ID: 900593336

View in Genome Browser
Species Human (GRCh38)
Location 1:3469334-3469356
Sequence GAGGACGTGACCCGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900593336_900593343 2 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593343 1:3469359-3469381 GTTCCAAGCATTGGTCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 56
900593336_900593350 30 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593350 1:3469387-3469409 CCGTGTCCAGCGTCACTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 82
900593336_900593346 28 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593346 1:3469385-3469407 GCCCGTGTCCAGCGTCACTGTGG 0: 1
1: 0
2: 1
3: 8
4: 84
900593336_900593348 29 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593348 1:3469386-3469408 CCCGTGTCCAGCGTCACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 53
900593336_900593340 -7 Left 900593336 1:3469334-3469356 CCTGCCACCCGGGTCACGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 900593340 1:3469350-3469372 CGTCCTCCTGTTCCAAGCATTGG 0: 1
1: 0
2: 0
3: 12
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900593336 Original CRISPR GAGGACGTGACCCGGGTGGC AGG (reversed) Intronic
900369008 1:2323245-2323267 GGGGACGGCACCCGTGTGGCCGG - Intronic
900569301 1:3350554-3350576 GGGGAGGGGACCAGGGTGGCAGG + Intronic
900593336 1:3469334-3469356 GAGGACGTGACCCGGGTGGCAGG - Intronic
901092224 1:6649503-6649525 GAGGACGTGGCCTGTGGGGCAGG - Intronic
901511670 1:9720895-9720917 GAGGATGTGGCCCAGGTGGGTGG + Exonic
906198766 1:43946490-43946512 GACGACGTGACTCGAGGGGCCGG - Intergenic
906523964 1:46483803-46483825 GAAGACGTGGCCTGGTTGGCTGG + Intergenic
906720004 1:47997451-47997473 GAGGACCTGGCGCGGGGGGCGGG + Intergenic
911527552 1:99004781-99004803 GAGGACGAGGCACGGGAGGCGGG + Exonic
913327567 1:117639945-117639967 GATGACGTGTCCCTGGGGGCTGG - Intergenic
916663860 1:166947876-166947898 GCGGGCGCGACCGGGGTGGCTGG + Intronic
1076287386 10:129313409-129313431 GAGGACGTGGATGGGGTGGCAGG + Intergenic
1076705632 10:132299911-132299933 GAGGACGGGACCCAGGGCGCTGG + Intronic
1076841145 10:133046209-133046231 GAGGGCAGAACCCGGGTGGCTGG - Intergenic
1076846207 10:133070734-133070756 GAGGATGTGAGCCGGGTGGGCGG - Intergenic
1077895729 11:6451809-6451831 GAGGACTTGTCCAGTGTGGCTGG + Intronic
1083595878 11:63918068-63918090 CAGCACGTGCCCCGGGCGGCGGG - Intergenic
1084872251 11:72106127-72106149 GAGGATGTGACCAGGGTCACCGG - Exonic
1085027561 11:73245447-73245469 GAGGATGGGACCAGGGTGGCGGG + Intergenic
1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG + Intergenic
1090731368 11:129575644-129575666 GTGGAGGTGAGCCGGGAGGCAGG - Intergenic
1092756701 12:11770305-11770327 GAGGCCGTGGCCCGGGTTTCAGG + Intronic
1100635284 12:96429680-96429702 GAGGAGGGGACCCTGGAGGCTGG + Intergenic
1102096825 12:110247640-110247662 GACGACCTGACCCTGGTGGGTGG - Intergenic
1103080103 12:118016948-118016970 GAGGAGGTGGCTGGGGTGGCAGG + Intronic
