ID: 900604107

View in Genome Browser
Species Human (GRCh38)
Location 1:3516220-3516242
Sequence CTGTGCCCTGAGCTGGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 275}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900604094_900604107 12 Left 900604094 1:3516185-3516207 CCCAGTGGGTGCCTGTACCCCGT 0: 1
1: 0
2: 0
3: 19
4: 95
Right 900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 275
900604102_900604107 -5 Left 900604102 1:3516202-3516224 CCCCGTGGATGGATGGGGCTGTG 0: 1
1: 0
2: 0
3: 10
4: 208
Right 900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 275
900604104_900604107 -7 Left 900604104 1:3516204-3516226 CCGTGGATGGATGGGGCTGTGCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 275
900604099_900604107 1 Left 900604099 1:3516196-3516218 CCTGTACCCCGTGGATGGATGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 275
900604103_900604107 -6 Left 900604103 1:3516203-3516225 CCCGTGGATGGATGGGGCTGTGC 0: 1
1: 0
2: 0
3: 25
4: 191
Right 900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 275
900604095_900604107 11 Left 900604095 1:3516186-3516208 CCAGTGGGTGCCTGTACCCCGTG 0: 1
1: 0
2: 2
3: 6
4: 128
Right 900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900604107 Original CRISPR CTGTGCCCTGAGCTGGCGCA GGG Intronic
900287526 1:1908795-1908817 CTGCGCCCCGAGGTGGAGCAGGG + Intergenic
900288622 1:1914415-1914437 CTTTCCCCTGGGCTGGGGCAGGG - Intergenic
900291712 1:1926506-1926528 CGGTGCCCTGAAATGGGGCAGGG + Exonic
900470897 1:2854446-2854468 CTGTGCCCTGCTCTGGTGGACGG + Intergenic
900525002 1:3124220-3124242 CTGGGCCCTGAGCTGGAGGCCGG + Intronic
900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG + Intronic
900746965 1:4367124-4367146 CTCTGCCCTGGGCTGGCGAGAGG + Intergenic
901066950 1:6498706-6498728 CTGTGCACTGAGGAGGCCCAGGG - Intronic
902379037 1:16044019-16044041 CTGTGGCCTGAGCTGGGGTCAGG + Intronic
902544926 1:17184241-17184263 CTCTGCTCTGGGCTGGCACAGGG + Intergenic
902631167 1:17705533-17705555 CTGGGCCATGAGCTGGGGCTGGG + Intergenic
902833062 1:19030002-19030024 CTGTGCCTGGAGTTGGCGAAGGG - Intergenic
902919114 1:19656160-19656182 GTGTCCCCAGAGCTGGCACAGGG + Intronic
905043093 1:34976514-34976536 CTGGGCACTGAGCTGCCGCCTGG - Intergenic
906868297 1:49447369-49447391 CTGTACCCAGAGCTGATGCAGGG - Intronic
912528959 1:110306361-110306383 CTGAGCCCAGAGCTGGCCCTAGG + Intergenic
913157459 1:116113963-116113985 CTGGGCCCTGAGCAGGCCAAGGG + Intronic
913202277 1:116504596-116504618 TAGGGCCCTGAGCTGGGGCAGGG - Intergenic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
914508433 1:148309355-148309377 CTGATCTCTGAACTGGCGCAAGG + Intergenic
915538461 1:156551993-156552015 CTGTGCATTGACCTGGCTCACGG + Exonic
