ID: 900595654

View in Genome Browser
Species Human (GRCh38)
Location 1:3479067-3479089
Sequence GTCCTGGCACTCAGAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900595646_900595654 7 Left 900595646 1:3479037-3479059 CCGGTAGGGGCCAGTTCAGACAG 0: 1
1: 0
2: 0
3: 6
4: 146
Right 900595654 1:3479067-3479089 GTCCTGGCACTCAGAATGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 144
900595650_900595654 -3 Left 900595650 1:3479047-3479069 CCAGTTCAGACAGCAGGGTGGTC 0: 1
1: 0
2: 0
3: 12
4: 95
Right 900595654 1:3479067-3479089 GTCCTGGCACTCAGAATGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 144
900595645_900595654 12 Left 900595645 1:3479032-3479054 CCTGGCCGGTAGGGGCCAGTTCA 0: 1
1: 0
2: 0
3: 8
4: 66
Right 900595654 1:3479067-3479089 GTCCTGGCACTCAGAATGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 144
900595644_900595654 13 Left 900595644 1:3479031-3479053 CCCTGGCCGGTAGGGGCCAGTTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 900595654 1:3479067-3479089 GTCCTGGCACTCAGAATGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900595654 Original CRISPR GTCCTGGCACTCAGAATGGG AGG Intronic
900595654 1:3479067-3479089 GTCCTGGCACTCAGAATGGGAGG + Intronic
902112924 1:14098261-14098283 GTCCTGGAACTAAGAAGGTGGGG + Intergenic
902247308 1:15129341-15129363 GTCCTGGCACCCAGAGGAGGAGG - Intergenic
904610254 1:31721948-31721970 GGGCTGGAACTCAGAATGAGGGG - Intergenic
905232729 1:36525072-36525094 ATCCTGGCACACAGGAAGGGAGG + Intergenic
906039687 1:42778606-42778628 GTCCTGGCAATGAGGAGGGGTGG + Intronic
907270744 1:53289540-53289562 GTCCTGCCCCTCAGTCTGGGTGG - Intronic
907481460 1:54748166-54748188 GTCCTGGCAACCAGAATAGATGG - Intergenic
908329748 1:63059512-63059534 GTCCTGGTATTCAGGAGGGGAGG + Intergenic
912923916 1:113896289-113896311 GTCCTGGCACTCAGCAGGTCGGG + Exonic
912938194 1:114021923-114021945 GTCCTGGCACTAGGAATGTAAGG - Intergenic
914826093 1:151138767-151138789 GTCCTGGGACTGAGAACAGGAGG + Intronic
915303811 1:154966509-154966531 GTCCTGTCCCTCAGGATGGCTGG - Exonic
916268786 1:162918659-162918681 GTCCTGGCACTAGGAATGTAAGG + Intergenic
916521576 1:165568209-165568231 GTCATGGCAGTGCGAATGGGAGG + Intergenic
918033474 1:180841197-180841219 CTCCTAGGCCTCAGAATGGGAGG + Intronic
919299720 1:195744418-195744440 GTGTTGGCACTCAGAGTGGCCGG + Intergenic
922572989 1:226644747-226644769 GCCCTGGGACTCAGCATGTGAGG + Intronic
1064566594 10:16646205-16646227 CTCCTATCACTCAGAAGGGGTGG - Intronic
1069097665 10:64279107-64279129 GTGCTGTCACTCAGAATGCTTGG - Intergenic
1074382609 10:112992614-112992636 GTCCTAGGACTCAGGATAGGAGG + Intronic
1074544173 10:114389594-114389616 GCTCAGGCACTCAGAATGGCTGG + Intronic
1076891874 10:133288669-133288691 GACCTGGCACTCACAGTGGGTGG - Intronic
1077935898 11:6785341-6785363 TTCCTGGCACTGACAATGGGTGG + Exonic
1079306752 11:19330110-19330132 GTCCTGGCACCAAGCAGGGGTGG - Intergenic
1084238194 11:67801633-67801655 GTCCTGGCACTTGGAAAGGAGGG + Intergenic
1084517865 11:69646236-69646258 CTCCCGGCTCTCAGACTGGGTGG + Intronic
1085466851 11:76729968-76729990 CTCCTGGCGCCCAGAAAGGGCGG + Intergenic
