ID: 900593336

View in Genome Browser
Species Human (GRCh38)
Location 1:3469334-3469356
Sequence GAGGACGTGACCCGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900593336_900593343 2 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593343 1:3469359-3469381 GTTCCAAGCATTGGTCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 56
900593336_900593350 30 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593350 1:3469387-3469409 CCGTGTCCAGCGTCACTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 82
900593336_900593346 28 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593346 1:3469385-3469407 GCCCGTGTCCAGCGTCACTGTGG 0: 1
1: 0
2: 1
3: 8
4: 84
900593336_900593348 29 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593348 1:3469386-3469408 CCCGTGTCCAGCGTCACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 53
900593336_900593340 -7 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593340 1:3469350-3469372 CGTCCTCCTGTTCCAAGCATTGG 0: 1
1: 0
2: 0
3: 12
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900593336 Original CRISPR GAGGACGTGACCCGGGTGGC AGG (reversed) Intronic