919745854 1:201008820-201008842 CTGTGCCCGGCGCTTGCGCTCGG + Exonic
920038659 1:203082126-203082148 CTGAGCCCGGAGCTGGTGCAGGG + Intergenic
920378410 1:205521899-205521921 CTGTGCCTGGTGCTGGTGCATGG + Intronic
920438194 1:205961669-205961691 CTGGGCCCAGAGCTGGGGGATGG + Intergenic
922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG + Exonic
922795247 1:228336512-228336534 CTGTGCCCAGGGCCGGCCCAGGG - Intronic
1067158557 10:43803145-43803167 CTGTGCCCTCACATGGAGCAAGG + Intergenic
1067575208 10:47404415-47404437 CTGCTCCCTGAGCTGGGGGAAGG + Intergenic
1070829971 10:79412102-79412124 CTGTGCCCTGAACTGGGCCTGGG + Intronic
1071513565 10:86282472-86282494 CTGTTCCCTGAGATGGACCACGG - Intronic
1072661647 10:97367016-97367038 CTGTGCACTGAGCAGGGGCGGGG - Intronic
1072921257 10:99579034-99579056 CTGTGCTCTGGGCAGGAGCAGGG + Intergenic
1075670738 10:124262618-124262640 CTGTGCTCCGAGCTGCCTCATGG - Intergenic
1076115547 10:127894896-127894918 CTGAGTCCTGAGGTGGCACAGGG + Intergenic
1076430662 10:130399632-130399654 CTGTGCACTGAGCAGGCGAGGGG + Intergenic
1076714098 10:132354574-132354596 CTGTGCCCTGAGGTGGCACTGGG + Intronic
1077323979 11:1955659-1955681 CTGTGGCCTGGGCTGGGGCTTGG + Intronic
1078470327 11:11581166-11581188 CTGAGGCCTGAGGTGGGGCAGGG + Intronic
1079328548 11:19514845-19514867 CTGTGCTCTGGGCTGAAGCAGGG + Intronic
1080777284 11:35397746-35397768 CTGTGTCCTGACCTGGTGGAAGG - Intronic
1082004947 11:47414321-47414343 CTCTGCTCTGAGCTGGCTCTGGG - Intronic
1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG + Intronic
1084461263 11:69297913-69297935 CTGAGCCCAGAGCTTGGGCAGGG - Intronic
1086946965 11:92853246-92853268 CTGGTACCTGAGCTGGCGCCTGG - Intronic
1088498964 11:110463273-110463295 CTCTGTCCTGAGCTGGAGAAGGG + Exonic
1088722748 11:112608896-112608918 CTGTGCCCTGAGGGAGGGCATGG + Intergenic
1088804835 11:113342830-113342852 CACTGCCCTAAGCTGGTGCAGGG - Intronic
1089399634 11:118156963-118156985 CAGTGCTCTGAGCTGGAGGAAGG - Intergenic
1090080427 11:123608913-123608935 CTGGGCCCTGAGGTGGCCGAGGG - Intronic
1090254184 11:125271768-125271790 CTGGGCTATGAGCTGGAGCAAGG - Intronic
1090729511 11:129557823-129557845 CTGTGGCCTGAGCTTGAGCAGGG + Intergenic
1091267282 11:134281465-134281487 CTGTGCCCTGGTCAGGGGCAGGG + Intronic
1202806965 11_KI270721v1_random:10854-10876 CTGTGGCCTGGGCTGGGGCTTGG + Intergenic
1092087233 12:5773132-5773154 CTGTAGCCGGAGCTGGTGCATGG - Intronic
1092162238 12:6322070-6322092 CTGTGCCCAGTGCTGGCCCCAGG - Intronic
1094492672 12:30970737-30970759 CTGAGCCCTGGGCTGGGGCCAGG + Intronic
1094493052 12:30973118-30973140 CTGTGCTCTGACCTGCTGCATGG - Intronic
1096215638 12:49796307-49796329 CTGTCCCCAGAGGGGGCGCAAGG - Exonic
1098302639 12:69069649-69069671 GTGTGGGCTGAGCTGGGGCAGGG + Intergenic