1087016531 11:93559681-93559703 GTCCAGGGAGTCAGAATGGCAGG + Intergenic
1087912609 11:103771126-103771148 TTTCTGGCACTCTGAATGGCTGG - Intergenic
1088618114 11:111653737-111653759 GTGCTGGCACTGAAAATGGATGG - Intronic
1089608257 11:119654506-119654528 TACCTGGCCCTCAGAATGGGAGG + Intronic
1090293905 11:125569616-125569638 TCCCTGCCACTCAGAATGGGCGG - Intronic
1094117637 12:26934827-26934849 GTTCTGTCACTCACAATGTGGGG + Intronic
1096573331 12:52537335-52537357 GGCCTGGCACTCAGGATGTCAGG + Intergenic
1097726531 12:63081417-63081439 GTCCTGGCACTGAGAAAGGTGGG + Intergenic
1101675469 12:106913111-106913133 GACCTGGGCCTCAGAAGGGGTGG + Intergenic
1101988599 12:109466668-109466690 GACCTGGCATCCAGCATGGGGGG - Intronic
1107832350 13:44385617-44385639 CAACTGGCACTCAGAATAGGAGG + Intronic
1110352698 13:74528196-74528218 GTCATGGCACAAAGAATGGAAGG - Intergenic
1113349991 13:109519705-109519727 GCCGTGGCAGTCACAATGGGTGG + Intergenic
1113967446 13:114162093-114162115 CTCCTGGCACCCGGAATAGGAGG + Intergenic
1114205158 14:20564026-20564048 GTCCTGGCACTAGGAATGTAAGG - Intergenic
1115690048 14:35833693-35833715 GTCCTGGCACTCATAATCAAGGG + Intronic
1119772097 14:77226466-77226488 TTCGTAGCATTCAGAATGGGAGG + Intronic
1121896955 14:97657555-97657577 GTCCTGGCACTCTCACTGGGTGG - Intergenic
1122228075 14:100291301-100291323 GCCCTGGCACTGAGAATGCCTGG + Exonic
1129971129 15:79778963-79778985 TTACTGGCACCCAGACTGGGGGG - Intergenic
1130675698 15:85950092-85950114 TTCCTAGCACTCAGAAAGGAGGG + Intergenic
1132703532 16:1231670-1231692 GTCCTGGGGCTCAGAAGCGGAGG - Intergenic
1132704979 16:1239691-1239713 GTCCTGGGGCTCAGAAGCGGAGG + Intergenic
1132987068 16:2772898-2772920 GTCCCAGCACTCGGAATGGCTGG + Intronic
1134087208 16:11365731-11365753 CTTCTGGCACTCAGCATGGTGGG + Intronic
1135728116 16:24872776-24872798 GTCCAGCTACTCAGATTGGGAGG - Intronic
1137706724 16:50540508-50540530 GTCCTGGCAGTGAGATTGAGTGG - Intergenic
1137721034 16:50627589-50627611 GCCCTGGCACTCAGAAGGCGTGG - Intronic
1139134821 16:64189749-64189771 GTCCTGGCTTTCAGATTAGGGGG + Intergenic
1140703245 16:77601979-77602001 GTGTTGGCACTCAGAGTGGCTGG + Intergenic
1143856828 17:9857536-9857558 GGCCTGACAATGAGAATGGGTGG + Exonic
1146277523 17:31524865-31524887 GGCCTGGCAGTCAGAAGGTGGGG - Intronic
1146279402 17:31535611-31535633 GTCCTGGCCTGCAGGATGGGAGG + Exonic
1146305674 17:31728258-31728280 ATACTGGCCATCAGAATGGGAGG - Intergenic
1148069662 17:44900860-44900882 ATCATGTCACTCAGATTGGGAGG - Intronic
1148894613 17:50832646-50832668 CTCCTGCTACTCAGAATGAGAGG - Intergenic
1149141267 17:53435936-53435958 GTGGTGGCAAGCAGAATGGGAGG - Intergenic
1151876742 17:76871160-76871182 GTCCTTGTCCTCAGACTGGGAGG + Intronic
1152366159 17:79857772-79857794 GACCTGGCCCTGAGAATGTGGGG + Intergenic
1155369086 18:25079112-25079134 GTTCTGGTCCTCAGAGTGGGTGG + Intronic
1159903977 18:74074261-74074283 GTCCTGGAAATGAGAGTGGGTGG - Intronic
1160789161 19:915192-915214 GCCCTGGAACCCAGAATGGGAGG - Intergenic
1161631162 19:5356475-5356497 CTCTTGGCACACAGAATGCGTGG - Intergenic
1164180156 19:22811266-22811288 GTCATGGTACTCAGAATATGTGG - Intergenic
1166704387 19:44900682-44900704 AGCCTGGCACTCAGGGTGGGTGG + Intronic
