ID: 900605261

View in Genome Browser
Species Human (GRCh38)
Location 1:3521021-3521043
Sequence TAGACTCCCCACTAGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900605261_900605265 2 Left 900605261 1:3521021-3521043 CCAAGCTGCTAGTGGGGAGTCTA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 900605265 1:3521046-3521068 CGCAGAGCCTCAAGCCCGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 81
900605261_900605266 3 Left 900605261 1:3521021-3521043 CCAAGCTGCTAGTGGGGAGTCTA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 900605266 1:3521047-3521069 GCAGAGCCTCAAGCCCGTGGGGG 0: 1
1: 1
2: 0
3: 10
4: 127
900605261_900605264 1 Left 900605261 1:3521021-3521043 CCAAGCTGCTAGTGGGGAGTCTA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 900605264 1:3521045-3521067 CCGCAGAGCCTCAAGCCCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 50
900605261_900605262 0 Left 900605261 1:3521021-3521043 CCAAGCTGCTAGTGGGGAGTCTA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 900605262 1:3521044-3521066 ACCGCAGAGCCTCAAGCCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900605261 Original CRISPR TAGACTCCCCACTAGCAGCT TGG (reversed) Intronic
900354242 1:2252403-2252425 CAGCCTCCCCAGAAGCAGCTTGG + Intronic
900605261 1:3521021-3521043 TAGACTCCCCACTAGCAGCTTGG - Intronic
901008268 1:6182183-6182205 CAGCCTCCCCAGTAGCAGCTGGG + Intronic
902636273 1:17736857-17736879 GAGACTTCACACAAGCAGCTCGG - Intergenic
904482570 1:30803222-30803244 CAGGCTCCCAAGTAGCAGCTGGG - Intergenic
905662302 1:39736945-39736967 TAGCCTCCCGAGTAGCAGCTGGG - Intronic
906568359 1:46816172-46816194 AAAACTCCCCACGAGCAGCATGG - Intronic
908700647 1:66896729-66896751 CAGAGTCCCCACTAGCAACAAGG + Intronic
909148508 1:71969732-71969754 TGGGCTTCCCACAAGCAGCTGGG - Intronic
912160231 1:106974143-106974165 CAGACTCCCAAGTAGTAGCTGGG + Intergenic
913559556 1:120003923-120003945 TGGCCTCCCCACAAGCATCTAGG - Intronic
913638304 1:120786618-120786640 TGGCCTCCCCACAAGCATCTAGG + Intergenic
914280144 1:146163344-146163366 TGGCCTCCCCACAAGCATCTAGG - Intronic
914541189 1:148614283-148614305 TGGCCTCCCCACAAGCATCTAGG - Intronic
914625451 1:149456962-149456984 TGGCCTCCCCACAAGCATCTAGG + Intergenic
914823637 1:151124892-151124914 TAGACTCTACAGTAGCAGTTTGG + Exonic
915313705 1:155016951-155016973 TCTACTCCCCAGGAGCAGCTGGG - Exonic
915866008 1:159500321-159500343 TAGCCACCCCACTAGCGGGTGGG + Intergenic
916799043 1:168197197-168197219 CAGCCTCCCAAGTAGCAGCTAGG - Intronic
921318442 1:213914487-213914509 TTCACACCCCACTAGCACCTCGG + Intergenic
1065209534 10:23389404-23389426 TAATCTCCCCAATTGCAGCTTGG - Intergenic
1066231463 10:33438843-33438865 TAGCCTCCCAAGTAGTAGCTGGG + Intergenic
1066641475 10:37558291-37558313 TAGCCTCCCGAGTAGTAGCTGGG - Intergenic
1068085440 10:52368223-52368245 CAGTCTCCCAAGTAGCAGCTGGG + Intergenic
1070242991 10:74701823-74701845 CAGTCTCCCAAGTAGCAGCTGGG - Intronic
1076794909 10:132793717-132793739 GAGACTCCCCAGGAGCAGGTGGG + Intergenic
1079459072 11:20663966-20663988 TAGAGTCCCCACTAGCAAGAAGG - Intergenic
1080632655 11:34093311-34093333 TTAACTCCCCACAAGTAGCTTGG + Intronic
1081832504 11:46125532-46125554 TCAGCTCCCCACTAGTAGCTTGG - Intergenic
1086351679 11:85948461-85948483 TTTACTCAGCACTAGCAGCTTGG + Intergenic
1096747079 12:53736022-53736044 AAGACTCCCCACTAGGTCCTAGG + Intergenic
1097028085 12:56073025-56073047 TAGACACCCCACCAGCAGCCAGG - Intergenic