1101325433 12:103711525-103711547 CTGTCCCCAGAGGTGGCCCAGGG - Intronic
1101838754 12:108312957-108312979 CAGAGCCCTGAGCTGCCCCAGGG + Intronic
1103359965 12:120347677-120347699 CTGTGTCCTGACCTGTGGCATGG + Intronic
1103792170 12:123479511-123479533 ATCTTCCCTGGGCTGGCGCAGGG - Intronic
1104628301 12:130377740-130377762 CTGTGGCCTCAGCTGTGGCAGGG + Intergenic
1104721928 12:131049224-131049246 CTGAGCCCAGGGCTGGCACAAGG + Intronic
1105313746 13:19237211-19237233 CTGTGGCCTGAGCTCAAGCACGG - Intergenic
1110196989 13:72800977-72800999 CTCTTCCCTGAGCTGTCTCAAGG - Intronic
1111008091 13:82276090-82276112 CTGTGCCCTGAGCTCGGGCAGGG + Intergenic
1111020130 13:82438260-82438282 CAGTGCCCTGAGGTTGGGCAGGG - Intergenic
1112452244 13:99523200-99523222 CTGTGGCCTGGGCTGGGCCACGG + Intronic
1112462982 13:99619279-99619301 CTGTGTCCTCACATGGCGCAGGG - Intronic
1113461470 13:110485165-110485187 GTGTGTCCATAGCTGGCGCAGGG + Intronic
1113533645 13:111047065-111047087 CTGAGCCCTGTGCTGCCACAAGG - Intergenic
1113696000 13:112345999-112346021 CTGTGCTCTGGGCGGGCGCCCGG + Intergenic
1115133653 14:30083666-30083688 CTGGGCCATGACCTGGCACAGGG + Intronic
1116204005 14:41837431-41837453 CTCTGTCCTGAGATGGTGCATGG + Intronic
1118506028 14:66412926-66412948 ATGTGCCTTGAGCTGTTGCAGGG - Intergenic
1118878451 14:69805023-69805045 CTGTGCCCTTAGATGGTGGAGGG - Intergenic
1119392845 14:74302874-74302896 CCGCGCCCGGAGCTGGCGCCAGG - Exonic
1119660475 14:76447811-76447833 CGGTGGCCTGAGCTGAAGCAGGG - Intronic
1120461531 14:84803575-84803597 TTGTGCCCTGAGCTGCTGGATGG - Intergenic
1122598167 14:102907746-102907768 CTGTGCCCTGAGCTCCCGTGAGG + Exonic
1122688424 14:103520795-103520817 CTGTGGCCTGAGGTGGGGCGGGG + Intronic
1122977312 14:105176148-105176170 CTGTGTCCTGGGCTGGAGAAGGG - Intronic
1125654101 15:41341675-41341697 CTGTGGCCTGAACTGGAGCGGGG - Intronic
1125854764 15:42938314-42938336 CTGTGCCCTGAGCTGCAGCCAGG - Intergenic
1126143378 15:45455239-45455261 CTGTGCCCTGGGTGGGCTCAAGG + Intergenic
1129295132 15:74596058-74596080 CTGTGCCCTGAGCTGGGAGGTGG - Exonic
1129297855 15:74609637-74609659 CTGTGTCCTGAGCCTGGGCAGGG + Intronic
1129597056 15:76973562-76973584 CTGGGCTCTGAGCTGTCGCCTGG - Intergenic
1129607090 15:77030286-77030308 CTGTGCTCTGAGCTGCCTGAGGG - Intronic
1129715354 15:77845284-77845306 CAGTGTCCTGAGGTTGCGCAGGG - Intergenic
1129943948 15:79523183-79523205 CTTTGCCTTAAGCTGGCTCAAGG + Intergenic
1132518298 16:376091-376113 CTGTGGCCTGGGCTCGGGCAGGG - Intronic
1134071263 16:11261303-11261325 CAGTGCCCTGAACAGGCTCAGGG + Intronic
1136268117 16:29132540-29132562 CTGTGCCTTCTGCTGGGGCAGGG + Intergenic
1137821358 16:51449025-51449047 CTGGGACCTGAGTTGGAGCATGG - Intergenic
