ID: 900605275

View in Genome Browser
Species Human (GRCh38)
Location 1:3521083-3521105
Sequence CCCCGCCTGGGGCTTTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 274}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900605275_900605290 13 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605290 1:3521119-3521141 CCGGCCAGGAGGACCCTGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 250
900605275_900605294 20 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605294 1:3521126-3521148 GGAGGACCCTGGCAGGCCTGGGG 0: 1
1: 0
2: 4
3: 52
4: 436
900605275_900605287 9 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605287 1:3521115-3521137 CCTCCCGGCCAGGAGGACCCTGG 0: 1
1: 0
2: 2
3: 31
4: 250
900605275_900605297 25 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605297 1:3521131-3521153 ACCCTGGCAGGCCTGGGGGAGGG 0: 1
1: 1
2: 1
3: 83
4: 547
900605275_900605284 2 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605284 1:3521108-3521130 ACGACACCCTCCCGGCCAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 57
900605275_900605282 -6 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605282 1:3521100-3521122 GCGGGGTCACGACACCCTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 85
900605275_900605296 24 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605296 1:3521130-3521152 GACCCTGGCAGGCCTGGGGGAGG 0: 1
1: 0
2: 8
3: 70
4: 595
900605275_900605292 18 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605292 1:3521124-3521146 CAGGAGGACCCTGGCAGGCCTGG 0: 1
1: 0
2: 3
3: 73
4: 715
900605275_900605299 26 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605299 1:3521132-3521154 CCCTGGCAGGCCTGGGGGAGGGG 0: 1
1: 0
2: 8
3: 101
4: 834
900605275_900605293 19 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605293 1:3521125-3521147 AGGAGGACCCTGGCAGGCCTGGG 0: 1
1: 0
2: 1
3: 48
4: 375
900605275_900605283 -1 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605283 1:3521105-3521127 GTCACGACACCCTCCCGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 64
900605275_900605295 21 Left 900605275 1:3521083-3521105 CCCCTGCAAAGCCCCAGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 274
Right 900605295 1:3521127-3521149 GAGGACCCTGGCAGGCCTGGGGG 0: 1
1: 0
2: 1
3: 41
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900605275 Original CRISPR CCCCGCCTGGGGCTTTGCAG GGG (reversed) Intronic
900040973 1:464224-464246 CCACCCCTGTGGTTTTGCAGGGG + Intergenic
900062402 1:699200-699222 CCACCCCTGTGGTTTTGCAGGGG + Intergenic
900188813 1:1344845-1344867 CCCTGCCAGGGGCTCTGCTGTGG - Intronic
900409690 1:2507026-2507048 CCCTGCATGGGGGTGTGCAGGGG + Intergenic
900605275 1:3521083-3521105 CCCCGCCTGGGGCTTTGCAGGGG - Intronic
901186100 1:7374432-7374454 CCCAGCCTGCTGCTTAGCAGAGG + Intronic
901644034 1:10707023-10707045 GCCCACCTGGTGCCTTGCAGTGG - Intronic
901924354 1:12556525-12556547 CCCAGCCTGGGGCCTGGCTGTGG - Intergenic
902046452 1:13528304-13528326 TCCCACCTGGGGGTTTGCAGAGG + Intergenic
