ID: 900599520

View in Genome Browser
Species Human (GRCh38)
Location 1:3497098-3497120
Sequence GCCTGCCCACCCGGCAGCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900599520_900599532 28 Left 900599520 1:3497098-3497120 CCAAAGCTGCCGGGTGGGCAGGC 0: 1
1: 0
2: 2
3: 21
4: 177
Right 900599532 1:3497149-3497171 GCCCAGCCCCGCCAAGGAACAGG 0: 1
1: 0
2: 3
3: 19
4: 207
900599520_900599525 -9 Left 900599520 1:3497098-3497120 CCAAAGCTGCCGGGTGGGCAGGC 0: 1
1: 0
2: 2
3: 21
4: 177
Right 900599525 1:3497112-3497134 TGGGCAGGCTGGGTGGAGACAGG 0: 1
1: 0
2: 4
3: 72
4: 686
900599520_900599528 0 Left 900599520 1:3497098-3497120 CCAAAGCTGCCGGGTGGGCAGGC 0: 1
1: 0
2: 2
3: 21
4: 177
Right 900599528 1:3497121-3497143 TGGGTGGAGACAGGCAGGGTCGG 0: 1
1: 0
2: 9
3: 99
4: 717
900599520_900599526 -5 Left 900599520 1:3497098-3497120 CCAAAGCTGCCGGGTGGGCAGGC 0: 1
1: 0
2: 2
3: 21
4: 177
Right 900599526 1:3497116-3497138 CAGGCTGGGTGGAGACAGGCAGG 0: 1
1: 0
2: 14
3: 94
4: 668
900599520_900599527 -4 Left 900599520 1:3497098-3497120 CCAAAGCTGCCGGGTGGGCAGGC 0: 1
1: 0
2: 2
3: 21
4: 177
Right 900599527 1:3497117-3497139 AGGCTGGGTGGAGACAGGCAGGG 0: 1
1: 0
2: 11
3: 93
4: 751
900599520_900599529 6 Left 900599520 1:3497098-3497120 CCAAAGCTGCCGGGTGGGCAGGC 0: 1
1: 0
2: 2
3: 21
4: 177
Right 900599529 1:3497127-3497149 GAGACAGGCAGGGTCGGTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 218
900599520_900599530 22 Left 900599520 1:3497098-3497120 CCAAAGCTGCCGGGTGGGCAGGC 0: 1
1: 0
2: 2
3: 21
4: 177
Right 900599530 1:3497143-3497165 GTCCTGGCCCAGCCCCGCCAAGG 0: 1
1: 0
2: 2
3: 55
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900599520 Original CRISPR GCCTGCCCACCCGGCAGCTT TGG (reversed) Exonic