1138970193 16:62134157-62134179 CAGTACCCTGAGGTGGTGCAGGG + Intergenic
1139421046 16:66849774-66849796 CTGTCCCTTGAGCTGGGCCAGGG - Intronic
1140044532 16:71431880-71431902 CTGTGCCCTGACCTGGGGGGTGG + Intergenic
1141470728 16:84236739-84236761 CTCTGCCCTGAGGTCGGGCATGG + Exonic
1141934693 16:87229429-87229451 ATGTGCCCAGAATTGGCGCACGG - Intronic
1142071427 16:88092878-88092900 CTGTGCCTTCTGCTGGGGCAGGG + Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142126162 16:88411676-88411698 CGGTGGCCTGAGGTGGCGCAGGG + Intergenic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1142248713 16:88981347-88981369 CCGTGCCCTGAGCTGGGGAGTGG - Intergenic
1143375342 17:6463847-6463869 CTGTGCCATGAGCTACCTCACGG - Exonic
1143621186 17:8081009-8081031 CTTTGCCCTGGGGTGGTGCACGG - Exonic
1144278292 17:13698815-13698837 CTGTGCTCTGGGCTGGTGCTGGG + Intergenic
1144428287 17:15166259-15166281 CTGTGCCCTGGGGTAGGGCAAGG - Intergenic
1146552194 17:33791026-33791048 CTGTGCCCTGGACTAGCCCAGGG + Intronic
1149530049 17:57388030-57388052 CAGTGCCCTGAGCAGGCTGAAGG - Intronic
1149555810 17:57572723-57572745 CTCTGCCCTGAGCTGGTGGGTGG - Intronic
1149578105 17:57728145-57728167 CTATCCCCAGACCTGGCGCATGG - Intergenic
1150004851 17:61463233-61463255 CTGTGGCCTGAACTGCCTCAGGG - Intronic
1150640674 17:66947546-66947568 CTGAGGCCTGGGCTGCCGCATGG - Intergenic
1151293083 17:73164589-73164611 CTGCGCCCGGGGCTGGCCCACGG + Intergenic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1152571551 17:81123358-81123380 CTGTGCCCAGCCCTGGCTCACGG - Intronic
1152630121 17:81407153-81407175 CCCTGCACTGAGCTGGGGCAAGG - Intronic
1152943383 17:83184500-83184522 CTGAGCCCTGAGGTGGGGCCTGG + Intergenic
1159932834 18:74332215-74332237 CTGAGTCCTGAGGTGGCACAAGG + Intronic
1160876833 19:1300358-1300380 CTGTGCCCTGGCCTGGGGGAGGG + Intergenic
1161280143 19:3441573-3441595 CTGGCCCCTGGGCTGGAGCAGGG + Intronic
1161587683 19:5114377-5114399 CGGTGTCCTGCACTGGCGCAGGG - Intronic
1163228127 19:15979346-15979368 CTGTGCTCTGGGCTGGCCAAGGG + Intergenic
1163462615 19:17448158-17448180 CTGGGCGCCGAGCTGGCGCGGGG - Exonic
1163602436 19:18257199-18257221 ATGTGCCGTGAGCTGGCCGAGGG + Exonic
1163831392 19:19548677-19548699 TTGTGCCCTGAGCTGACCCAGGG - Intergenic
1165700255 19:37932174-37932196 CCCTGCCCTGAGCTTGCGCCTGG - Intronic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1165879267 19:39031462-39031484 CTTTGCCCTGAGCTGGTGGGAGG - Intronic
1165899080 19:39160241-39160263 CTGGTCCCTGAGGAGGCGCAGGG - Intronic
1166281895 19:41799702-41799724 CTGGGCCCTGCGCTGGTGCAGGG - Intronic
1167240233 19:48339084-48339106 CTGTGCCCAGAGGAGGGGCAGGG + Intronic
1168728568 19:58606504-58606526 CAGCGCCCCGTGCTGGCGCAGGG - Intergenic
