ID: 900600783

View in Genome Browser
Species Human (GRCh38)
Location 1:3501854-3501876
Sequence GTGGCAGGGGGCCCCCCCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 196}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900600767_900600783 13 Left 900600767 1:3501818-3501840 CCTCCCCGGCGGACACCGGCACT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG 0: 1
1: 0
2: 2
3: 27
4: 196
900600765_900600783 18 Left 900600765 1:3501813-3501835 CCAGTCCTCCCCGGCGGACACCG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG 0: 1
1: 0
2: 2
3: 27
4: 196
900600768_900600783 10 Left 900600768 1:3501821-3501843 CCCCGGCGGACACCGGCACTGCC 0: 1
1: 0
2: 0
3: 8
4: 122
Right 900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG 0: 1
1: 0
2: 2
3: 27
4: 196
900600771_900600783 -2 Left 900600771 1:3501833-3501855 CCGGCACTGCCCCGTGACCCCGT 0: 1
1: 0
2: 1
3: 5
4: 158
Right 900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG 0: 1
1: 0
2: 2
3: 27
4: 196
900600769_900600783 9 Left 900600769 1:3501822-3501844 CCCGGCGGACACCGGCACTGCCC 0: 1
1: 0
2: 1
3: 9
4: 135
Right 900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG 0: 1
1: 0
2: 2
3: 27
4: 196
900600764_900600783 19 Left 900600764 1:3501812-3501834 CCCAGTCCTCCCCGGCGGACACC 0: 1
1: 0
2: 1
3: 3
4: 102
Right 900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG 0: 1
1: 0
2: 2
3: 27
4: 196
900600763_900600783 20 Left 900600763 1:3501811-3501833 CCCCAGTCCTCCCCGGCGGACAC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG 0: 1
1: 0
2: 2
3: 27
4: 196
900600770_900600783 8 Left 900600770 1:3501823-3501845 CCGGCGGACACCGGCACTGCCCC 0: 1
1: 0
2: 1
3: 11
4: 150
Right 900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG 0: 1
1: 0
2: 2
3: 27
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900600783 Original CRISPR GTGGCAGGGGGCCCCCCCAC AGG Exonic
900185424 1:1331050-1331072 GTGGCAAGGGGCTCAGCCACAGG + Intergenic
900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG + Exonic
901633850 1:10660582-10660604 GGGACAGGAGGTCCCCCCACTGG + Intronic
904738272 1:32651522-32651544 CTGGCCGGGGGCCCCACCGCTGG - Intronic
905103353 1:35545085-35545107 CTGGCAGGGGACCCTCCCACTGG - Intronic
907308208 1:53525297-53525319 GGGGAAGGGGGCACCCACACAGG + Intronic
907387919 1:54137943-54137965 GCTGCAGGAGGCCTCCCCACTGG - Intronic
908310159 1:62873262-62873284 GGGGCAGGGGCCATCCCCACGGG + Intergenic
911078922 1:93909214-93909236 CAGGCAGGCGGCCGCCCCACAGG + Exonic
911912598 1:103654483-103654505 GGAGAAGGGGGCCTCCCCACTGG + Intergenic
911915856 1:103697465-103697487 GGAGAAGGGGGCCTCCCCACTGG - Intronic
911920010 1:103748621-103748643 GGAGAAGGGGGCCTCCCCACTGG + Intronic
912467789 1:109886009-109886031 GTGGCAGGGGGCTTCTTCACTGG - Intergenic
912797304 1:112700897-112700919 GTGGCAGGGAAGCCACCCACAGG + Intergenic
913088899 1:115462947-115462969 GGGGCAGGCAGCCCCTCCACTGG - Intergenic
