ID: 900604526

View in Genome Browser
Species Human (GRCh38)
Location 1:3517924-3517946
Sequence CATCAAACCCCCACTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900604526_900604532 17 Left 900604526 1:3517924-3517946 CCCCACCCAGTGGGGGTTTGATG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 900604532 1:3517964-3517986 CACCGCGTGCTTCCGCAATCCGG 0: 1
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900604526 Original CRISPR CATCAAACCCCCACTGGGTG GGG (reversed) Intronic
900604526 1:3517924-3517946 CATCAAACCCCCACTGGGTGGGG - Intronic
902542311 1:17163834-17163856 GACCAAATCCCCCCTGGGTGGGG - Intergenic
903781491 1:25822961-25822983 CATTAAATCCCCACTGTGGGGGG + Intronic
903864726 1:26389789-26389811 CAGGAAACCCCCACAGGCTGAGG + Intergenic
907156320 1:52337893-52337915 CATCATCCACCCACTGGATGTGG - Exonic
907516272 1:54995270-54995292 ACTCAAGCCCCCACAGGGTGGGG - Intergenic
908787048 1:67745484-67745506 CATCCAAGCCCCACAGGGTCTGG + Intronic
908849689 1:68363381-68363403 CATCAAAACCAGCCTGGGTGGGG + Intergenic
915953673 1:160206198-160206220 CACCACACCCCCACTCTGTGGGG + Intronic
917796965 1:178539560-178539582 CTTCAAAGCCCCACTGGGCTGGG + Intronic
920111150 1:203588220-203588242 CATCAATTCCCCACTCTGTGGGG + Intergenic
921374093 1:214455468-214455490 CATGATACCTCCTCTGGGTGAGG + Intronic
922365492 1:224859709-224859731 CATCAAACCCCCAACAAGTGTGG - Intergenic
1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG + Exonic
1072511578 10:96130776-96130798 AATCCAACTGCCACTGGGTGTGG - Intronic
1075680004 10:124324989-124325011 CATCACAGCCTCACTGGCTGAGG - Intergenic
1083187873 11:61027894-61027916 CATCAAAGCCCCTCTGGCTGTGG + Intergenic
1087133787 11:94694111-94694133 CATCAAACCTCCTCTGGGCCAGG + Intergenic
1087185542 11:95189190-95189212 CATCAAAGGCCTACAGGGTGAGG - Intronic
1094096680 12:26712996-26713018 CCTCAGAGCCCCGCTGGGTGAGG - Intronic
1095629870 12:44363006-44363028 CATTAAACCACAGCTGGGTGTGG - Intronic
1096232813 12:49905838-49905860 CATCTAACCCCAACTAGGGGGGG - Intergenic
1104981200 12:132573800-132573822 CACCACTCCCCCTCTGGGTGGGG + Intronic
1106170520 13:27284341-27284363 GATCAAAGCACCCCTGGGTGGGG + Intergenic
1110751338 13:79119642-79119664 CATCAAACACCCAAGGGCTGAGG - Intergenic
1112873949 13:104012134-104012156 CCTCCACCCTCCACTGGGTGAGG + Intergenic
1112920377 13:104604645-104604667 GCTCAAACCCCTACTGGGAGGGG - Intergenic
1113716890 13:112516373-112516395 CCTCCAGCCCCCACTGGGTGCGG - Intronic
1115268569 14:31527087-31527109 CATCAAACCCCCAAGGGCTGAGG - Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119551148 14:75514986-75515008 CCTCAAGCCCCCTCTGCGTGGGG + Intergenic
1125197578 15:37065878-37065900 CATCAAACCTCCACTGACTTTGG - Intronic
1126378063 15:48016379-48016401 CAGCAAACCAGAACTGGGTGGGG + Intergenic