925316673 2:2931962-2931984 TTCCTGCTACTCAGCATGGGTGG + Intergenic
930008072 2:46914021-46914043 GTCCTGACTCTCAGAGAGGGAGG - Intronic
931625042 2:64249812-64249834 TTCCTGGCACTTAGAAGCGGTGG + Intergenic
933184218 2:79260786-79260808 GTGGTGGGACTCAGAATTGGAGG - Intronic
933741900 2:85539864-85539886 GTCCTGGCCCTCAGTTTGAGGGG + Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934151012 2:89147559-89147581 GTCCTGGCACTAGGAATGTAAGG - Intergenic
934216261 2:90034464-90034486 GTCCTGGCACTAGGAATGTAAGG + Intergenic
934850125 2:97693722-97693744 GTGCTGTCACTCAGAGTGGCAGG + Intergenic
941027260 2:160470745-160470767 GTACTCGCTCTCAGAGTGGGGGG + Intronic
941928337 2:170917350-170917372 GTGCTGGCACTTGGAATGGCTGG - Intergenic
942177303 2:173346343-173346365 ATCCTGGCACTCAGCCTGGGAGG - Intergenic
947070495 2:226282946-226282968 ATCCAGGCACTCAGAATGCAAGG - Intergenic
947810498 2:233001061-233001083 GAAGTGGCACTCAGGATGGGGGG - Intronic
948515829 2:238503429-238503451 GACTTGGCACTCAGGGTGGGAGG + Intergenic
1170205766 20:13796562-13796584 GTCCTGGAACTCAGCATAAGGGG + Intronic
1172827736 20:37804755-37804777 GTCATGGCACTGAGAAGAGGAGG + Intronic
1173363570 20:42365949-42365971 CTCCTGGCACTCAGTGTGGAAGG - Intronic
1174032356 20:47640033-47640055 CTCATGGCACTCAAAATAGGTGG + Exonic
1179287702 21:39992336-39992358 GTTCTGGATCTCAGAATAGGTGG - Intergenic
1181649897 22:24253005-24253027 GTCCTGGGAATCAGAAGAGGTGG - Intergenic
1181707481 22:24657741-24657763 GTCCTGGGAATCAGAAGAGGTGG + Intergenic
1182090536 22:27591592-27591614 GTCCTGAGCCTCAGAGTGGGAGG + Intergenic
1183255859 22:36761722-36761744 GTTCTGCCACTCACCATGGGAGG + Intronic
1183549238 22:38471546-38471568 GTCCTGCCACTCTGCATGAGGGG + Intronic
1183966290 22:41444888-41444910 GCCCTGGAATTCAGATTGGGTGG - Intronic
1184216108 22:43068373-43068395 GACCTGGCACACAAAGTGGGTGG + Intronic
1185341361 22:50292740-50292762 GTGCGGGCAATCAGAACGGGGGG - Intronic
950497045 3:13340089-13340111 GCCCTGGCTCTCTGAGTGGGAGG - Intronic
950979696 3:17289166-17289188 GTGCTGGCACTCAGAACAGCTGG + Intronic
953389546 3:42526409-42526431 GTCCTGGGACTGAGAATGACAGG - Intronic
954257517 3:49416903-49416925 GCCCTGGAACTCAGAATAGGTGG + Exonic
954692315 3:52402154-52402176 GTCCAGGCCCTGGGAATGGGAGG - Exonic
958914538 3:100034229-100034251 ATCCAGGAACTCAGAATGGGGGG + Intronic
960004633 3:112769445-112769467 TCCCTTGCTCTCAGAATGGGGGG + Intronic
961450295 3:126999531-126999553 GTCCTGGCACATAGCCTGGGTGG + Intronic
961646399 3:128394985-128395007 GTCCTGGCACACAGAGTGCTCGG - Intronic
961871495 3:129991869-129991891 TTCCTGGCAGGCAGAATGGTGGG - Intergenic
963018575 3:140849548-140849570 GTCCTGGGGCTCAGAAGGGTTGG - Intergenic
964967074 3:162508420-162508442 GTCCTGGCAATCAAAAGGGTTGG + Intergenic
967980249 3:195061211-195061233 GTCCTGGCACTGGGCATGGGCGG - Intergenic
968532170 4:1098153-1098175 GTCCTGAACCACAGAATGGGAGG - Intronic
968697632 4:2040850-2040872 GTCCTGACCCTAAGAGTGGGTGG - Intronic
975811677 4:78176349-78176371 GTCCTCATACTCACAATGGGAGG - Intronic
981848288 4:149195462-149195484 GTCCTGGGCCCTAGAATGGGGGG - Intergenic
