ID: 900596439

View in Genome Browser
Species Human (GRCh38)
Location 1:3482194-3482216
Sequence GCTTTTCCTGGAGCTCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900596432_900596439 0 Left 900596432 1:3482171-3482193 CCTGTGAACTGGTTACTCCCTGG No data
Right 900596439 1:3482194-3482216 GCTTTTCCTGGAGCTCCTGTGGG No data
900596427_900596439 18 Left 900596427 1:3482153-3482175 CCAGCCTCCGCTGTCCTGCCTGT No data
Right 900596439 1:3482194-3482216 GCTTTTCCTGGAGCTCCTGTGGG No data
900596429_900596439 11 Left 900596429 1:3482160-3482182 CCGCTGTCCTGCCTGTGAACTGG No data
Right 900596439 1:3482194-3482216 GCTTTTCCTGGAGCTCCTGTGGG No data
900596431_900596439 4 Left 900596431 1:3482167-3482189 CCTGCCTGTGAACTGGTTACTCC No data
Right 900596439 1:3482194-3482216 GCTTTTCCTGGAGCTCCTGTGGG No data
900596428_900596439 14 Left 900596428 1:3482157-3482179 CCTCCGCTGTCCTGCCTGTGAAC No data
Right 900596439 1:3482194-3482216 GCTTTTCCTGGAGCTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900596439 Original CRISPR GCTTTTCCTGGAGCTCCTGT GGG Intergenic