902046710 1:13530100-13530122 TCCCACCTGGGGGTTTACAGAGG + Intergenic
902386360 1:16078172-16078194 CCCTGCCTGGGGGGTTCCAGGGG + Intergenic
902386625 1:16079589-16079611 CCCCGCCTGGGGTTTCCCCGGGG + Intergenic
902924603 1:19687904-19687926 GCTCCCCTGGGTCTTTGCAGAGG - Intronic
904295242 1:29516054-29516076 CCCCGCCTTGGGCACTGAAGTGG + Intergenic
904382193 1:30119143-30119165 GCCCGCCTGGGGGGCTGCAGTGG + Intergenic
904697151 1:32336921-32336943 CCCCACGTGGGACTTTGCAGTGG - Intergenic
906436972 1:45804145-45804167 CCCGGGCTGGAGCTTTGGAGGGG + Intronic
906590391 1:47019584-47019606 CCCAGACTGGGGTGTTGCAGTGG - Intergenic
907469534 1:54664366-54664388 CCCACCCTGGGGCTCTGCAAAGG - Intronic
908420285 1:63952522-63952544 CCATGCCTGGGGCCCTGCAGTGG - Intronic
908780477 1:67685733-67685755 CCCCGCCGGGGCCTTTGCAAAGG + Intronic
909185312 1:72479771-72479793 CCTCCCCTGAGGCTCTGCAGGGG + Intergenic
914423953 1:147556995-147557017 CCCTGCCTGAGGATGTGCAGTGG - Intronic
915281647 1:154826649-154826671 CCTCCCCTGAGGCTGTGCAGAGG + Intronic
916592414 1:166205216-166205238 CACCCCCTGAGCCTTTGCAGAGG + Intergenic
923554128 1:234987325-234987347 CCCTGCCTAGGGCTTTGCTGGGG - Intergenic
1063402873 10:5764486-5764508 CCCAGCTTGGGCCTTTGCATGGG + Intergenic
1064038436 10:11935998-11936020 CCCCGCCTGGGGCTTGCTTGTGG + Intronic
1067528697 10:47054996-47055018 CCACTCCTGGGGCTTTGGAAGGG + Intergenic
1067660951 10:48235830-48235852 CCACACATGGGGCTCTGCAGGGG + Intronic
1067667003 10:48287568-48287590 CCACAGCTGGGGCTGTGCAGAGG + Intergenic
1069557364 10:69407021-69407043 GCCCACCTGGGGCTGGGCAGTGG + Intronic
1069569733 10:69487063-69487085 GCCAGCCTGCGGCTTTCCAGGGG + Intronic
1069660547 10:70120834-70120856 CCTCTCCTGGGGCTTTTCACGGG - Intronic
1069910906 10:71758555-71758577 CCCAGCTTGGGGCAGTGCAGTGG - Intronic
1070458493 10:76641827-76641849 CTCTGCCTGGGTCCTTGCAGAGG - Intergenic
1071818227 10:89253976-89253998 CTGCCCCTGTGGCTTTGCAGGGG + Intronic
1073444411 10:103571996-103572018 CCAGGCCCGTGGCTTTGCAGTGG + Intronic
1075002584 10:118809307-118809329 TCTCGCCAGTGGCTTTGCAGGGG + Intergenic
1075048774 10:119166339-119166361 CCCCGCCTGGCCCTGTGCTGGGG - Intergenic
1076409607 10:130236572-130236594 TCCCGCCTGGAGTTGTGCAGAGG - Intergenic
1076472540 10:130728987-130729009 GCCCGCCAGGGGCTCTGGAGAGG + Intergenic
1076837064 10:133026389-133026411 CTCCAGCGGGGGCTTTGCAGAGG + Intergenic
1076967245 11:100454-100476 CCACCCCTGTGGTTTTGCAGGGG + Intergenic
1077014090 11:392383-392405 GCCCACCTGGGGCCCTGCAGGGG - Intergenic
1077048265 11:555564-555586 CCGCGCCTGGGGCGGGGCAGGGG + Intronic
1077142305 11:1029991-1030013 CACCGCCCGTGGGTTTGCAGGGG + Intronic
1077306340 11:1870299-1870321 CCCATCCTGGGGCTTGGCAGGGG + Intronic
1077979504 11:7285936-7285958 CCACCCCTGTGGCTTTGCAGGGG + Intronic
1078062029 11:8054414-8054436 CCCCTCCTTGGGCCTGGCAGGGG + Intronic
1079296903 11:19241947-19241969 GCCGGCCTGGGGCTGGGCAGGGG - Intergenic