982198703 4:152938845-152938867 GTCCTGGTGCTCAGAATGAGTGG - Intronic
982198708 4:152938881-152938903 GTCCTGGTGCTCAGAATGAGTGG - Intronic
982198713 4:152938917-152938939 GTCCTGGTGCTCAGAATGAGTGG - Intronic
984356231 4:178662671-178662693 GTACTGGCAATGAGAATGAGTGG - Intergenic
990165846 5:52992365-52992387 GATCTGGAACTCAGAAGGGGAGG - Intronic
992672113 5:79070590-79070612 GCCCTGTCATTCAGAATGGGAGG + Intronic
993296550 5:86148279-86148301 GTTCTGGCAATAAGAGTGGGAGG + Intergenic
997612072 5:135222323-135222345 GTGCTGGCACTCAGGGTGTGTGG + Intronic
997631230 5:135370203-135370225 TTCCTGGCACTGTGAATGTGGGG - Intronic
1001638980 5:173232227-173232249 GCCCTGGCTCGCGGAATGGGCGG + Exonic
1005708701 6:28482579-28482601 TTCCAGGCACCCAGAGTGGGAGG + Intergenic
1006178753 6:32140656-32140678 GTCCTGGCACTAGGAATGTAAGG + Intergenic
1017156314 6:151325565-151325587 GTCCTGGAGCTCAGCAAGGGAGG + Intronic
1017996053 6:159532432-159532454 GTCCTGGCAGTCAGAGAGAGGGG + Intergenic
1019275630 7:174035-174057 GTGCAGCCCCTCAGAATGGGGGG + Intergenic
1022130959 7:27403986-27404008 ATCATGGCAGACAGAATGGGAGG + Intergenic
1023733515 7:43214935-43214957 GTCCTGGGACGCTGACTGGGAGG - Intronic
1024007639 7:45238975-45238997 GTCCTGGCACGAGGAATGGAAGG - Intergenic
1024339435 7:48242364-48242386 TTCCTGGCACTGAGAATGTGTGG - Intronic
1026874065 7:73869741-73869763 ATCCTGGCGCCCAGGATGGGGGG + Intergenic
1030468506 7:109933508-109933530 TTCCTGGCACTTAGTGTGGGAGG + Intergenic
1034952426 7:155308281-155308303 TTCCTTGCTCTCAGAATCGGTGG - Exonic
1035160132 7:156944134-156944156 CGCCTGGCCCTCTGAATGGGGGG + Intergenic
1035453656 7:158995798-158995820 CTCCTGGGACTGAGGATGGGAGG - Intergenic
1036641515 8:10587126-10587148 GTCTTTGCAAACAGAATGGGAGG - Intergenic
1038452783 8:27650611-27650633 GTCCTAGTAGTCAGAATGTGTGG + Intronic
1040609328 8:48967065-48967087 GTCATGGCACGCAGACTGAGAGG - Intergenic
1046599553 8:116300368-116300390 GTCATGCCAGTCAGAATGGCAGG + Intergenic
1047448823 8:124944106-124944128 GTCCTGGGAAGCAAAATGGGAGG - Intergenic
1049316566 8:141972238-141972260 GTCCCAGCACTGATAATGGGCGG + Intergenic
1053418856 9:37964185-37964207 GTGCTGCCACTCATGATGGGAGG + Intronic
1055900040 9:81223737-81223759 ATCCTGGCAATTAGAATGGTTGG - Intergenic
1059406042 9:114098714-114098736 GGGCGGGCACTCAGAAGGGGCGG + Intronic
1059714126 9:116897346-116897368 TTACTGGCACTCAGTCTGGGAGG - Intronic
1059751297 9:117249960-117249982 GAACTAGCACTCAGAGTGGGCGG - Intronic
1060854263 9:126902362-126902384 GTCCTGGCACTAGGAATGGAAGG + Intergenic
1061163986 9:128911866-128911888 GGCCTCCCACTCAGAATGAGGGG - Intronic
1062376420 9:136263887-136263909 GCCCTGGCCCTCACACTGGGAGG + Intergenic
1062610352 9:137370681-137370703 TTCCTGCCCCTTAGAATGGGGGG - Intronic
1188074742 X:25761286-25761308 GTCCTGACACTCAGTATTGTAGG - Intergenic
1190247018 X:48697201-48697223 GTCCCCGCACTCTGAAGGGGGGG - Intronic
1192539536 X:71956500-71956522 GTCCTGTCACTCAGACTGACAGG - Intergenic
1195481033 X:105345464-105345486 GTCCTGGGTCTCAGAAGGGCAGG - Intronic
1196187427 X:112759628-112759650 ATCATGCCACTCAGAATGGCAGG - Intergenic
1200954476 Y:8930150-8930172 GACCTGGCACTCTGCATTGGTGG + Intergenic