671869 14:103378919-103378941 CCAGGGCCATCTCTACACTGCGG + Intergenic
1122843133 14:104476390-104476412 CCTGGAGAAGCTCTCCCCGGTGG + Intronic
1125506343 15:40269901-40269923 CATGGGCCAGCTCTACTCTGAGG - Intronic
1126798608 15:52280636-52280658 CCTGGACCAGCTCCACAAGGTGG + Intronic
1128072461 15:64806426-64806448 ACTGGACCAACTGACCACTGTGG + Intergenic
1128133578 15:65246561-65246583 CCTGACCCAGCTCTGCCCTGTGG + Intronic
1128591376 15:68900769-68900791 CCTTGCCCAGCTCTCCATTAAGG - Intronic
1129078939 15:73022739-73022761 CCTGCATCAGCTCACCATTGTGG - Intergenic
1130064352 15:80592143-80592165 CCTGGCTCTGCTCTCCTCTGTGG + Intronic
1130716605 15:86341005-86341027 CCTAGCCCTGCTCCCCACTGGGG - Intronic
1130960704 15:88657082-88657104 CTGGGGCCAGCTCTCAACTGTGG - Intergenic
1131049485 15:89337064-89337086 CCTGGCCCAACTGTCCACAGGGG + Intergenic
1132350754 15:101138407-101138429 TCTGAACCAGCTATTCACTGAGG + Intergenic
1132458642 16:38412-38434 CCTGGGTCAGCTCTCAGCTGTGG - Intergenic
1133118634 16:3592751-3592773 CCTGCACTATCTCTACACTGCGG - Exonic
1134639607 16:15819742-15819764 CCCGAACCATCTCTCCCCTGCGG + Intronic
1136383074 16:29905964-29905986 CCAGGACCTCCTCTCTACTGCGG + Exonic
1138053958 16:53813068-53813090 TCTGAACCAGCCATCCACTGAGG + Intronic
1139282885 16:65785129-65785151 CATGGCCCAGCCCTCCCCTGGGG + Intergenic
1139283357 16:65788592-65788614 ACTGGCCCAGCTCTCCAATCAGG - Intergenic
1139387945 16:66586255-66586277 CCAGGACCAGCTCCCCTCTCTGG - Intronic
1141224000 16:82098121-82098143 TCTGGACCACCTCCCCGCTGAGG + Exonic
1141332141 16:83120589-83120611 TCTAGACCAGCTCTCATCTGAGG + Intronic
1141869579 16:86775566-86775588 CTTGGGCCACCTCTCCACTCGGG + Intergenic
1142231912 16:88903937-88903959 CCGGCACCAGCTCCCCAGTGGGG - Intronic
1142349395 16:89573068-89573090 CCTGGACCAGGAGTCCACCGAGG - Intergenic
1142504972 17:357628-357650 CCTGGCCCAGCTCTCCAGAGAGG - Intronic
1142973715 17:3630503-3630525 CCTGGGCCTGCCCTCCACTGGGG + Intronic
1145267888 17:21389247-21389269 CCTGGACCAGCCATGCTCTGTGG - Intronic
1145924184 17:28633548-28633570 CCTGCACCAGCTGGCCACTGAGG - Exonic
1145940447 17:28740837-28740859 CCTGGACCACCTCTCCCTGGGGG + Exonic
1147473719 17:40689273-40689295 CCTGGACAAGGTCTCAACTCTGG - Intergenic
1148645403 17:49217357-49217379 GCTGGATCAGCTCTCCCCTTTGG - Intronic
1150248232 17:63691681-63691703 CCTCCACCAGCCCTCCCCTGAGG + Intronic
1150723835 17:67635834-67635856 GCTGGAGCAGTTCTCAACTGGGG + Intronic
1152068469 17:78124029-78124051 CCTGGCCTACCTCTCCACTGTGG - Exonic
1152632854 17:81418307-81418329 CCAGGCCCAGCTCCCCTCTGTGG - Intronic