925474478 2:4197621-4197643 CTGTGCCCTTAGCAGTCACACGG - Intergenic
925701952 2:6647766-6647788 TAGTACCCAGAGCTGGCGCAGGG + Intergenic
925811215 2:7702782-7702804 CCCTGCCCTGAGCTGAGGCAGGG - Intergenic
926251844 2:11159320-11159342 CTCTGCCCTGCCCTGCCGCAGGG - Intronic
927247098 2:20965849-20965871 CAGTGCCCAGAGCTGGTGCTGGG + Intergenic
927250437 2:20991281-20991303 CTGTCCCCTGACCTGTCACAGGG - Intergenic
927481441 2:23457172-23457194 CCGTGCCCTGAGTGAGCGCAGGG + Intronic
927645848 2:24876590-24876612 CAGGGCCCTGAGCTGGCCCTAGG + Intronic
929564440 2:42975653-42975675 CAGTGCCCCGAGCTGGGGCTTGG + Intergenic
932415664 2:71572591-71572613 CTGTGGCCTGAGCTGTGGCCTGG + Intronic
933644416 2:84798894-84798916 CTGTGGCCTGAGCTCGAGTAGGG + Intronic
933920447 2:87040313-87040335 CTGGGACCTGGGCTGGTGCAGGG - Intergenic
933931177 2:87153473-87153495 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
934002550 2:87729585-87729607 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
934051190 2:88212372-88212394 CTAAGCTCTGAGCTGGCGTAGGG - Intergenic
934063450 2:88318462-88318484 CTGGGACCTGAGCTGGGGCCGGG + Intergenic
934655835 2:96116518-96116540 CTGCGAGCTGAGCGGGCGCAAGG - Intergenic
935182959 2:100706475-100706497 CTGGGCCCTAAGCGGGCACAGGG + Intergenic
935262670 2:101368779-101368801 CTGTGCCCTCACTTGGGGCAAGG - Intronic
935341090 2:102060594-102060616 CTGTGCTCTGAGGAGGCCCAGGG - Intergenic
936361946 2:111811959-111811981 CTGGGACCTGGGCTGGTGCAGGG - Intronic
938728060 2:134124097-134124119 CTGTGCACTGGGCTGGTGCTGGG + Intronic
940002013 2:148975781-148975803 CTGAGTCCTGGGCTGGCGCCTGG + Intronic
940323207 2:152399119-152399141 CTGGACCCTGAGCTGGTGCTGGG + Intronic
940630394 2:156230561-156230583 CTGGGCTCTGAGCTGGTGCTGGG - Intergenic
942450343 2:176105081-176105103 CTGGGTCCTGAGCTACCGCAGGG + Intronic
946196174 2:218034042-218034064 CTCTGGGCTGAGCTGTCGCAAGG - Intergenic
946327543 2:218992591-218992613 CTGGGACCTCAGCTGGGGCAGGG + Intronic
947114903 2:226759090-226759112 CTGTGTCCGGGGCTGGTGCAAGG + Intronic
947999108 2:234553146-234553168 CTGTGTCCTCACCTGGCGGAAGG - Intergenic
948126343 2:235567324-235567346 CTCTGCCCTCAGCTGGCCCATGG + Intronic
948437247 2:237962015-237962037 CTCTGGCCTGGGCTGGTGCAGGG - Intergenic
948831114 2:240598691-240598713 CAGTCACCTGAGCTGGCACAGGG - Exonic
1168879462 20:1194347-1194369 CTAGGCCCTGTGCTGGCACATGG - Intergenic
1169292895 20:4367888-4367910 CTGTGCCCTGTGCTGCTGGAGGG + Intergenic
1169340104 20:4790087-4790109 CTGTGCCCCCAGCTGGTGTATGG - Intronic
1170818294 20:19734030-19734052 CCGTGCCCTGCACTGACGCACGG - Intergenic
1171186121 20:23125606-23125628 CTTTGGACTGAGCTGGCTCAAGG - Intergenic
1172379073 20:34473511-34473533 CTCTGTCCTGAGCTGGAGAAGGG - Intronic