1084653449 11:70502127-70502149 CACAGCCTGGTGCTTTGCAAAGG + Intronic
1085387109 11:76163715-76163737 CCCCGCCAGGGGCCTTGGTGAGG - Intergenic
1085396440 11:76209267-76209289 GGCCGCCTGGGGCTGTGCACAGG + Intronic
1089453500 11:118612502-118612524 GCCAGCTTGGGGCTTTGCATAGG + Intronic
1089556872 11:119319943-119319965 TCCGGCCTGGGTCTTTGGAGGGG + Intronic
1091267380 11:134281822-134281844 CCCCCGATGGGGCTGTGCAGAGG + Intronic
1091275141 11:134344831-134344853 CCCCCGATGGGGCTGTGCAGAGG + Intronic
1095623272 12:44283374-44283396 CCGCCCCTGTGACTTTGCAGTGG - Intronic
1095812174 12:46383234-46383256 GCCAGCCTGGGGCGCTGCAGCGG + Intergenic
1096519433 12:52175883-52175905 CCCTGGCTGGGGCTTGGCTGGGG + Intronic
1096959960 12:55568081-55568103 CCACCCCTGTGGCTTTGTAGGGG - Intergenic
1099202125 12:79690077-79690099 CCCCGCGGGGGGCTTCCCAGCGG + Exonic
1099674611 12:85742753-85742775 CCACTCTTGTGGCTTTGCAGGGG + Intergenic
1101576504 12:106002004-106002026 CCACCCCTGGGGCTTTGCATGGG - Intergenic
1104870829 12:131994294-131994316 CCCCACCTGGGGGCCTGCAGGGG - Intronic
1104965264 12:132506101-132506123 CCCTGTCTGGGGCTGAGCAGGGG + Intronic
1104987321 12:132604237-132604259 CCCCGCCCGGGACTTACCAGGGG + Exonic
1105899866 13:24745112-24745134 GCCTCCCTGGCGCTTTGCAGGGG - Intergenic
1106614780 13:31316304-31316326 CCACCCCTGTGGCTCTGCAGGGG - Intronic
1114066318 14:19062211-19062233 CGCCCCCTGGGGCTGGGCAGAGG + Intergenic
1114083139 14:19218823-19218845 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1114095950 14:19337813-19337835 CGCCCCCTGGGGCTGGGCAGAGG - Intergenic
1117609520 14:57468017-57468039 CCCTGGATGGGGCTTTTCAGTGG + Intergenic
1118319651 14:64745742-64745764 ACCCGACTGGGGCTCTTCAGAGG + Exonic
1119405276 14:74394963-74394985 CCCTGCCTGGGCTTTTGCACTGG - Intergenic
1119690780 14:76670667-76670689 CCCAGGCTGGAGTTTTGCAGTGG + Intergenic
1121493318 14:94375499-94375521 CCTCGCCTAGGAGTTTGCAGGGG - Intergenic
1122179777 14:99946673-99946695 GCCCTCCTGGGGCGTTCCAGGGG + Intergenic
1122945601 14:105007270-105007292 GCCCGGCAGGGGCCTTGCAGAGG - Intronic
1123007913 14:105333305-105333327 CCCCGCCTGGGGCAGGCCAGGGG - Intronic
1123047995 14:105527736-105527758 CCAGGCCTGGGGCTGTGGAGGGG + Intronic
1202894762 14_GL000194v1_random:591-613 CCCCACAAGGGGCTGTGCAGTGG + Intergenic
1128257898 15:66212037-66212059 CCCTGCCTGGGCCCTGGCAGTGG - Intronic
1128580659 15:68807477-68807499 CCTCGCCTGGAGCTGTGAAGCGG - Intronic
1128705943 15:69837560-69837582 CCCAGGCTGGAGCTGTGCAGGGG + Intergenic
1129614234 15:77085069-77085091 CCCCTCCCAGGGCTTTGGAGGGG - Intergenic
1130988474 15:88860327-88860349 CCCCGCCAGGTCCTGTGCAGAGG + Exonic
1132222371 15:100114562-100114584 CCACGCTCGGGGCTTTGCACAGG - Intronic
1132440930 15:101863381-101863403 CCACCCCTGTGGTTTTGCAGGGG - Intergenic
1132499976 16:280867-280889 CCCCGGCTGGGGTCTGGCAGGGG + Intronic
1132663287 16:1070955-1070977 GCCCGCCTGGGACGCTGCAGAGG - Intergenic
1132745210 16:1433592-1433614 CCCCTCCAGGGGCTCTGCTGGGG - Intergenic