917929543 1:179813945-179813967 GTGGCTCGCGGCCACCCCACAGG - Exonic
917930675 1:179820639-179820661 GAGGCAGCAGGGCCCCCCACAGG + Intergenic
917931088 1:179823399-179823421 GAGGCAGCAGGGCCCCCCACAGG + Intergenic
918062091 1:181070752-181070774 GTGGCAAGGTGCCCAGCCACAGG + Intergenic
919138681 1:193542770-193542792 GTGTCATGGGGTCCCTCCACAGG + Intergenic
924674009 1:246157168-246157190 GAGGCAGGGGGCGCCCCGAAGGG - Intronic
1067081848 10:43216656-43216678 GTGGCAGTGGGCCACGTCACAGG + Intronic
1069921408 10:71817962-71817984 GGGGCAGGGGGCCCCCATTCTGG - Intronic
1069927098 10:71858337-71858359 GTGACAGGGTGCCACTCCACAGG + Intergenic
1069944846 10:71978771-71978793 GAGGCAGGGCGCCTCCCCTCTGG - Intronic
1070672659 10:78388839-78388861 CTAGCTCGGGGCCCCCCCACTGG - Intergenic
1071468394 10:85961414-85961436 GTGGCGGGAGGCCTCCTCACTGG - Intronic
1074827153 10:117222897-117222919 GTGGCAGAGGGCTGGCCCACTGG - Intergenic
1075589116 10:123678672-123678694 GTGGCTGGGCGCCCCCCTCCAGG + Intronic
1076243538 10:128928340-128928362 GGGGCCGGGGGCCCCATCACCGG + Intergenic
1076698146 10:132256925-132256947 GTGGCCAGCGTCCCCCCCACTGG - Intronic
1076707179 10:132308258-132308280 GAGGCAGGGAGCGTCCCCACGGG + Intronic
1077235603 11:1480691-1480713 GAGGGAGGGGGCCCGCCCCCAGG + Intronic
1077322419 11:1948203-1948225 GTGGCAGGTGGGACCCCCAGTGG + Intronic
1077327284 11:1969283-1969305 GGGGCAGGAGGCCCCCCAAGCGG - Intronic
1079135581 11:17774503-17774525 GGGGCAGGGGGACTCCGCACAGG - Intronic
1081705430 11:45180201-45180223 GAGGCAGGGGGCCATCCCACAGG + Intronic
1081802412 11:45869249-45869271 GTGGGAAGGGGCCTCACCACAGG - Intronic
1082772840 11:57221902-57221924 GTGGAAGCGGGCCCACCCAAGGG - Intergenic
1083443446 11:62691619-62691641 GTGGCATATGGCCCTCCCACAGG - Intronic
1083554272 11:63613774-63613796 CAGGCAGGGCGCCCCCACACCGG + Intronic
1084220699 11:67675772-67675794 GAGGCAGTGGGCCTCCCCAGTGG - Intronic
1084659260 11:70537528-70537550 GTGGCAGGAGGCCTCCTCCCCGG + Intronic
1085181596 11:74541282-74541304 CTCGCAGGGGGCCCCCCCATGGG + Intronic
1089323970 11:117644705-117644727 AGGGCAGGGGACCCCCCCTCTGG + Intronic
1089566909 11:119376440-119376462 GCAGCAGGGGCCCCCCGCACTGG - Intronic
1090334220 11:125951890-125951912 GTGGCAGGGGGCTCGCCGCCAGG - Intergenic
1090397930 11:126431601-126431623 GTGGCAGGGGCTGCCCCCGCAGG - Intronic
1202805437 11_KI270721v1_random:3516-3538 GTGGCAGGTGGGACCCCCAGTGG + Intergenic
1202810266 11_KI270721v1_random:24463-24485 GGGGCAGGAGGCCCCCCAAGCGG - Intergenic
1091702661 12:2674248-2674270 CAGCCAGGGGGCCCCTCCACCGG - Intronic
1092860602 12:12716833-12716855 GGGGCTGGGCGCCCCCCCGCCGG - Intronic
1093994399 12:25625844-25625866 GTGGCAGGAGGCCACCACAGTGG - Intronic
1094844191 12:34354269-34354291 GTGGCAGAGGTCCCCCCCATGGG - Intergenic
1094844242 12:34354457-34354479 GCGGCAGAGGTCCCCTCCACGGG - Intergenic
1094845835 12:34361008-34361030 GAGGCAGCGGTCCCCTCCACAGG - Intergenic
1094846022 12:34361757-34361779 GAGGCAGAGGCCCCCCCCACGGG - Intergenic