1127775651 15:62262328-62262350 CATCCAACCCCCACTGTGGGAGG + Intergenic
1128366777 15:67009770-67009792 CATCAAACCCTGAATGGGTGGGG + Intergenic
1130851395 15:87797704-87797726 CACCGAACACCCACAGGGTGTGG - Intergenic
1130996390 15:88906853-88906875 CTTCACTCCCCCACTGGGTGGGG + Intronic
1137728825 16:50675028-50675050 CATTTAATCCTCACTGGGTGAGG - Intronic
1140040184 16:71402305-71402327 CAGCAAACCCACACAAGGTGAGG + Intergenic
1141395314 16:83699312-83699334 CAACAAACAGCCACTGAGTGTGG + Intronic
1141631770 16:85291704-85291726 CCCCTAACCCCCACAGGGTGAGG - Intergenic
1141755401 16:85987608-85987630 CCCCAAACACCCACTGGATGTGG - Intergenic
1141816216 16:86410981-86411003 AAACAAACCTCCACTGTGTGTGG + Intergenic
1142376661 16:89710191-89710213 GATCCAACCCCCTGTGGGTGGGG + Intronic
1143492512 17:7292675-7292697 CATAAGAACCCCAGTGGGTGGGG + Intronic
1145028873 17:19489552-19489574 CACCAAACCCCTGCTGGGTGAGG + Intergenic
1146425513 17:32733697-32733719 CAACAAATCCCCACAGGGTGAGG + Intronic
1148397018 17:47317073-47317095 AATACAATCCCCACTGGGTGTGG - Intronic
1148787572 17:50152762-50152784 TTCCAAACCCCAACTGGGTGAGG - Intergenic
1151934880 17:77255481-77255503 GCTTAAACCCCCACTGGGGGAGG - Intergenic
1152209219 17:78994232-78994254 GAACAAACCCCCATTGGATGTGG + Intronic
1153740139 18:8116569-8116591 CATCAGACCTCCTCTTGGTGAGG + Intronic
1154042280 18:10868019-10868041 CATAAAACCCCCAGTGGAAGTGG - Intronic
1154502052 18:15001957-15001979 CGTGCAGCCCCCACTGGGTGCGG - Intergenic
1162457148 19:10792237-10792259 CTTCATACCCCAACTGGGAGAGG - Intronic
1164502734 19:28833142-28833164 CATCGAACAGCCCCTGGGTGTGG - Intergenic
1164588024 19:29489473-29489495 CATCAAACCCACCCATGGTGTGG + Intergenic
1166175006 19:41061608-41061630 CATAAAACCACCACTGGCCGGGG + Intergenic
925088638 2:1134729-1134751 CATCAACCACCCAATGGCTGAGG - Intronic
925290709 2:2746709-2746731 CAGCAAAACCCCACTGGAGGGGG - Intergenic
925731086 2:6919631-6919653 AGTCAGACCCCCACTGGCTGTGG + Intronic
927869037 2:26612200-26612222 CATCAGCCCCTCACTGGGTCTGG - Intronic
929585472 2:43111316-43111338 AATGAAAACCCTACTGGGTGTGG - Intergenic
931825999 2:66001774-66001796 AGTCAAAATCCCACTGGGTGGGG - Intergenic
933292466 2:80453053-80453075 TAACAAATTCCCACTGGGTGTGG - Intronic
934671266 2:96214657-96214679 CAACAAACCACCAATGGGTTGGG - Intergenic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG + Intronic
944253902 2:197605045-197605067 CATAAAACACACGCTGGGTGTGG - Intronic
945267544 2:207905767-207905789 TATCAAACACCCTGTGGGTGGGG - Intronic
945465845 2:210170726-210170748 CACCACACCCCCAATGGGTGAGG + Intronic
1169150735 20:3287390-3287412 CATCATATCCCCACAAGGTGGGG - Intronic
1174379407 20:50146971-50146993 CAGAAAACCCCGAGTGGGTGGGG + Intronic