1152962575 18:88660-88682 CCTGGGTCAGCTCTCAGCTGTGG - Intergenic
1157584249 18:48791087-48791109 CCTGTACAAGCCCTACACTGTGG + Intronic
1159265331 18:66072405-66072427 CCTTGGGCAGCTCTGCACTGTGG - Intergenic
1161272175 19:3396050-3396072 GCTGGAGCAGGACTCCACTGTGG + Intronic
1163287802 19:16359389-16359411 CCATAACCAGCTCTCCTCTGGGG - Intronic
1164573263 19:29389307-29389329 TCTGGACCAGCCCTGGACTGTGG - Intergenic
1165716383 19:38048466-38048488 GCTGGACCAGCTGTAGACTGAGG - Intronic
1166132837 19:40756845-40756867 CCTGGAACATCCCTCCCCTGAGG - Intronic
1167259407 19:48450104-48450126 ACTGGGACAGCTCTCCACAGGGG - Intronic
1168241230 19:55089865-55089887 CCTGCACCAGCTTTTCCCTGAGG + Intergenic
1168322509 19:55518479-55518501 CATGGACCCACTGTCCACTGAGG + Exonic
1168468854 19:56625052-56625074 CCTGGGCAAGCTCCCCACTCAGG + Exonic
925188341 2:1864526-1864548 ACAGGGCCAGCTCTCCCCTGGGG - Intronic
925671248 2:6311868-6311890 CCTTGATCAGCTCTCAGCTGAGG - Intergenic
925875788 2:8310280-8310302 CCTGGTCAAGCTGCCCACTGTGG + Intergenic
926059080 2:9794076-9794098 CCTGGACCAGGTCTCCATGTTGG - Intergenic
926330365 2:11820467-11820489 CCTGTACCAGCTCTCCTTTAGGG - Exonic
929904859 2:46036810-46036832 CCTACACAAACTCTCCACTGAGG - Intronic
929916716 2:46142637-46142659 CCTGGACCACCTTTCCCCTGGGG + Intronic
932142553 2:69292800-69292822 CCTGGGCCAGGTTTCCACTCAGG - Intergenic
932398790 2:71465880-71465902 CCTTGAACAGCTTTCCACTGTGG + Intronic
934686912 2:96327786-96327808 CCAGGAGCAGCTCACCAGTGTGG + Exonic
934772050 2:96913413-96913435 CCTGGACCCCTTCTCCACTGTGG - Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935573573 2:104687304-104687326 CCTGGCCCAGGTCCCCACTGGGG - Intergenic
936452718 2:112645735-112645757 CGTGGACCGGCTCCCCGCTGGGG + Intergenic
937274046 2:120672970-120672992 CCAGGGCCAGCGCTCCACTCTGG + Intergenic
938966316 2:136391843-136391865 CCTGCACCAGCTGGCCCCTGTGG + Intergenic
942736633 2:179121867-179121889 CCTGGATCAGATCTCCAATCAGG - Exonic
944595689 2:201258519-201258541 CCTGGCCCAGGTCTCCTGTGTGG + Intronic
944688602 2:202139644-202139666 CCTGGGTCAGGCCTCCACTGAGG + Intronic
947507409 2:230719257-230719279 CCTGGACAAACCCTCCACTTTGG - Intronic
947718377 2:232352890-232352912 CCAGGATCAGCTCTCCCCGGGGG + Intergenic
947741863 2:232488293-232488315 CCTGGATGGGCTCTCCACTAGGG + Intergenic
947822487 2:233081789-233081811 CATGGATCAGCTCTTCTCTGTGG + Intronic
948354958 2:237370780-237370802 GCTGGACCAGCTCCCCAATGCGG - Intronic
948600654 2:239105939-239105961 CGTGGGGCAGCTCTCCAGTGCGG - Intronic
948786643 2:240356144-240356166 CCTGGGTCAGCTCTGCACTGTGG - Intergenic