1132868646 16:2105778-2105800 CCCTGCCTGGAGCTTTGCAGAGG - Intronic
1133225352 16:4338075-4338097 TTCTACCTGGGGCTTTGCAGGGG - Exonic
1133439685 16:5810464-5810486 CCCAGCCTGGTGCTTTGTAATGG + Intergenic
1134410553 16:14000270-14000292 CCCCGCCGGGGGCTGGGAAGGGG - Intergenic
1134522942 16:14926881-14926903 CCCTGCCTGGAGCTTTGCGGAGG + Intronic
1134549684 16:15133177-15133199 CCCTGCCTGGAGCTTTGCGGAGG - Intronic
1134710610 16:16325532-16325554 CCCTGCCTGGAGCTTTGCGGAGG + Intergenic
1134718780 16:16369820-16369842 CCCTGCCTGGAGCTTTGCGGAGG + Intergenic
1134948992 16:18343113-18343135 CCCTGCCTGGAGCTTTGCGGAGG - Intergenic
1134955976 16:18382339-18382361 CCCTGCCTGGAGCTTTGCGGAGG - Intergenic
1136381544 16:29898319-29898341 CCAACCCTGGGGCTCTGCAGAGG + Intronic
1137053997 16:35734835-35734857 CTCCGCCTGGGGCCTTCCTGTGG + Intergenic
1138141963 16:54576447-54576469 TCCTGCCTGGGGCTAGGCAGAGG + Intergenic
1138599802 16:58047640-58047662 CCCTGCCTGAGGACTTGCAGAGG - Intergenic
1141638474 16:85328229-85328251 CCCCGTCTGGGGGCTTGCTGTGG - Intergenic
1142353276 16:89589503-89589525 CCTGGCCTGGGGCTTGGGAGAGG + Intronic
1144677777 17:17172886-17172908 CCCTTCCTGTGTCTTTGCAGAGG + Intronic
1144833972 17:18147356-18147378 GCCTGCCTGGGGCTTTCCTGAGG + Intronic
1144955744 17:19018027-19018049 GCCCGCCTGGGCCTTTGATGAGG + Intronic
1147446041 17:40475893-40475915 CCCAGCCTGGGGGCTGGCAGAGG - Exonic
1149994315 17:61399068-61399090 CCCCGCCCTGAGCTTTCCAGCGG - Intergenic
1150382915 17:64734615-64734637 CCCGGGCTTGTGCTTTGCAGTGG - Intergenic
1151772994 17:76177245-76177267 CCCCGCCTTGGGCTGTGGATCGG + Intronic
1152214177 17:79022968-79022990 CCCAGCCTGGGGCAAGGCAGTGG + Intronic
1152273761 17:79341812-79341834 CCTGGCTTGGGGGTTTGCAGGGG - Intronic
1152509066 17:80772890-80772912 ACTCGCCTGGGGCTGTACAGGGG + Intronic
1152628994 17:81401330-81401352 CCCTGCCTGGGCCTTTGGCGAGG + Intronic
1152942926 17:83181950-83181972 CCACGCCTGGGGGGGTGCAGGGG + Intergenic
1153712231 18:7811309-7811331 CCCAGCAAGGGGCTTTGCATAGG + Intronic
1154499839 18:14990498-14990520 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1157856678 18:51110661-51110683 CCCAGCCTCGGGCTCTGCACAGG - Intergenic
1159149741 18:64505586-64505608 TCCACCCTGTGGCTTTGCAGGGG - Intergenic
1159452740 18:68623540-68623562 CCCCCTCTTGGCCTTTGCAGTGG + Intergenic
1160222161 18:76985340-76985362 CCCGGCCTGCGCCTTTGCTGGGG + Intronic
1160316631 18:77854004-77854026 CCCAGGCTGGGGCTATGCTGGGG + Intergenic
1160387759 18:78506820-78506842 GGCCGCCTTGGGCTTTACAGAGG - Intergenic
1160644048 19:170077-170099 CCACCCCTGTGGTTTTGCAGGGG + Intergenic
1160772037 19:836652-836674 ACACGCTGGGGGCTTTGCAGGGG - Intergenic
1161014214 19:1975517-1975539 GCCCGCCTGGTGCTGTGCCGCGG - Intronic
1161237399 19:3204776-3204798 CCCCTCCTAGGGCTTTCCTGGGG + Intronic
1161775499 19:6260029-6260051 CCACGCTTGGGGCCTTCCAGAGG + Intronic
1161978589 19:7619331-7619353 CGCTGCCTGGGGCCTTGGAGTGG - Intergenic
1162741797 19:12777798-12777820 CCCCGGCTGGGGCGGTGGAGCGG + Intronic
