ID: 900599502

View in Genome Browser
Species Human (GRCh38)
Location 1:3497031-3497053
Sequence GGTCCCGGTGGCAGGGTGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900599494_900599502 3 Left 900599494 1:3497005-3497027 CCGTGGTAGCCAGCAGCACATGA 0: 1
1: 0
2: 1
3: 6
4: 153
Right 900599502 1:3497031-3497053 GGTCCCGGTGGCAGGGTGGCAGG 0: 1
1: 0
2: 3
3: 20
4: 326
900599496_900599502 -6 Left 900599496 1:3497014-3497036 CCAGCAGCACATGAGCAGGTCCC 0: 1
1: 0
2: 1
3: 17
4: 200
Right 900599502 1:3497031-3497053 GGTCCCGGTGGCAGGGTGGCAGG 0: 1
1: 0
2: 3
3: 20
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900599502 Original CRISPR GGTCCCGGTGGCAGGGTGGC AGG Exonic