1098106104 12:67069766-67069788 TGGGCTCCGCACCAGCAGCTCGG - Intergenic
1101742533 12:107511873-107511895 TAGACTCCCCACTAAAACCTGGG - Intronic
1102416217 12:112765152-112765174 TATGCTCCCCACGACCAGCTGGG - Intronic
1105639346 13:22246264-22246286 TAGGCCCCCCACTAGGAGCTGGG - Intergenic
1107218873 13:37955621-37955643 AAGACTCCCCACTACCAACCTGG + Intergenic
1108133206 13:47326199-47326221 TTGACACCCCACATGCAGCTTGG - Intergenic
1110884630 13:80617819-80617841 CAGCCTCCCAAGTAGCAGCTGGG - Intergenic
1117134807 14:52724303-52724325 TAGTCTCCCAACTTTCAGCTGGG - Intronic
1117449109 14:55833816-55833838 TAGAAACCCCACTAGGCGCTTGG + Intergenic
1118758467 14:68862909-68862931 CAGCCTCCCAAGTAGCAGCTGGG + Intergenic
1128003658 15:64218061-64218083 CAGCCTCCCAAGTAGCAGCTGGG + Intronic
1130989720 15:88869140-88869162 TAGTCTCCCCACCAGCCGCCTGG + Intronic
1134041983 16:11076061-11076083 TAGAATCCCCACCAGCTGCAGGG - Intronic
1137665667 16:50247478-50247500 CAGCCTCCCGAGTAGCAGCTGGG + Intronic
1139459695 16:67111737-67111759 CAGCCTCCCTACTAGTAGCTGGG + Intronic
1144698077 17:17319093-17319115 CAGCCTCCCCGCAAGCAGCTGGG - Intronic
1146829974 17:36060182-36060204 TTGCCACCCCACTAACAGCTTGG - Intergenic
1147504517 17:41002308-41002330 CAGACTCCCAAGTAGCAGCTGGG + Intergenic
1149607266 17:57933864-57933886 AAGACTCCCCAGGAGCATCTGGG + Intronic
1152531819 17:80923311-80923333 TGGACTCGGCACCAGCAGCTGGG + Intronic
1156552428 18:38031695-38031717 CAGCCTCCCAAGTAGCAGCTGGG + Intergenic
1159121797 18:64179603-64179625 TATACTCCCCATCAGCAGCAGGG + Intergenic
1161532386 19:4797817-4797839 CAGCCTCCCCAGTAGCAGCTGGG - Exonic
1161710718 19:5846232-5846254 CAGCCTCCCCAGTAGTAGCTGGG - Intronic
1162685991 19:12384816-12384838 TAGAGTCCCCACCAGCAGGAAGG + Intronic
926420685 2:12693938-12693960 TAGAGGCCCTGCTAGCAGCTTGG - Intergenic
927406245 2:22771928-22771950 TAGATTACCCACTATCAGGTTGG - Intergenic
928503970 2:31929573-31929595 TAGAATGCTGACTAGCAGCTTGG - Intronic
929991156 2:46788069-46788091 TAGCCTCCCAAGTAGCAACTGGG - Intergenic
935402224 2:102671988-102672010 CAGCCTCCCAAGTAGCAGCTGGG - Intronic
937862896 2:126724956-126724978 AAGACTCCCAACCATCAGCTGGG - Intergenic
939046541 2:137256959-137256981 TAGACTCCCCACGAGCAAGAAGG - Intronic
939767409 2:146268030-146268052 CACACTCCCCACCAGCAGCCAGG - Intergenic
943332126 2:186572293-186572315 CAGCCTCCCAAGTAGCAGCTGGG - Intergenic
948185402 2:236017626-236017648 GAGACCACCCACTAGGAGCTGGG + Intronic
948920505 2:241063965-241063987 CAGACTCCCCCCTTGCAGCTTGG + Intronic
1171140321 20:22735201-22735223 TAGACTCACCACTAGGGGCAGGG + Intergenic
1172327836 20:34050781-34050803 TAGACTCCTCACCATCATCTTGG - Intronic
1175103513 20:56596988-56597010 CAGCCTCCCGAGTAGCAGCTGGG - Intergenic
1175289106 20:57861907-57861929 TAGACTCCCCAGAAGGATCTTGG + Intergenic
1175828977 20:61951762-61951784 TAAGCTCCCCACTTGAAGCTGGG - Intergenic
1176230016 20:64027801-64027823 GTGACTCCACACAAGCAGCTGGG - Intronic
1177267646 21:18805217-18805239 CAGACTTCTCAATAGCAGCTGGG + Intergenic
1178038264 21:28609235-28609257 AACACTCCCCAGTACCAGCTTGG + Intergenic
1178732933 21:35121142-35121164 GACACTCCCCACTATCAGCCCGG + Intronic
1180632325 22:17238212-17238234 CAGCCTCCCCAGTAGTAGCTGGG - Intergenic
1182053337 22:27330164-27330186 AAGTCTCACCACCAGCAGCTGGG - Intergenic
952714848 3:36470372-36470394 GATACTCCCCAGTACCAGCTTGG - Intronic
953822577 3:46221411-46221433 TGCTCTTCCCACTAGCAGCTGGG + Intronic
959532659 3:107451360-107451382 AAGACTCCCCAGAACCAGCTGGG + Intergenic