1163288860 19:16365621-16365643 CCCAGCCTGTGGGTTTGCAGGGG + Intronic
1163478438 19:17540202-17540224 TCCCACCTGGGTCTTTGTAGGGG - Intronic
1165407128 19:35637771-35637793 CCCCGCCTGGGTGTTTGCCTGGG - Intergenic
1165898719 19:39158453-39158475 CCTCGCCTGAGGCTGGGCAGGGG - Intronic
1166051343 19:40262448-40262470 CCCAGCATGGGGCGTGGCAGAGG + Intronic
1166966848 19:46534061-46534083 CTCAGCCTGGGTCTTTGAAGCGG - Intronic
1167720781 19:51178888-51178910 CCCTGCCTGGGTCTTCCCAGGGG + Intergenic
1202647660 1_KI270706v1_random:157103-157125 GCCCGCCTGGGTCTGTGCTGAGG + Intergenic
925189711 2:1873043-1873065 TCCTGCCTTGGCCTTTGCAGAGG + Intronic
927150568 2:20193062-20193084 ACCCGAATGGGGATTTGCAGAGG + Intergenic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932413396 2:71560144-71560166 CCCTGCCTTGGGCTTTCCTGAGG + Intronic
936091822 2:109506494-109506516 CCTCCCCTGGGGCCTTGCAGAGG + Intergenic
936788612 2:116124365-116124387 CCGCCCCTGTGGCTTTGCAGGGG - Intergenic
937079084 2:119127502-119127524 CCTAGCCTGGAGCTTTGGAGAGG + Intergenic
938236081 2:129708357-129708379 CCCTGCCTGGTGCTCTGCGGTGG - Intergenic
938499050 2:131820853-131820875 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
940484151 2:154275847-154275869 CCATTCCTGTGGCTTTGCAGGGG - Intronic
945292208 2:208137613-208137635 CCCTGCCAGGGGCCTTGCTGAGG + Intergenic
946024669 2:216664674-216664696 CCCTGCCTGGCGCTGTACAGGGG + Intergenic
946230217 2:218286677-218286699 CCCCGGCTGGGGCTCTCCTGGGG + Exonic
946314147 2:218898289-218898311 CTCCGCCTGCGGGTCTGCAGGGG + Intronic
946575510 2:221071475-221071497 CTACCCCTGTGGCTTTGCAGGGG + Intergenic
947373754 2:229474746-229474768 GCGAGTCTGGGGCTTTGCAGTGG - Intronic
948489311 2:238302283-238302305 CCCCTTCTGGGGCTTTCCATTGG - Intergenic
948698236 2:239744852-239744874 TCTGGCCTGGGGCTGTGCAGGGG + Intergenic
948704232 2:239779239-239779261 ATCTGCCTGGGGCTGTGCAGTGG + Intronic
948857270 2:240735908-240735930 CCCTGCCTGTGGCCTTCCAGAGG - Intronic
1170570926 20:17632222-17632244 CACAGCCTGGGGCTGGGCAGAGG - Intronic
1171201257 20:23244263-23244285 CCCCGCCTGCAGCTCTGCTGTGG - Intergenic
1171782035 20:29427960-29427982 CCCCGCCAGGGGCAGGGCAGGGG - Intergenic
1171881423 20:30620445-30620467 CCCCACCTGGGGGTGTGCTGAGG + Intergenic
1173249029 20:41354875-41354897 CCCCTATTGGGGCTCTGCAGGGG + Intronic
1173670326 20:44794327-44794349 CCCAGCCTGGGCCTTTTCTGGGG + Intronic
1174353180 20:49982548-49982570 CCCCGCCTCGGGCTTGGGAGGGG - Intergenic
1175284496 20:57828931-57828953 CCATGCCTGGGGCTGTCCAGCGG - Intergenic
1175891878 20:62319322-62319344 CCCAGCCTGGGGGTCGGCAGGGG - Intronic
1176199466 20:63854001-63854023 CACTGCCTGGGACTTTCCAGGGG + Intergenic
1176604200 21:8815657-8815679 GCCCGCCTGGGTCTGTGCTGAGG - Intergenic
1176614461 21:9016578-9016600 CCCCACAAGGGGCTGTGCAGTGG + Intergenic
1176710742 21:10147293-10147315 CCCCACAAGGGGCTGTGCAGTGG - Intergenic
1178395052 21:32235671-32235693 ACTCGCCTTGGCCTTTGCAGGGG - Intergenic