1104966773 12:132511837-132511859 GAGGAAGGGGCCCGGGTGGGTGG - Intronic
1105767905 13:23579291-23579313 GAGGGCGGGGCCCGGGTGGGCGG + Intronic
1106563920 13:30869590-30869612 GAGGAGGAGACACGGGAGGCAGG + Intergenic
1111956585 13:94765856-94765878 CAGGACGTGACTCAGGAGGCAGG + Intergenic
1113749846 13:112769419-112769441 GAGCCCGTGACCCGGGTCCCTGG + Intronic
1114642664 14:24233883-24233905 GAGGGGGTGACCTGGGTGGTGGG - Intronic
1116190688 14:41661742-41661764 GAGAAGGTGACCCTAGTGGCAGG + Intronic
1117342516 14:54804423-54804445 GAGGTCATGTCCTGGGTGGCTGG + Intergenic
1121531757 14:94659191-94659213 GGGGAAGTGACCTGGGTGCCTGG + Intergenic
1122786576 14:104166917-104166939 GTGGAGGTGCCGCGGGTGGCTGG - Exonic
1122953599 14:105059716-105059738 GATGACGTGCCCAGGGTGGTCGG - Intronic
1124682024 15:31740102-31740124 GAGGACATGAGTGGGGTGGCCGG + Intronic
1125554564 15:40573536-40573558 GAGTACGTGTGCCGGGTGGAAGG + Exonic
1126267685 15:46773744-46773766 GAACATGTGACCCAGGTGGCTGG + Intergenic
1128771748 15:70288065-70288087 GAAGAGGGGACCTGGGTGGCAGG + Intergenic
1130053435 15:80502855-80502877 GGAGAGGTGACCAGGGTGGCCGG + Intronic
1141614153 16:85200946-85200968 GACGAACTGACCCTGGTGGCAGG + Intergenic
1142195657 16:88738176-88738198 GTGGGCGGGACCAGGGTGGCAGG + Intronic
1142763641 17:2054757-2054779 GAGCACGGGACTCGGGTGGTGGG - Intronic
1145077349 17:19867287-19867309 GAGGCCGGGCCCCGGGCGGCAGG - Intronic
1146656387 17:34637513-34637535 GAGGACGAGGCCCGGGGAGCTGG + Exonic
1148469249 17:47883365-47883387 GAGGATGTGACCTGGGTGGGGGG - Intergenic
1149443966 17:56699421-56699443 GAGGAGCAGAGCCGGGTGGCAGG - Intergenic
1149626450 17:58083697-58083719 GGGGGCGTCCCCCGGGTGGCGGG + Intronic
1150414541 17:64976124-64976146 GAGGCCGAGACCCGGATGCCAGG + Intergenic
1152103243 17:78314849-78314871 GATGACGTGAACCAGGGGGCGGG - Intergenic
1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG + Intronic
1152640978 17:81449127-81449149 GACCACGTGTCCCGGGTGGTGGG + Intronic
1160065186 18:75567546-75567568 GAGCAAGTGAGCCGGGTGGGAGG - Intergenic
1160663282 19:311410-311432 GAGGGTTTGTCCCGGGTGGCAGG + Intronic
1160754248 19:749403-749425 AAGGACGTGAAGGGGGTGGCGGG + Intergenic
1161302246 19:3548302-3548324 GAGGAAGTGACCCAGGTTCCTGG - Intronic
1167492939 19:49802300-49802322 GAGGGCGTGAGCAGGGAGGCTGG - Intronic
925004486 2:430511-430533 GGGGACGTGACCCTGCAGGCAGG + Intergenic
926043559 2:9693393-9693415 GAGGGTGTTAGCCGGGTGGCGGG - Intergenic
927844979 2:26466796-26466818 GAGGACGTGTCCCGGGAAGCCGG - Exonic
937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG + Intergenic
946165789 2:217863030-217863052 GAGGGGGTGACCAGGGAGGCTGG - Intronic
947588592 2:231371703-231371725 GAGAAAGTGACCCGGCTGGCGGG - Intronic
948761254 2:240192781-240192803 GAGGACTTGACCTGGGAGGTAGG - Intergenic
948850323 2:240702458-240702480 GAGGTGGTGACCATGGTGGCAGG - Intergenic
1173314512 20:41931242-41931264 GAGGACTTCACCCTTGTGGCAGG + Intergenic
1173605231 20:44326909-44326931 AAGGCCGTGCCCCGGGGGGCTGG - Intergenic