960787035 3:121384867-121384889 TTTACTCTCCACTAGCAACTTGG + Intronic
963935456 3:151047525-151047547 CAGACTCCCGAGTAGCAGCGGGG - Intergenic
968033479 3:195524404-195524426 CAGCCTCCCCAGTAGTAGCTGGG - Intronic
971554890 4:28001727-28001749 GACACTCCCCAGTACCAGCTTGG - Intergenic
975978006 4:80121155-80121177 CAGCCTCCCGAGTAGCAGCTGGG - Intronic
977468368 4:97410628-97410650 CAGACAAACCACTAGCAGCTAGG + Intronic
978373306 4:108050749-108050771 TAGACTCGCCATTGGCAGCCAGG + Intronic
980790541 4:137614284-137614306 TAGTGTCCCCACTAACATCTGGG + Intergenic
982829818 4:160045010-160045032 GACACTCCCCAGTACCAGCTTGG + Intergenic
984066585 4:175055392-175055414 TATACTCCCCAGTACCAGCCTGG + Intergenic
990576128 5:57125193-57125215 CAGCCTCCCGACTAGTAGCTGGG + Intergenic
991058522 5:62345429-62345451 CAGCCTCCCAAGTAGCAGCTGGG - Intronic
992782134 5:80137521-80137543 CAGCCTCCCGAGTAGCAGCTGGG - Intronic
997779484 5:136642335-136642357 TAGACTCAGCACTAGATGCTGGG + Intergenic
999337588 5:150735503-150735525 GACACTCCCCAGTACCAGCTCGG + Intronic
1000086671 5:157893672-157893694 CAGCCTCCCAACTAGTAGCTGGG - Intergenic
1001109129 5:168881117-168881139 TATACTCACTACTAGCAGCTGGG - Intronic
1002705525 5:181158986-181159008 TGGCCTCCCCATTATCAGCTGGG - Intergenic
1006762479 6:36475328-36475350 CAGCCTCCCAAGTAGCAGCTGGG - Intronic
1007011162 6:38418857-38418879 TAGCCTCCCAAATAGCTGCTGGG - Intronic
1009545424 6:65013744-65013766 TAGCCTCCCAAGTAGTAGCTGGG - Intronic
1015691841 6:135933147-135933169 TAGACTCCACACAAGAACCTGGG + Intronic
1016216251 6:141607568-141607590 GACACTCCCCAGTACCAGCTTGG - Intergenic
1019137791 6:169922146-169922168 CAGTCTCCCCACCAGCAGCCTGG - Intergenic
1024673350 7:51616531-51616553 CAGAGTCCCCACTAGCAGGAAGG - Intergenic
1025182028 7:56828156-56828178 TGGACTCTCCACGAACAGCTAGG - Intergenic
1025689900 7:63748839-63748861 TGGACTCTCCACGAACAGCTAGG + Intergenic
1028529577 7:91824232-91824254 GACACTCCCCAGTAGCAGCCTGG - Intronic
1029260953 7:99302446-99302468 CAGCCTCCCAAGTAGCAGCTGGG - Intergenic
1030736635 7:113056376-113056398 TAGACTCCCCACTATTGTCTAGG + Intergenic
1032513567 7:132491005-132491027 GGCACTCCCCACAAGCAGCTTGG + Intronic
1037789727 8:21927131-21927153 TAGCCTCCCCCCCAGTAGCTGGG - Intronic
1038708176 8:29915748-29915770 CAGCCTCCCAAGTAGCAGCTGGG + Intergenic
1040598751 8:48864196-48864218 GAGACATCCCACTAGAAGCTAGG - Intergenic
1042126582 8:65543556-65543578 CAGTCTCCCCCCGAGCAGCTGGG - Intergenic
1047570738 8:126095797-126095819 CAGCCTCCCCCCTAGTAGCTGGG - Intergenic
1047985603 8:130229944-130229966 CAGCCTCCCGAGTAGCAGCTGGG - Intronic
1049134617 8:140884797-140884819 CAGTCTTCCCACTACCAGCTTGG + Intronic
1052095873 9:24383423-24383445 TAGCCTCCAGACTAGCAGCTAGG + Intergenic
1054729497 9:68686378-68686400 TAGCCTCCCAAGTAGTAGCTGGG - Intergenic
1059217457 9:112578764-112578786 TTGACTACCTACTAGTAGCTTGG + Intronic
1060611584 9:124970602-124970624 CAGACTCCCAAGTAGTAGCTGGG - Intronic
1061981428 9:134106222-134106244 CAGCCTCCCCAGTAGTAGCTGGG - Intergenic
1062348351 9:136125972-136125994 TAGAATCTCCTCTTGCAGCTTGG - Intergenic
1188645619 X:32563222-32563244 CAGCCTCCCAAGTAGCAGCTGGG - Intronic
1188972277 X:36632650-36632672 TAGAATCACCACTAGCATATTGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1198179767 X:134194926-134194948 CAGCCTCCCGAGTAGCAGCTGGG - Intergenic
1199586914 X:149424221-149424243 TATATTCCCCAGCAGCAGCTGGG + Intergenic