1178878841 21:36432783-36432805 GCCCGTGTGGGGCTTTGCACAGG + Intergenic
1179613322 21:42566175-42566197 CCCCTCCTGGGGCCTTGGTGGGG + Intronic
1179821633 21:43940433-43940455 CCCTGCCTAGCCCTTTGCAGGGG + Intronic
1180048709 21:45321493-45321515 CACCGCCTGAGGCTCAGCAGGGG - Intergenic
1180103535 21:45601687-45601709 CCCCACCTGGGACCTGGCAGGGG + Intergenic
1180294834 22:10874444-10874466 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1180346491 22:11707264-11707286 GCCCGCCTGGGTCTGTGCTGAGG - Intergenic
1180354254 22:11825388-11825410 GCCCGCCTGGGTCTGTGCTGAGG - Intergenic
1180384001 22:12166967-12166989 GCCCGCCTGGGTCTGTGCTGAGG + Intergenic
1180484796 22:15784802-15784824 CGCCCCCTGGGGCTGGGCAGAGG + Intergenic
1180497640 22:15903858-15903880 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1180721369 22:17911129-17911151 CCCCGCATGGGCCTTGGCTGTGG + Intronic
1181023910 22:20117062-20117084 CCCCGCCTGGGGCGAAGCCGGGG - Exonic
1182421482 22:30250738-30250760 CCAACCCCGGGGCTTTGCAGGGG - Intergenic
1182586314 22:31346080-31346102 CCCCGGCTCGCGCTTTGCAGGGG - Exonic
1182598816 22:31443697-31443719 CCCCACGTGGGTCTTTGCACCGG - Intronic
1184254394 22:43278854-43278876 ACCCTCCTGGAGCTTTGCTGTGG - Intronic
1184363100 22:44030513-44030535 CCCTTGCTGGGGCTTGGCAGGGG + Intronic
1184648588 22:45909238-45909260 CACTGGGTGGGGCTTTGCAGGGG - Intergenic
1184738563 22:46413351-46413373 CCCTGCCTGGAGTTGTGCAGTGG + Intronic
953498312 3:43407864-43407886 GCCCACGTGGGGCTTTGCAGGGG + Intronic
959569509 3:107867979-107868001 CCCTGCCTAGGGCTTTGCCTGGG - Intergenic
961468103 3:127093566-127093588 CCCAGCCCGGGGCCTCGCAGAGG - Intergenic
961627229 3:128272467-128272489 CCCAGGCTGGAGGTTTGCAGAGG + Intronic
961679320 3:128588365-128588387 CACCGGCTGGGGCTCTGCAGGGG + Intergenic
962406078 3:135101214-135101236 CCCAGCTTTGGACTTTGCAGGGG - Intronic
964457076 3:156880188-156880210 CCGCCCCTGTGGCTTTGCAGGGG - Intronic
965538336 3:169848044-169848066 CCCCACCTGGTGCTTTGCAGGGG + Intronic
967685019 3:192408899-192408921 CGCCGGCTGCGGCTTTCCAGGGG + Exonic
968432911 4:569178-569200 CCCCACCATGGGCTTGGCAGCGG - Intergenic
968501732 4:953303-953325 CCCGGCCCTGTGCTTTGCAGCGG + Exonic
968514659 4:1011182-1011204 CCCGGCCCGGGGCTGCGCAGAGG + Exonic
968619857 4:1599179-1599201 CCCCGCCCGGGACTTCGCCGAGG + Intergenic
969107796 4:4820977-4820999 CTCTGCATGGGGCTTTGCACAGG - Intergenic
969264795 4:6057394-6057416 CCCAGCCTGGTGCTTGGGAGGGG - Intronic
971385790 4:26139534-26139556 TCCCCCCTGGGGCTGTGCTGAGG + Intergenic
972725725 4:41745545-41745567 ACCTGCCTGGGGCCTCGCAGCGG - Exonic
973012418 4:45093279-45093301 CTACCCCTGTGGCTTTGCAGGGG + Intergenic
973373918 4:49275292-49275314 GCCCGCCTGGGTCTGTGCTGAGG + Intergenic
973383494 4:49334947-49334969 GCCCGCCTGGGTCTGTGCTGAGG - Intergenic
973387099 4:49519961-49519983 GCCCGCCTGGGTCTGTGCTGAGG - Intergenic
974843456 4:67323714-67323736 CCACCCCTGTGGCTTTGCAGGGG - Intergenic
976444860 4:85118361-85118383 CCACCCCTGAGGCTTTGCAGGGG - Intergenic