1172703251 20:36864984-36865006 CTCTGCCCTGCGGTGGCTCAGGG - Intergenic
1173277250 20:41595899-41595921 CTATGCCCTGTGCTGGCGGCAGG + Intronic
1173634684 20:44544970-44544992 CTGTGGCCTGAGCTGGAGTACGG + Intronic
1173721809 20:45265196-45265218 CTGTGCCCAAAGCTGGGGTAAGG + Intergenic
1174386211 20:50190037-50190059 CTGGGCCCTGGGATGGGGCAGGG - Intergenic
1174483345 20:50845931-50845953 CTGTGGCCTGGGCTGGCCCGAGG + Intronic
1174581364 20:51574110-51574132 CTGAGCCCTGATTTGGCACAGGG + Intergenic
1175733236 20:61368385-61368407 CTGTGTCCTCACCTGGCGGATGG - Intronic
1176102655 20:63371629-63371651 GCGTGCCCTGTGCTGGCGCAAGG + Intronic
1176122527 20:63460499-63460521 CAGTGCCCTCAGCTGGTCCACGG + Intronic
1176978506 21:15352057-15352079 CTGTGCCCTGAGAGGGAGAACGG - Intergenic
1179210628 21:39321616-39321638 CTGTGGCGTGACCTGGCCCACGG + Intergenic
1179241820 21:39599458-39599480 CTGGGCCTTGAGCTGGCATAGGG + Intronic
1179909531 21:44440691-44440713 CTGTGCTCAGAGCTGGGTCAGGG + Intronic
1179959456 21:44759805-44759827 CGGTGCCCTGAGCTGGCCGTGGG - Intergenic
1180217714 21:46336409-46336431 CTGTCCCCTGGGCTGGAGTATGG + Intronic
1181063403 22:20293070-20293092 CTGTCTCCTGAGCTGGAGAACGG + Intergenic
1184021705 22:41825824-41825846 CTGAGCCCTGAGCTGCTCCAGGG - Exonic
1184062337 22:42091040-42091062 CTGGGTCGTGAGCTGGCGCCGGG + Intergenic
1184478681 22:44735175-44735197 CTGGGCCTTGGGCTGGGGCAGGG + Intronic
1184596552 22:45517456-45517478 CTGTAGCCTGGGCTGGGGCATGG + Intronic
1184810829 22:46830605-46830627 TTGTGCCATCAGCTGGCCCACGG - Intronic
1185080092 22:48704936-48704958 CTGTGTCCTGAGATGGTGCAGGG + Intronic
1185168717 22:49278465-49278487 TGGGGCCCTGAGCTGCCGCAGGG + Intergenic
1185392272 22:50569016-50569038 CTGTGGTCTGAGCTGGGGGAGGG + Exonic
949934240 3:9104624-9104646 CTTTGCCCCAAGCTGGCCCATGG - Intronic
950671806 3:14531903-14531925 CTGAGCCCTGAGGCAGCGCAGGG - Intronic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
953361407 3:42300562-42300584 CTGTGTCCTTAGATGGCACAAGG + Intergenic
956681587 3:71785937-71785959 CTGTGCCTGGAGCTGGCGCGGGG - Intergenic
956743642 3:72294271-72294293 CAGAGTCCTGAGGTGGCGCAGGG - Intergenic
957014224 3:75044214-75044236 CTGTGGCCTGAGCTCTAGCAGGG - Intergenic
957691880 3:83581235-83581257 GGGTGCCCTGAGTTGGTGCAGGG + Intergenic
960543378 3:118884855-118884877 CTGTGCCCTGTGCTGCCCCCAGG - Intergenic
963876669 3:150483635-150483657 CTGTCCCCTTAGCTGCCCCAGGG - Intergenic
964178497 3:153855710-153855732 CTGTCCCCTGGACTGGCCCAGGG + Intergenic
967790041 3:193538929-193538951 TTGTGCCCCAAGCTGGAGCACGG + Intronic
968601374 4:1511578-1511600 CTGGGCGCTGAGCTGGGGCGCGG - Intergenic
969712822 4:8853991-8854013 GTGTGCCCTGAGCCGACCCATGG + Intronic