948838619 2:240638059-240638081 CCTGTCCCAGCCATCCACTGTGG - Intergenic
1169197480 20:3691376-3691398 CCTGGCTGAGCTCCCCACTGGGG - Exonic
1170036542 20:11995871-11995893 CCAGGAGCACCTCTCCTCTGGGG - Intergenic
1170571233 20:17634003-17634025 CCTGGTCCAGCTGGCCAGTGAGG - Intronic
1170590681 20:17769071-17769093 CATGGACAAGGTATCCACTGTGG + Intergenic
1171048363 20:21832640-21832662 TCTGCACAAGCTCTGCACTGGGG + Intergenic
1171308845 20:24129553-24129575 CCTTGAGCAGGTCGCCACTGTGG + Intergenic
1173249814 20:41358495-41358517 CCTGGATGAGCTCTCCCCGGGGG - Exonic
1173266098 20:41483621-41483643 CCTAGACCAGCAGTCCAGTGAGG + Intronic
1174177203 20:48652607-48652629 CCTGGGCCTGCTCGCCACTGGGG + Exonic
1176172722 20:63703433-63703455 CTTGGGCCTCCTCTCCACTGTGG - Intronic
1176676084 21:9778771-9778793 CCTGGGCCTGCTCTCCAATCTGG - Intergenic
1177228744 21:18291503-18291525 CCTGGAACAGGTTTACACTGAGG + Intronic
1179473944 21:41631610-41631632 CCTGCCTCAGCTCTCCTCTGTGG - Intergenic
1179643993 21:42764451-42764473 CCTGGAGGAGCTCCCCACTGGGG - Intronic
1179906736 21:44426600-44426622 CCTGGCCCAGCTTTGCAGTGGGG + Intronic
1180557974 22:16592702-16592724 CACGGACCAGCACTCCACTGTGG + Exonic
1183394956 22:37566391-37566413 CCTGGGCAAGCTCTCGCCTGTGG + Exonic
1184225660 22:43127763-43127785 CCTGGCCCAGCTCTCCGAGGTGG + Exonic
1184330812 22:43826321-43826343 CCTGAACCAGCTTCCCTCTGAGG + Intronic
1184430927 22:44441241-44441263 CATGGTCCTGCTCGCCACTGTGG + Intergenic
1184506927 22:44909460-44909482 CGTGAACCAGGTCTCCTCTGTGG - Intronic
1185023702 22:48395715-48395737 ACTAGATCAGCTCTCCACAGAGG + Intergenic
1185220399 22:49626633-49626655 CCTGGAGCCGCACTGCACTGTGG - Intronic
951022242 3:17793541-17793563 CCTGGACCATATGTCCACAGGGG + Intronic
952900643 3:38109622-38109644 CCAGGACCAGCACGGCACTGTGG + Intronic
954466799 3:50660035-50660057 CCTGGACCAGCTCTACAGAATGG + Intergenic
959557550 3:107739480-107739502 CCTCTACCATCTGTCCACTGTGG + Intronic
961314087 3:126022714-126022736 CCTGGAGCAGGTCACCACTGAGG - Intronic
961356810 3:126344611-126344633 ACTGGACCAGAACTCCACAGGGG + Intronic
961435526 3:126913849-126913871 CCTGGAGCAGCTTGCCTCTGAGG + Intronic
961516897 3:127443700-127443722 CAGGCACCAGCTGTCCACTGGGG - Intergenic
962479421 3:135785763-135785785 CCTGGTCCATTACTCCACTGGGG - Intergenic
963068329 3:141281496-141281518 CCTGTGCCAGCTATTCACTGAGG - Intronic
967130993 3:186470574-186470596 TCTGGAGCAGCTGGCCACTGTGG + Intergenic
968881569 4:3302892-3302914 CCTGGCCCTGCTGTGCACTGTGG + Intronic
969395108 4:6915539-6915561 CCTGCCCAAGGTCTCCACTGTGG - Intronic