977458888 4:97299559-97299581 CCCCACCTTGGGATTTGCTGTGG - Intronic
979102542 4:116638776-116638798 CACAGCCTAGGGCTCTGCAGGGG + Intergenic
979610262 4:122682235-122682257 CCACCCCTGTGGCTCTGCAGGGG - Intergenic
980225071 4:129972445-129972467 CCCCACCTGGAGCATTTCAGTGG - Intergenic
982478310 4:155878821-155878843 CTGCCCCTGTGGCTTTGCAGGGG + Intronic
985795616 5:1959758-1959780 CCCCGCCTGGGGCTGAACAAAGG + Intergenic
985896820 5:2753594-2753616 CCCCCGCTGGGTCGTTGCAGGGG - Intronic
986780280 5:11058772-11058794 TCACCCCTGTGGCTTTGCAGGGG - Intronic
990291307 5:54354609-54354631 CCACCCCTGTGGCTTTGCAAGGG - Intergenic
995251113 5:109994249-109994271 ATCCCTCTGGGGCTTTGCAGAGG + Intergenic
995762478 5:115577938-115577960 CCCACCCTGGAGCTTTACAGGGG - Intergenic
996284314 5:121770447-121770469 CCACCCCTGCAGCTTTGCAGAGG - Intergenic
997899971 5:137754880-137754902 TCCCGCCCAGGGCTTTGCCGGGG + Intergenic
1000768279 5:165318842-165318864 CCACCCGTGTGGCTTTGCAGGGG + Intergenic
1001493780 5:172173752-172173774 CCCTTCCTGGGGCTTGACAGAGG - Intronic
1002523352 5:179803277-179803299 TCCCGCCAGGGGCTGTCCAGAGG - Intronic
1002537992 5:179888759-179888781 CCAGGCCTTGGGCTCTGCAGAGG - Intronic
1002732874 5:181354702-181354724 CCACCCCTGTGGTTTTGCAGGGG - Intergenic
1002751664 6:119402-119424 CCACCCCTGTGGTTTTGCAGGGG + Intergenic
1002909585 6:1479246-1479268 CCACGCCTGCTCCTTTGCAGGGG - Intergenic
1007380931 6:41489688-41489710 CCCTGCCTGGGGCTGGGCTGGGG - Intergenic
1007811813 6:44491678-44491700 CCCATCCTGAGGCTATGCAGGGG - Intergenic
1010294768 6:74182990-74183012 CCCCCTCTGGGGCTTTGGGGTGG + Intergenic
1013146939 6:107403329-107403351 CAGCCCCTGTGGCTTTGCAGAGG + Intronic
1016879228 6:148894543-148894565 TCCTGCCTGGGGGTTTGGAGGGG - Intronic
1019303802 7:322788-322810 CCAGGCCTGGGGCCTTGCTGGGG + Intergenic
1019364708 7:627462-627484 CCACGCCTGAGGGTTTGCAAAGG + Intronic
1019518098 7:1448402-1448424 CACAGCCTGGGGCTTTGCATGGG + Intronic
1023333731 7:39146648-39146670 CCCTCCCTGGGGCCTTGAAGGGG - Intronic
1029613813 7:101643913-101643935 CCCCTTCTGGTGCTTTGCTGGGG - Intergenic
1032192325 7:129772113-129772135 ACCCGCCTGAGGCTGGGCAGAGG + Intergenic
1033546379 7:142405166-142405188 CCCCGCCTGCGGTTTGGCCGTGG - Intergenic
1034337103 7:150330768-150330790 AGACCCCTGGGGCTTTGCAGGGG - Exonic
1034851965 7:154501927-154501949 CCACTCCTGTGGCTCTGCAGGGG - Intronic
1034976915 7:155454225-155454247 CGGCGCCTGGGGCTTGGCTGCGG + Intergenic
1035510642 8:179588-179610 CCACCCCTGTGGTTTTGCAGGGG + Intergenic
1035658886 8:1331969-1331991 CCCACCCTGGGGCTGTTCAGGGG - Intergenic
1036652706 8:10655310-10655332 CACAGCCTGGGGGCTTGCAGGGG + Intronic
1037512478 8:19597970-19597992 CCCAGCCTGGGGCTCAGCAAAGG + Intronic
1037817751 8:22120785-22120807 CTCCCCCAGGGGCTTTGCTGTGG - Exonic
1038402796 8:27298260-27298282 CCACGCCTGGGTCTTTAGAGGGG + Intronic
1038426778 8:27469024-27469046 CCCCCCGTGGGGCTTTGGGGAGG + Intronic
1040304750 8:46206238-46206260 CCCCGCCTGGGACTGTCCTGGGG - Intergenic