1182449508 22:30410627-30410649 CATCAAACCCTTCCTGAGTGAGG + Exonic
1183296577 22:37033295-37033317 CATCACACCCACACTGGGCATGG - Intergenic
1184089756 22:42286194-42286216 TCTCAAAGCCCCACTGGGAGGGG - Intronic
1184200448 22:42965046-42965068 CATCAAAACCCAACTGTGTGTGG + Intronic
954334103 3:49906139-49906161 TATCAACCCTGCACTGGGTGTGG - Intronic
954813363 3:53261699-53261721 CATCAAGCTCCCACTGCCTGGGG - Intergenic
955567983 3:60270265-60270287 CAACAAAGCCTCACTGGGGGAGG - Intronic
960867444 3:122216199-122216221 CATCAAATCCTAACTGGGTGAGG + Intronic
962120842 3:132558314-132558336 CAACAAACCCTCAGTGGGTCAGG + Exonic
967017174 3:185492896-185492918 CAGCAAACCCCCACTAGCTGAGG + Intronic
984926953 4:184815431-184815453 AACTAAACACCCACTGGGTGAGG - Intronic
985995999 5:3597183-3597205 CATCTAACGCCCACTGGGACGGG - Intronic
987100979 5:14590977-14590999 AAACAAACCCACACTGGCTGTGG + Intronic
989140888 5:38200306-38200328 CTTTAAAACCCCACTTGGTGTGG + Intergenic
991971072 5:72142109-72142131 CACCAAACTGTCACTGGGTGGGG - Intronic
995841038 5:116443471-116443493 CATCATACCCACAAAGGGTGGGG + Intergenic
1004863478 6:19831290-19831312 GTACAAACACCCACTGGGTGGGG - Intergenic
1008142333 6:47846276-47846298 TATTAAACCTCCACTGGGTCTGG - Intergenic
1014643541 6:123944868-123944890 TATCAATCCCCCACAGGGTAAGG - Intronic
1019389225 7:776461-776483 CTCCAAACCAGCACTGGGTGGGG + Intronic
1024299762 7:47877911-47877933 TAACAAACACTCACTGGGTGGGG + Intronic
1029467651 7:100736487-100736509 CCTCAAAATCACACTGGGTGAGG - Exonic
1029519826 7:101052897-101052919 CATTAAACACCCACTGGGCAGGG + Intronic
1029595021 7:101533208-101533230 CATCAGGCAACCACTGGGTGTGG + Intronic
1032446645 7:131989893-131989915 CATGCAGCCTCCACTGGGTGGGG - Intergenic
1041365737 8:57102130-57102152 CAGCAATCCACTACTGGGTGAGG - Intergenic
1042810584 8:72821669-72821691 CACCAAGCCCCCACAGTGTGTGG + Intronic
1050176343 9:2873085-2873107 CCACAAAGCCCAACTGGGTGTGG + Intergenic
1051262796 9:15281193-15281215 CAACAAAAACCCACTGTGTGTGG + Intronic
1056470568 9:86901612-86901634 CATCAAACCCTGACTGGTGGTGG + Intergenic
1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG + Intronic
1057180726 9:93028658-93028680 CATAAAACCCCGACTGCGTTTGG - Intronic
1057827365 9:98381364-98381386 CAGCAAACTCCCACCGAGTGGGG - Intronic
1059426194 9:114222382-114222404 CATCAAACCCCCAGAGGGGCTGG + Intronic
1061072731 9:128321593-128321615 CATCAACCATCCACTGGGTAAGG - Exonic
1061130640 9:128706003-128706025 CCCCAAACCCCAGCTGGGTGAGG + Intronic
1061494867 9:130967112-130967134 CAACAAACCTCCTCTGGGCGCGG + Intergenic
1187706812 X:22017454-22017476 CATCCAAATCCCACTGGGTAGGG - Intergenic
1189842807 X:45099742-45099764 AAAGAAACCCTCACTGGGTGCGG + Intronic
1198543143 X:137661783-137661805 CATCATCCACCCATTGGGTGTGG - Intergenic