969517991 4:7659243-7659265 CCTGGACCAGGTCCTCACTAAGG + Intronic
969589602 4:8114287-8114309 CCTGTGCCAGCTCTGCCCTGGGG + Intronic
969781192 4:9405719-9405741 CCAGGACAGGCTCTCCAGTGTGG + Intergenic
970607456 4:17694036-17694058 CCTGGATCTGCTTTGCACTGAGG - Intronic
972696496 4:41451565-41451587 CCTGAACCAGCACTCCATGGGGG - Intronic
973050161 4:45586102-45586124 CCAGGAGGAGCTCTCCATTGTGG - Intergenic
974235851 4:59180097-59180119 CCCGGGTCACCTCTCCACTGAGG + Intergenic
977412691 4:96688450-96688472 CCAGAACCTGCTCTCAACTGGGG - Intergenic
978714555 4:111825740-111825762 ACTGGGCCAGCTACCCACTGAGG + Intergenic
981343389 4:143648015-143648037 CCTTGAACAGCTCTGCGCTGTGG - Intronic
983815855 4:172126548-172126570 CCTGGAGCGGCTCCCCAGTGTGG + Intronic
983977753 4:173955969-173955991 GCATGCCCAGCTCTCCACTGCGG + Intergenic
984169406 4:176343112-176343134 TCTGGGCCTCCTCTCCACTGAGG - Intergenic
985223817 4:187737870-187737892 CCTGGCTCACCTTTCCACTGGGG + Intergenic
985564697 5:609609-609631 CCTGGACCGGCTGCCCACTGAGG + Intergenic
985811996 5:2097051-2097073 CCTGGACCCGCTCTCCAGCACGG - Intergenic
985907773 5:2854394-2854416 CCAGCAGCAGCTATCCACTGGGG - Intergenic
988680383 5:33479375-33479397 CTTGCACCAGCAATCCACTGGGG - Intergenic
989396583 5:40963591-40963613 CCTTGACCAGCTCTGCTCTAGGG - Intronic
993022159 5:82605154-82605176 CCTGGAGAAGCTCCCCAGTGTGG + Intergenic
995121117 5:108536143-108536165 CCTGGCCCAACTCTTCTCTGAGG - Intergenic
997530068 5:134576589-134576611 GGTGGACCAACTGTCCACTGTGG - Intronic
998229951 5:140354786-140354808 CCTGGAGGAGCTCACCGCTGGGG - Intergenic
1001602341 5:172937284-172937306 CAAGGACCAGCTCTTCACAGAGG + Intronic
1003033576 6:2623584-2623606 CCTGCCCCATCTCCCCACTGCGG - Exonic
1003424939 6:5992750-5992772 CCTGAGCCAGCTCTGCACCGAGG - Intergenic
1003691177 6:8355158-8355180 CCTGAACCTGCTCTACAGTGAGG - Intergenic
1006084664 6:31587418-31587440 CCTGTACCAGCTGTCCCCAGAGG - Intronic
1006276641 6:33009509-33009531 CCAGGACCAGCCCTGCTCTGAGG + Exonic
1006750302 6:36372772-36372794 CCTGCCCCACCCCTCCACTGGGG - Intronic
1007110386 6:39310282-39310304 CCTGGACTAACCCTCCTCTGCGG - Intronic
1007625928 6:43246483-43246505 CCTGGAGCATCTGTCCAGTGGGG + Intronic
1017090460 6:150754466-150754488 CCTAACCCAGCTCTCTACTGTGG - Intronic
1017325474 6:153136623-153136645 CCTGGCCCTGCCTTCCACTGAGG - Intergenic
1019448988 7:1086726-1086748 CCTGCACCAGCTCTCCTGGGGGG + Intronic
1020432398 7:8127402-8127424 CCTGATCCACCTCTCCCCTGAGG - Intronic
1021224850 7:18014838-18014860 CCTTGACCAGCTCCCTGCTGAGG - Intergenic
1023734125 7:43219931-43219953 GCTGGGCCAGCCCTCCAGTGTGG + Intronic