1043222731 8:77687280-77687302 CCTCCCCTGTGGCTTTGCAGAGG - Intergenic
1048971190 8:139645757-139645779 CACCGCTTGGGGCCTTGCACGGG - Intronic
1049003925 8:139843010-139843032 CCAGGCCTGGGGCTGGGCAGTGG - Intronic
1049462303 8:142735803-142735825 CCCTGCCTCGGCCCTTGCAGTGG - Exonic
1049766631 8:144358196-144358218 CCCGGCCTTGGGCTTGGCCGCGG + Exonic
1049791821 8:144475740-144475762 TCCCGCATGGGGCCCTGCAGCGG - Exonic
1051382311 9:16471038-16471060 CCGCCCTTGTGGCTTTGCAGGGG - Intronic
1052774515 9:32720004-32720026 ACCAGCCTGAGGCCTTGCAGGGG - Intergenic
1053647725 9:40132989-40133011 CCCCACAAGGGGCTGTGCAGTGG - Intergenic
1053758006 9:41330854-41330876 CCCCACAAGGGGCTGTGCAGTGG + Intergenic
1054333307 9:63781483-63781505 GCCCGCCTGGGTCTGTGCTGAGG + Intergenic
1054351069 9:64017101-64017123 GCCCGCCTGGGTCTGTGCTGAGG - Intergenic
1054536854 9:66243181-66243203 CCCCACAAGGGGCTGTGCAGTGG + Intergenic
1055393175 9:75845397-75845419 ACCAGCGTGAGGCTTTGCAGTGG - Intergenic
1056275202 9:84988000-84988022 GCCCCCATGGGGCTCTGCAGGGG + Intronic
1056811798 9:89770950-89770972 ACCAGCCCAGGGCTTTGCAGCGG + Intergenic
1056834651 9:89944669-89944691 CACCCCCCTGGGCTTTGCAGAGG - Intergenic
1057817037 9:98303532-98303554 CCCAGCCTGTGGCTTTCCTGGGG - Intronic
1057850840 9:98565705-98565727 CCTGGTCTGGGGCTTGGCAGTGG - Intronic
1059407115 9:114108205-114108227 CCCCTCCTGGGGCTGGGCACTGG - Intergenic
1060522617 9:124302255-124302277 CCCAGCCTAGAGCTTGGCAGAGG - Intronic
1061314182 9:129783972-129783994 CCTCGCCAGGGGCTTGGCCGAGG - Intergenic
1061389927 9:130311803-130311825 CCCCGCCTGGGGAGCTGCGGAGG + Intronic
1061487476 9:130927624-130927646 CCCCGGCTGGGGGGCTGCAGGGG + Intronic
1061488792 9:130934002-130934024 CACATCCTGGGGCTTTGCACTGG + Intronic
1062472896 9:136713993-136714015 CCTGGGCTGGGGCTTTGCAGGGG - Intronic
1062627166 9:137448536-137448558 ACAGGCCTGGGGCTTGGCAGGGG - Exonic
1062757280 9:138307028-138307050 CCACCCCTGTGGTTTTGCAGGGG - Intergenic
1202795502 9_KI270719v1_random:116281-116303 CCCCACAAGGGGCTGTGCAGTGG - Intergenic
1203697617 Un_GL000214v1:113262-113284 GCCCGCCTGGGTCTGTGCTGAGG + Intergenic
1203551597 Un_KI270743v1:167754-167776 GCCCGCCTGGGTCTGTGCTGAGG - Intergenic
1190473023 X:50801432-50801454 CCCCACCTGGGTCTTAGCAGTGG + Intronic
1192266534 X:69542513-69542535 CCTGGCCTGGAGCTTTGCACAGG - Intergenic
1192865960 X:75132313-75132335 CCCTGCCTGGTGCTGGGCAGAGG - Intronic
1193509120 X:82377895-82377917 CCCCTACTGGGGCAATGCAGAGG - Intergenic
1194474027 X:94335940-94335962 CCACCCCTGTGGCTTTGCAGGGG - Intergenic
1194893327 X:99407057-99407079 CCCTGCCTGTGGCTTTGTAGGGG - Intergenic
1195942412 X:110176950-110176972 CCCAGCCTGGGGCCTTGCCAAGG - Exonic
1197385548 X:125796627-125796649 CCACCACTGTGGCTTTGCAGGGG - Intergenic
1197623942 X:128781813-128781835 CCCTGCCTGGTGATTAGCAGTGG - Intergenic
1198205615 X:134461624-134461646 CCCCGCCAGGGGCCATGCAAGGG - Intronic
1200069526 X:153521133-153521155 CCCAGCCCGGGGCGTTGCTGGGG - Intronic