1094847492 12:34367723-34367745 GAGGCAGGGGTCCCCCCGACGGG - Intergenic
1094847727 12:34368663-34368685 AAGGCAGAGGTCCCCCCCACTGG - Intergenic
1094848995 12:34373922-34373944 GAGGCAGAGGTCCCCCGCACGGG - Intergenic
1094850169 12:34378789-34378811 ATGGCAGAGGTCCCCCCCATGGG - Intergenic
1094850865 12:34381780-34381802 GTGGCAGAGGTCCCCCCCAAGGG - Intergenic
1094851289 12:34383432-34383454 GAAGCAGAGGTCCCCCCCACGGG - Intergenic
1094851517 12:34384371-34384393 GAGGCAGAGGTCCCCCTCACGGG - Intergenic
1094852566 12:34388811-34388833 GAGGCAGAGGTCCCCCCCACGGG - Intergenic
1094852697 12:34389361-34389383 ATGGCAGAGGTCCCCCCCAACGG + Intergenic
1094853574 12:34393093-34393115 GCGGCAGAGGTCCCCCCCACGGG + Intergenic
1094853802 12:34394030-34394052 GAGGCAGAAGTCCCCCCCACGGG + Intergenic
1094855190 12:34399762-34399784 GAGGCAGAGGTCCCCCCAACGGG + Intergenic
1094870973 12:34599172-34599194 GTGGCAGAGTTCCCCCCCAGGGG + Intergenic
1096633632 12:52945216-52945238 CATGCAGGGGGCCCTCCCACAGG - Intronic
1102530016 12:113539391-113539413 CTGGGAGAGGGCCTCCCCACAGG - Intergenic
1102926967 12:116833716-116833738 GGGGCGGGGGGCCCCCCAGCTGG + Intronic
1103362361 12:120361719-120361741 GCGGCGGGGGGCCCCCCGCCCGG - Intronic
1103547219 12:121710904-121710926 GTGGCGGGGGGCTCCTTCACTGG - Intergenic
1103561373 12:121794769-121794791 GTGGCAGAGGGACCCCCCCCTGG + Intronic
1103896874 12:124278838-124278860 GTGGCAGGGGGCCCCGTGGCAGG - Intronic
1104421027 12:128635596-128635618 GTGGCAGGTGGCCCCTCAAAGGG - Intronic
1105296222 13:19089865-19089887 GTGGCAGGGCACCCTCCCAGTGG + Intergenic
1106033200 13:26020884-26020906 CTGACATGGGGCCACCCCACAGG + Exonic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107712105 13:43160384-43160406 GTGGCTGGGGGCACACACACAGG + Intergenic
1107996407 13:45865401-45865423 GAGGCAGGGAGCCCACCCTCTGG + Intergenic
1108354798 13:49620478-49620500 GTGGCAGGAGGCCCACACCCAGG + Intergenic
1117516489 14:56507184-56507206 TTGCCATGTGGCCCCCCCACAGG + Intronic
1118688647 14:68316530-68316552 GTGGAAGAGGGCCCACCCACAGG - Intronic
1119165506 14:72489146-72489168 GACAAAGGGGGCCCCCCCACCGG + Intronic
1123412550 15:20072648-20072670 GTGGCCTGAGGCTCCCCCACAGG + Intergenic
1123521892 15:21079761-21079783 GTGGCCTGAGGCTCCCCCACAGG + Intergenic
1126466190 15:48963352-48963374 GATGCAGCGGGCCCCCCGACCGG - Exonic
1126583577 15:50262423-50262445 ATGGCAGGGAGCCCCGCCACAGG + Intronic
1128145982 15:65332781-65332803 GCGGCAGGGCCCCGCCCCACGGG + Intronic
1128329261 15:66745122-66745144 GTGGCTGGTGGCACCCCCAGGGG + Intronic
1132464462 16:71365-71387 GTGGCAGGGGGCTCCGCCTCAGG + Intronic
1136672777 16:31873391-31873413 GTGGGAGGGGGCCCCTCAGCTGG - Intergenic
1139592299 16:67940062-67940084 GTGGCTGGCGGCCCTGCCACAGG + Exonic
1139900308 16:70322963-70322985 GTGGCCGGGGGCCCTCCCCATGG + Intronic
1140093371 16:71854953-71854975 TTGGCTGGGGGCCCTCCCTCAGG - Exonic