1024198269 7:47081381-47081403 CCTGGTGCAGTCCTCCACTGAGG - Intergenic
1024767032 7:52671695-52671717 CCAGGACCACCTGCCCACTGTGG - Intergenic
1026843143 7:73682223-73682245 CCTGGACCAGGTCTCACCTGCGG + Exonic
1026896768 7:74013921-74013943 CCTGGACCAGCTCGCTCCTGCGG - Intergenic
1030654157 7:112147934-112147956 CCTCCACCAGCTCTCCCCTCAGG + Intronic
1033855618 7:145557967-145557989 CTGGGTCCAGCTCTGCACTGGGG + Intergenic
1034437972 7:151072146-151072168 CCTGGCCCAGCTCTCGGCAGGGG - Intronic
1034619341 7:152445303-152445325 CACAGACCAGCGCTCCACTGTGG - Intergenic
1035365729 7:158348585-158348607 CCTGGCCCAGCTCAGCACTCAGG - Intronic
1036278625 8:7379636-7379658 CCAGGACAGGCTCTCCAGTGTGG + Intronic
1036342897 8:7932232-7932254 CCAGGACAGGCTCTCCAGTGTGG - Intronic
1037806426 8:22060116-22060138 CCTGGACCTGCCTTCCTCTGTGG + Intronic
1040592152 8:48803420-48803442 CCAGGACCACTGCTCCACTGTGG - Intergenic
1043346757 8:79307088-79307110 CATGGACCAGCCTGCCACTGGGG + Intergenic
1044693483 8:94900659-94900681 CGGGGCCCTGCTCTCCACTGAGG + Intronic
1045474749 8:102543297-102543319 CTGGGACCTGCTCTCCAATGAGG - Intergenic
1045551845 8:103180015-103180037 CCTGGCCCAGGCCTGCACTGTGG - Intronic
1049290143 8:141797488-141797510 GCTGCAGCTGCTCTCCACTGTGG - Intergenic
1049684861 8:143935240-143935262 CCTGGACCAGGCCTTCTCTGTGG - Exonic
1049756800 8:144314368-144314390 CCAAGACCAGCCCTGCACTGGGG - Exonic
1049848926 8:144820472-144820494 CCTGGACCATCTGTACCCTGGGG + Intergenic
1051091288 9:13411948-13411970 CCTGGTTCTGCTCTGCACTGTGG - Intergenic
1055615970 9:78073500-78073522 CGTGGAACATCTCTCCACTGGGG - Intergenic
1056544293 9:87601090-87601112 CCTGGACCCGCTTTCCACCCTGG - Intronic
1057076359 9:92140231-92140253 CCTGCTCTAGCTCTGCACTGGGG + Intergenic
1057173110 9:92975688-92975710 CCTGCCCCAGCCCTCCCCTGAGG + Intronic
1060413223 9:123413576-123413598 CCTGGACCCGCTTTCCCCTCAGG - Intronic
1060786790 9:126457392-126457414 ACTGGCCCAACTCCCCACTGAGG + Intronic
1062423680 9:136496418-136496440 CCTGGCTCGGCTCTCCACTCAGG + Exonic
1062517689 9:136944459-136944481 CCTGGAGCAGCTCTGCCCGGCGG + Intronic
1185825708 X:3247265-3247287 CCTTCACCTGCTTTCCACTGAGG - Intergenic
1190650396 X:52563378-52563400 CCTGCCCCAGGTCACCACTGTGG + Intergenic
1194603361 X:95950853-95950875 CAGGGACCTGCTCACCACTGTGG + Intergenic
1195647571 X:107249810-107249832 CCTGGACAAACTCTTCTCTGAGG + Intergenic
1196050703 X:111300969-111300991 CCTGGTCAATCTCTCCACTGAGG - Exonic
1198691454 X:139289414-139289436 CCAGGGCCCTCTCTCCACTGAGG + Intergenic
1200397776 X:156001284-156001306 CCTGGGTCAGCTCTCAGCTGTGG + Intronic