972311946 4:37890689-37890711 CTGTGCCCAGATCCTGCGCAGGG + Intergenic
973246724 4:48017327-48017349 CTGCGCCCTGCGCTGGCTCCCGG + Intronic
976239471 4:82939583-82939605 CTGTTCCCGGAGCTGGTGCCAGG + Exonic
976513966 4:85943411-85943433 CTGTGCCCTCAGATGGTGGAAGG + Intronic
981227452 4:142313507-142313529 CTGAGCCCTGAGCTGTGGAAGGG + Intronic
981529320 4:145736434-145736456 CTGTGACCTGAGCTGGGTCAAGG + Intronic
981579816 4:146239929-146239951 CTGGACCCTGAGCAGGAGCAAGG - Intergenic
982790587 4:159586950-159586972 CTGTGTCCTGAGGGTGCGCAGGG + Intergenic
984866470 4:184284410-184284432 CTCTGCCCTAAGCAGGAGCAGGG + Intergenic
985698966 5:1358998-1359020 CTGTGCACTGAGCAGCCCCATGG + Intergenic
987081052 5:14425766-14425788 CTGTGCCCTCACATGGCGGAAGG - Intronic
993874103 5:93286088-93286110 CTGGGCCCTGAGAGGGGGCAGGG - Intergenic
995678001 5:114685022-114685044 CACTGCCCTGAGCTGGCCCTTGG - Intergenic
995853800 5:116573355-116573377 CTTTGCACCGGGCTGGCGCACGG - Intronic
999134073 5:149306203-149306225 CTCTTCCCTGAGGTGGAGCAGGG + Intronic
1000014867 5:157267256-157267278 CTGTGCCCTCAGCATGGGCAGGG + Intronic
1000297921 5:159928296-159928318 CTGTATCCTGAGCTGACTCATGG - Intronic
1002395548 5:178950243-178950265 CTGTGCCATGAGCTAGGGGAAGG + Intronic
1002476332 5:179468679-179468701 CTGGGAGCTGAGCTGGGGCAGGG - Intergenic
1003232713 6:4269202-4269224 CAGAGCCCTGAGGTGGTGCAGGG - Intergenic
1003616421 6:7659045-7659067 CAGTGTCCTGAGGTGGTGCAGGG + Intergenic
1003992029 6:11495638-11495660 CTCTACCCTGAGATGGCTCAAGG - Intergenic
1006407164 6:33852064-33852086 CTGTGCCCTGAGCAGACACTAGG + Intergenic
1008265709 6:49423305-49423327 CTGAGCCCTGAGCTTGCTTAAGG - Intergenic
1011693148 6:89887989-89888011 ATGTGCCCTGTGCTGGGGCCTGG + Intergenic
1012499088 6:99869013-99869035 CGGTGTCCTGAGGTGGCACAGGG + Intergenic
1015912414 6:138182164-138182186 CTCTGCCCTGGACTGGCTCAAGG - Intronic
1018849172 6:167575477-167575499 CTGTGCCCTCACGTGGCGGAAGG - Intergenic
1019540296 7:1548225-1548247 CAGTGCCCTGGCCTGGCCCAGGG + Intronic
1021188910 7:17597780-17597802 CTGTGCCCTGCAGTGGCGCAGGG - Intergenic
1023319697 7:38980894-38980916 CTGTGTCCTGAGCTGGATCATGG - Intronic
1023534007 7:41188638-41188660 CTGTGCTCTGAGCTTCCGAAAGG + Intergenic
1023659143 7:42455335-42455357 GTGAGCCCCGAGCTGGTGCAGGG + Intergenic
1024046182 7:45587234-45587256 CTCTGCCCAGAGCTGTGGCATGG + Intronic
1024929915 7:54658952-54658974 CTGTGGCCTGATTTGGAGCAGGG + Intergenic
1025025848 7:55515426-55515448 CTGTGCCCAGAGGTGGCTGATGG - Intronic
1026999576 7:74643186-74643208 CAGTGCCCTGTGGTTGCGCATGG + Intergenic
1028669417 7:93384074-93384096 CTATGTCCTGACCTGGGGCAGGG - Intergenic
1031257151 7:119467512-119467534 CTGTACCCTGGGGTGGCCCAAGG + Intergenic