1142155934 16:88532945-88532967 GGGGCAGGGGTGGCCCCCACAGG - Intronic
1142848566 17:2693663-2693685 ATGGCAGGGGACCCCCCCACAGG - Intronic
1143682872 17:8490662-8490684 GTGGCAGGGGGCCGGCCCAGGGG - Intronic
1144340769 17:14309152-14309174 GTGGCCGGGGGCGCTACCACGGG + Intronic
1144675559 17:17159242-17159264 ATGGCAGGGGCCCCCACCATCGG - Intronic
1145235919 17:21208391-21208413 GTGGAAGGAGGCCCTCCCACGGG - Intronic
1147637127 17:41970957-41970979 GTACCAGGAGGCCCCCCCATAGG + Intronic
1147726105 17:42567076-42567098 GCCGCAGGGGGCCCGCCCGCTGG + Exonic
1152339391 17:79715985-79716007 CAGGCAGGGGACCCCCCCACCGG + Intergenic
1152428951 17:80236814-80236836 GAGGCAGGAGACGCCCCCACCGG - Intronic
1152558944 17:81068330-81068352 ATGGCAGGGGTCTCCCCCTCGGG + Intronic
1152573400 17:81130181-81130203 CTGGCAGGGGCCCCTCCCACTGG + Intronic
1152720345 17:81920629-81920651 GAGGCAGGCTGCGCCCCCACAGG + Exonic
1155270745 18:24139243-24139265 GTGGGCCGGGGCCGCCCCACAGG - Intronic
1158954154 18:62523580-62523602 GCGGCAGAGGGCCCCGCGACGGG - Exonic
1160050146 18:75425894-75425916 GAGGCAGGGGCCCCCACCTCAGG - Intronic
1160364261 18:78311000-78311022 GTGGATGGGGGCCCCACCCCAGG + Intergenic
1160902372 19:1434826-1434848 GGGTCGGGGGGCCCCCCCGCCGG + Exonic
1161374584 19:3933032-3933054 GTGACCGGGGGCCCAGCCACAGG - Intergenic
1161828582 19:6586358-6586380 CTGGCAGGGGGGCCCAGCACTGG - Exonic
1161888872 19:7019309-7019331 GTGGCAGGGGGGCCAACCCCAGG - Intergenic
1161890496 19:7032712-7032734 GTGGCAGGGGGGCCAACCCCAGG + Exonic
1161890952 19:7038021-7038043 GTGGCAGGGGGGCCAACCCCAGG - Exonic
1161892582 19:7051440-7051462 GTGGCAGGGGGGCCAACCCCAGG + Exonic
1161893035 19:7056482-7056504 GTGGCAGGGGGGCCAACCCCAGG - Exonic
1162331501 19:10032636-10032658 GGGGCAGGGGGACCGGCCACGGG + Intergenic
1162880423 19:13654737-13654759 GTGGAACGGGGCCGCCCCATAGG + Intergenic
1166585965 19:43949260-43949282 GGGGCAGGGGGGCCCCCCACTGG + Intergenic
1167040733 19:47021190-47021212 CTGGCCGCGGGCCCCCCCCCGGG + Intronic
1167485977 19:49763177-49763199 GAGGCCGGGGACACCCCCACGGG - Exonic
924958493 2:11775-11797 GTGGCAGCTGGCTCCCCCGCTGG + Intergenic
925072551 2:982683-982705 GTGACAGGGGCCCTGCCCACGGG - Intronic
926222818 2:10947508-10947530 GTGGCAGGGGGACCCCTGGCTGG + Intergenic
927519621 2:23690950-23690972 GTGGCAGGAGGGCCCGCCCCGGG + Intronic
930025663 2:47027801-47027823 GGGGCAGCGGGCCACCTCACAGG + Intronic
932595433 2:73090289-73090311 GTGGCTGGGGCCCGCCCTACTGG + Intronic
933658240 2:84906212-84906234 GTGGCCGGGGCCGCCCACACCGG - Intronic
935715054 2:105932231-105932253 GTGGCAGATGTCCCCCCCAGTGG + Intergenic
937125845 2:119474557-119474579 GTGGCAGGGCTCCTACCCACAGG - Intronic
941772886 2:169362642-169362664 GCGGCAGGGGGCCTGCCCGCTGG - Exonic
942448268 2:176092639-176092661 GCGGGAGGCGGCCCCCCGACCGG + Intergenic
948423266 2:237873404-237873426 GGGGCAGCCGGGCCCCCCACAGG - Intronic
948454104 2:238096837-238096859 GTGGCACGCGGCCCCCACACTGG - Exonic