1173648099 20:44646148-44646170 GTGGGCTTGACCTGGGTGGCTGG - Intronic
1174268741 20:49351390-49351412 GAGGATGGGAGCAGGGTGGCCGG - Intergenic
1179996310 21:44976001-44976023 GAGGCCCTGAGCCTGGTGGCGGG - Intronic
1181000202 22:19984488-19984510 GATGACTTCACCCGGGTGGCAGG + Intronic
1183675519 22:39297036-39297058 GAGGAGGTGCCCCGGCAGGCAGG + Intergenic
1184837990 22:47035386-47035408 GAGGAAGTCACCAGGGAGGCTGG - Intronic
950634982 3:14308126-14308148 GAGGAACTGGCCAGGGTGGCCGG - Intergenic
950704051 3:14769238-14769260 GAGGAGGGGACCTGGGAGGCTGG + Intronic
954577780 3:51686274-51686296 GAGGGCGTGGCCAGTGTGGCAGG + Intronic
968954694 4:3712234-3712256 AAGGATGTGCCCCAGGTGGCCGG - Intergenic
969413328 4:7043394-7043416 GGGGACGCGGCCCGGCTGGCTGG + Exonic
981782707 4:148445001-148445023 GAGGGCGTGACCCGGGGAGGGGG - Intergenic
985680361 5:1252825-1252847 GAGGGCCTGGCCAGGGTGGCAGG - Intergenic
985776652 5:1847840-1847862 CAGGACGTGTCCCCGGTGGCAGG + Intergenic
985894566 5:2740695-2740717 AAGGACGTGGGCCGGGTGGAAGG + Intergenic
989740762 5:44768312-44768334 GAGGAACTGATCCGGGTAGCAGG + Intergenic
992202262 5:74396074-74396096 GAGGAGGTAGCCCTGGTGGCAGG - Intergenic
1002442772 5:179272938-179272960 GAGGAGGGGACGTGGGTGGCCGG + Exonic
1002648090 5:180672205-180672227 GAGGAGCTGACCCGGGGGGTGGG - Intergenic
1004291580 6:14372485-14372507 CAGCACTTGACCCAGGTGGCAGG - Intergenic
1014438018 6:121441668-121441690 GAGGACGTGAGCTGCGTGGATGG + Intronic
1019452154 7:1104668-1104690 GGAGACGTGAGCCGGGTGCCTGG + Intronic
1019536092 7:1530642-1530664 GGGGGCGTGGCCCGGGGGGCAGG + Intergenic
1019849355 7:3538794-3538816 GAGGAAGTCACTCTGGTGGCTGG + Intronic
1021234472 7:18125219-18125241 TAGGCAGTGTCCCGGGTGGCAGG - Intronic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1029438518 7:100575219-100575241 GAGGCCGTGAAGCGGGTGGGGGG - Exonic
1031976136 7:128094820-128094842 GAGGCCCTGGCCCAGGTGGCTGG + Intergenic
1034204774 7:149305804-149305826 GAGGAGGGGACATGGGTGGCTGG - Intergenic
1034278453 7:149834957-149834979 TAGGGAGTGACCAGGGTGGCAGG - Intergenic
1034292721 7:149945615-149945637 GAGGAGGTGACCTGGATGGATGG + Intergenic
1034813344 7:154151257-154151279 GAGGAGGTGACCTGGATGGATGG - Intronic
1037529035 8:19756713-19756735 GGGGGCGTGACGAGGGTGGCCGG - Intronic
1040491283 8:47924603-47924625 GAGGCCATGACCTGGGTGCCAGG + Intronic
1049465361 8:142749034-142749056 GAGGAAGGGGCCCGGGAGGCTGG - Intergenic
1050412090 9:5376869-5376891 GAGGAGGTGAACCAGGTGGCTGG + Intronic
1057215880 9:93228591-93228613 GAGGAGGTGATCCTGGGGGCAGG + Intronic
1057788962 9:98110042-98110064 GAGGAGGTGACCCCTGTGGGGGG - Intronic
1059408313 9:114116203-114116225 GAGGGTGTGAGCCGGCTGGCAGG + Intergenic
1061674874 9:132209946-132209968 GAGGAAGTGATCGGGGTGGGCGG + Intronic
1062060351 9:134492133-134492155 GAGGTCTTGACCCGTGAGGCTGG + Intergenic
1185610563 X:1391843-1391865 GGGGACGGGAACCGAGTGGCCGG - Intronic
1190114898 X:47619958-47619980 GCGGACGCGACCAAGGTGGCCGG + Intergenic