1032957420 7:136987201-136987223 CTGTGCTATGTGCTGGAGCAGGG - Intronic
1033040981 7:137917992-137918014 CTCTGGGCTGAGCTGGGGCACGG - Intronic
1033401175 7:141026711-141026733 CTGAGCCCTGGGCTGGTGCTAGG + Intergenic
1034590283 7:152132532-152132554 CTGGGCACTGAGCTGGAGCACGG + Intergenic
1034941991 7:155236667-155236689 GTGAGCCCTGGGCTGGAGCAGGG - Intergenic
1035302141 7:157904496-157904518 CAGTGCCCTGAGCAGGTGCCGGG + Intronic
1037319642 8:17630911-17630933 CTTTGCTCTGAGCTGCAGCATGG + Intronic
1038190504 8:25315437-25315459 CTGTAACCTGAGTTGGGGCAAGG + Intronic
1039573302 8:38603868-38603890 CTGTGCCCTGAGGTTGCCCTAGG + Intergenic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1040106901 8:43546580-43546602 CTCTGCCAAGATCTGGCGCAGGG + Intergenic
1040285237 8:46097434-46097456 GTGAGCCCTGAGCTGGTGCTGGG + Intergenic
1044199163 8:89413561-89413583 CTTTGCCCTCTGCTGGCGGAGGG - Intergenic
1045111115 8:98940299-98940321 CGGAGCCCAGAGCCGGCGCAAGG - Intronic
1045518130 8:102879137-102879159 CAGTGTCCTGAGGTGGTGCAGGG - Intronic
1046134008 8:110003541-110003563 ATGTGCCCAGAGCAGGAGCAAGG + Intergenic
1046970648 8:120219522-120219544 CTGTGCCCTTACCTGGTGGAAGG + Intronic
1047706800 8:127507160-127507182 CTGTTGCCTAAGCTGGAGCATGG - Intergenic
1049402343 8:142434041-142434063 CTGTGCCTTCAGGTGGGGCAGGG + Intergenic
1049443865 8:142621333-142621355 GTGTGCCCTGAGCTTGCCCTGGG + Intergenic
1049560196 8:143306487-143306509 CTGTGTCCTGAGCTGTGGCTTGG + Intronic
1049592962 8:143470982-143471004 CGGTGCCCAGAGCTGGCACTGGG - Intronic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049720040 8:144111511-144111533 CTGGGGCCTGAGCCGGGGCAGGG - Intronic
1051583882 9:18706635-18706657 CAGTGCCCAGAGCTGTCCCAGGG - Intronic
1052781261 9:32783577-32783599 CTGCGCGCTGAGCTGGCGCCGGG + Exonic
1056693838 9:88829830-88829852 ATGTGCCCTGTGCTGCCCCAAGG - Intergenic
1060802597 9:126554186-126554208 CAGTGCCCTGAGCTGGGCCCTGG - Intergenic
1060814523 9:126627582-126627604 CTTTCCCCAGAGCTGGAGCAGGG + Intronic
1062459537 9:136657143-136657165 CTGTGCCATGTACTGGCGCCAGG + Intergenic
1062568330 9:137173055-137173077 ATGTGTCCTGAGCTGGCAGAAGG - Intergenic
1187601730 X:20839093-20839115 CTGTGCCCTGAGCTTGATCAAGG - Intergenic
1187843165 X:23509574-23509596 CAGTGCCCTGAGCTGTAGCTGGG - Intergenic
1190808860 X:53864434-53864456 CTATGGCCTGAGCTTGAGCAGGG + Intergenic
1191888864 X:65920170-65920192 CTGTGCTCTGGGCTGGTACAGGG + Intergenic
1192122028 X:68465279-68465301 CTGAGTCCTGGGCTGGGGCAGGG + Intergenic
1192200140 X:69061344-69061366 CTGTGCACTGAGCTGTCTCCAGG - Intergenic
1194542346 X:95190090-95190112 CTGTGCCCTGAAAAGGCACATGG - Intergenic
1197460603 X:126736143-126736165 CAGTGTCCTGAGGTGGCCCAGGG + Intergenic