948493952 2:238333251-238333273 GTTGGAGGGGTCCCTCCCACTGG - Intronic
948613805 2:239185439-239185461 GAGGCACGGGACACCCCCACAGG - Intronic
1168802664 20:653258-653280 CTGGCACGGGCCCCCCCCCCCGG - Exonic
1169418047 20:5434135-5434157 GGGGCAGGGGGTCCTCCCTCCGG + Intergenic
1169897799 20:10522844-10522866 GAGGAAGGGGGTCCCACCACAGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170756665 20:19212042-19212064 GGCGCAGGGGGCCCCCTCTCGGG - Intergenic
1171385699 20:24768143-24768165 GTGGCAGGAGGAGTCCCCACAGG - Intergenic
1172389842 20:34559124-34559146 GTGGCCGGGGGCCGCCCCTCCGG + Intronic
1172446545 20:34996417-34996439 GTTGCAGGAGGCCCACCAACAGG + Exonic
1175918417 20:62438400-62438422 GGGTCAGGGGACCCCCACACCGG + Intergenic
1175992303 20:62795702-62795724 GGGGCAGGGGGTCCCCACGCGGG + Intergenic
1176097360 20:63350227-63350249 GTGGCAGGGGGCTCCCCTTCTGG + Exonic
1176164037 20:63663600-63663622 GTGGCAGGGTGCACCCCCGTTGG + Intronic
1179681606 21:43025417-43025439 GTGGCAGAGGGTCCCCTCATGGG - Intronic
1180007340 21:45028808-45028830 GAGGCAGGCGGCCCCTCCACAGG - Intergenic
1180066004 21:45412752-45412774 GTGCCACGTGGCCTCCCCACAGG - Intronic
1181430327 22:22877598-22877620 GTGGCAGGCGCGCCCCCTACAGG + Intronic
1181982869 22:26778487-26778509 TTGGCTGGGGGCCTCTCCACAGG - Intergenic
1182555382 22:31126008-31126030 TTGGGAGAGGGCCCCCTCACCGG - Exonic
1183398168 22:37585240-37585262 GGAGCAGGGGACCCCCCCTCAGG - Intergenic
1185074344 22:48675321-48675343 TTGGACGGGGGCCCCGCCACAGG - Intronic
1185179265 22:49349884-49349906 CTGGCAGGGGGCCCCATCGCTGG - Intergenic
1185338530 22:50281528-50281550 CTGGCGGGGGGTGCCCCCACGGG - Intronic
949420421 3:3859272-3859294 GTGGCAGTAGGGCCACCCACTGG - Intronic
954290731 3:49648663-49648685 CTGGCAGGGTGCACCCCCAGAGG - Intronic
954689784 3:52389580-52389602 GTGGCAGGTGCCCACCCCAGGGG + Exonic
955069073 3:55557228-55557250 GTGGCAGATGGCCCCCCCAGTGG + Intronic
956705480 3:71995448-71995470 GTGGCAGAGGGGCCCCACTCTGG + Intergenic
959704897 3:109330667-109330689 AGGGCAGGCGGCTCCCCCACAGG + Exonic
961222737 3:125212802-125212824 GTGGCAGGGGTGCCCCCGCCGGG - Intronic
961697439 3:128715336-128715358 GTGGCTGGGGGAACACCCACAGG - Intergenic
966748278 3:183298966-183298988 ATGGCAGGGGGCACCCACCCAGG - Intronic
966911472 3:184562447-184562469 GTCGGAGGAGGCCCCGCCACCGG + Intronic
967920137 3:194608349-194608371 CTGGCAGGGGCCCTCACCACTGG + Intronic
968007606 3:195254026-195254048 GCACCAGGGGGCACCCCCACTGG + Intronic
968128154 3:196175369-196175391 GTGGCAGGCAGCCCCCCTGCTGG + Intergenic
968422332 4:496316-496338 GTGCCAGGTGGCCACCACACGGG - Intronic
968801471 4:2745974-2745996 GCAGCTGGGGGCCCCCTCACTGG - Intronic
974047444 4:56908894-56908916 GCCGGAGGGGGCCCCCACACGGG - Intronic
978363276 4:107953819-107953841 CTGGCAGGGGGTCCCTCCACAGG - Intergenic
983079912 4:163372300-163372322 GTGCTAGGTGGCCACCCCACAGG - Intergenic
985475777 5:78284-78306 GAGGCAGGAGGCCCCTCCCCGGG + Intergenic
985678955 5:1246134-1246156 GTGGGCGGGGCCCCGCCCACAGG + Exonic
997593792 5:135092652-135092674 GAGGCAGGAGGCCCCCCCTTTGG - Intronic
1002051229 5:176572729-176572751 CTGGCATGGGGCCCCCCACCTGG - Intronic
1002898110 6:1390711-1390733 GTGGCTGGGGGCGCCCGCGCCGG - Exonic
1003138973 6:3456129-3456151 CTGGCAGGGGTCACCACCACAGG - Exonic
1006302547 6:33201253-33201275 GAGGCCTGGGGGCCCCCCACTGG + Exonic
1006428808 6:33982698-33982720 GTGGCAGGGGGCACTCTCCCAGG + Intergenic
1010070071 6:71733788-71733810 TTGGCAGGGGACCCCCTCACAGG - Intergenic
1011624730 6:89273598-89273620 GTGGGAGGAGGCCCCTCCTCAGG + Intronic
1017526438 6:155245232-155245254 GTGGCAGGAAGCCCCTCCAAGGG + Intronic
1019187340 6:170228422-170228444 GATGCAGGGGGCTCCCGCACTGG + Intergenic
1019595459 7:1856389-1856411 GAGGCAGGGGGCCCCCACAGAGG - Intronic
1022175107 7:27864915-27864937 GTGGCAATGGGCTCCCTCACAGG + Intronic
1023922410 7:44639746-44639768 GGGGCAGGGTGCTCCCCCAGTGG + Intronic
1035454134 7:158997914-158997936 GTGGAGGGGGCCCCCCACACTGG - Intergenic
1037829677 8:22180094-22180116 GTGGCACGGAGCCCCACCAAGGG + Intronic
1045429124 8:102096771-102096793 GTGGGAGTGGGCCCCAGCACAGG - Intronic
1048026996 8:130596264-130596286 ATGGCAGAGGGCCCCCGCAATGG - Intergenic
1048073039 8:131040971-131040993 GTGGCGGGGCGCCCCGCGACAGG + Exonic
1048985455 8:139732451-139732473 GTGGCAGGAGGCCCTCCCAGAGG - Intronic
1049228238 8:141467891-141467913 CTGGCAGGGAGACACCCCACAGG - Intergenic
1049349369 8:142155960-142155982 GTGGCTGTGGGCCCCTCCGCAGG - Intergenic
1049678180 8:143902785-143902807 GTTGCAGGAGGCCACCCCTCAGG - Intergenic
1049846918 8:144807295-144807317 GGTGCAGGGTGCCCCCCCACAGG - Exonic
1058830991 9:108816254-108816276 GTGGCGGGGGGGCGCCACACAGG - Intergenic
1059251426 9:112890639-112890661 GAGGCAGGTGGCCCCTCCGCGGG + Exonic
1060437135 9:123603615-123603637 GCAGCTGGGGGCCCCCCAACTGG + Intronic
1061214278 9:129211994-129212016 GTAGTAGGGCGCCCTCCCACCGG + Intergenic
1061580043 9:131530966-131530988 CTGGCAGGGGGCCCCTCGGCCGG + Intronic
1061587391 9:131577816-131577838 GTGGCAGGCGGGACCCCCTCTGG - Exonic
1061626905 9:131845950-131845972 GTGGGAGGGGGCCCCAGCCCCGG + Intergenic
1061925905 9:133805957-133805979 GAGGCAGGGGCCGCCCCCTCTGG - Intronic
1062126963 9:134869144-134869166 GTGGCAGGAAGCCCCGGCACGGG - Intergenic
1062327523 9:136019330-136019352 GTGGCAGGAGGCCCCTCGATGGG + Intronic
1062397949 9:136360067-136360089 GTGGTGGGTGGCACCCCCACGGG + Intronic
1062414970 9:136443860-136443882 GCTGCAGGGGGCCCTCCCAGCGG - Exonic
1062454125 9:136627779-136627801 GAGCCACGGGGCCACCCCACAGG + Intergenic
1062459396 9:136656602-136656624 GTGGTGGGGGGCCCCTCCCCTGG - Intergenic
1062465321 9:136678259-136678281 CTGGCAGGGGCCCAGCCCACTGG + Intronic
1062497723 9:136839522-136839544 GTGGCCAGGGTCCCTCCCACAGG + Intronic
1188309584 X:28599966-28599988 CTGGCGGGGGGCTGCCCCACAGG + Intronic
1190108366 X:47574297-47574319 GCGCCAGGCGGGCCCCCCACAGG - Exonic