ID: 900605501

View in Genome Browser
Species Human (GRCh38)
Location 1:3521846-3521868
Sequence ACCCCCTTCCTGGCACTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900605501_900605510 12 Left 900605501 1:3521846-3521868 CCAGAGAGTGCCAGGAAGGGGGT 0: 1
1: 0
2: 2
3: 27
4: 272
Right 900605510 1:3521881-3521903 CAAGCAGGGTGGCCTAGAAATGG 0: 1
1: 0
2: 0
3: 15
4: 184
900605501_900605506 -2 Left 900605501 1:3521846-3521868 CCAGAGAGTGCCAGGAAGGGGGT 0: 1
1: 0
2: 2
3: 27
4: 272
Right 900605506 1:3521867-3521889 GTCTGGATGGTGCCCAAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 154
900605501_900605505 -3 Left 900605501 1:3521846-3521868 CCAGAGAGTGCCAGGAAGGGGGT 0: 1
1: 0
2: 2
3: 27
4: 272
Right 900605505 1:3521866-3521888 GGTCTGGATGGTGCCCAAGCAGG 0: 1
1: 0
2: 0
3: 46
4: 473
900605501_900605512 14 Left 900605501 1:3521846-3521868 CCAGAGAGTGCCAGGAAGGGGGT 0: 1
1: 0
2: 2
3: 27
4: 272
Right 900605512 1:3521883-3521905 AGCAGGGTGGCCTAGAAATGGGG 0: 1
1: 0
2: 0
3: 20
4: 179
900605501_900605511 13 Left 900605501 1:3521846-3521868 CCAGAGAGTGCCAGGAAGGGGGT 0: 1
1: 0
2: 2
3: 27
4: 272
Right 900605511 1:3521882-3521904 AAGCAGGGTGGCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 22
4: 168
900605501_900605507 1 Left 900605501 1:3521846-3521868 CCAGAGAGTGCCAGGAAGGGGGT 0: 1
1: 0
2: 2
3: 27
4: 272
Right 900605507 1:3521870-3521892 TGGATGGTGCCCAAGCAGGGTGG 0: 1
1: 0
2: 6
3: 32
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900605501 Original CRISPR ACCCCCTTCCTGGCACTCTC TGG (reversed) Intronic
900142901 1:1145928-1145950 ACTGCCTTCCTGGCACCCTCTGG + Intergenic
900605501 1:3521846-3521868 ACCCCCTTCCTGGCACTCTCTGG - Intronic
900807475 1:4776840-4776862 ACCCCCTCCCTGTGGCTCTCAGG + Intronic
901585097 1:10283451-10283473 AGCCCCTTGCTGGCTCTGTCAGG + Intronic
902465838 1:16618075-16618097 ACTCCCTTCCTTACCCTCTCCGG + Intergenic
904805055 1:33125252-33125274 ACCCTCTTCCTGGCACCTTTAGG + Intergenic
905224115 1:36468025-36468047 ACCCCCTTCCAGGCCTTCTGGGG + Intronic
905704008 1:40040700-40040722 ACCCACTTCCGGGCCCTCACTGG - Exonic
905887420 1:41498921-41498943 ACACAATTCCTGGCACTCACGGG + Intergenic
905900047 1:41575379-41575401 ATCACCTTCCTGGGACTCTCAGG - Intronic
906273620 1:44500412-44500434 ACTCCCCACCTGGCACTCTCTGG + Intronic
908205415 1:61843071-61843093 CACCACTTCCTGGCACTCACTGG - Intronic
909852006 1:80478421-80478443 ACCCTCTTCCTCTCACTCTGAGG - Intergenic
914460268 1:147877434-147877456 ACCACCCTCCTGGCACCTTCAGG + Intergenic
915555514 1:156658731-156658753 TGCCTCTTCCTGGCACTCACAGG - Exonic
915952709 1:160200184-160200206 ATTCCCTCCCTGGCACTCCCAGG + Intronic
917086736 1:171311418-171311440 ACCCCTTTCCAGCCACTCACCGG + Intergenic
922763842 1:228147720-228147742 ACTCCCCTCCTGGCATTCCCTGG - Intronic
922790694 1:228309311-228309333 ATCCCCATCCTGGTACACTCAGG - Intronic
1063371882 10:5527532-5527554 CACCCCTCCCTGCCACTCTCAGG + Intergenic
1063795605 10:9511233-9511255 CCCACCTTGATGGCACTCTCAGG + Intergenic
1066613800 10:37276847-37276869 ACCCCTTTCCAGTCACTCACTGG - Intronic
1068966296 10:62915246-62915268 GTCTCCTTTCTGGCACTCTCAGG + Intronic
1070284965 10:75076222-75076244 CCACCCTTGCTGGCACTCTCTGG + Intergenic
1070346028 10:75542876-75542898 GGCCCCTTCCTGCCACTGTCCGG + Intronic
1070605975 10:77898757-77898779 ACCGCCTGCCTGGCCCTCTCAGG - Intronic
1070677314 10:78420988-78421010 ACTGCCTTCCTGGCTCTCCCAGG + Intergenic
1070775988 10:79110098-79110120 ACCCCCATGCTGCCACCCTCTGG + Intronic
1071943418 10:90613577-90613599 ACTCGCTACCTGGCACTATCTGG + Intergenic
1073230008 10:101961141-101961163 ATCGCCTTCCTGTCACTCACTGG + Intronic
1074772139 10:116741654-116741676 ACCCCCTTCCCCGTCCTCTCCGG + Intronic
1075238561 10:120756307-120756329 TAACCCTTCCTGGTACTCTCTGG + Intergenic
1077146982 11:1050751-1050773 ACCTCCTGCCTGGCCCTCCCAGG - Intergenic
1077443377 11:2578963-2578985 ACACCCCAGCTGGCACTCTCAGG - Intronic
1081800824 11:45858183-45858205 TCCCCTTTCCTGACTCTCTCAGG + Intronic
1082142202 11:48622378-48622400 ATCCCTTTGCTGGCACTCTACGG - Intergenic
1083639586 11:64138282-64138304 ACCCCCTCCCCGGCACTGCCTGG + Intronic
1083785880 11:64946632-64946654 ACCCTTTTCCTGGGACTCTGTGG - Intronic
1084174353 11:67415786-67415808 CCCCCCTCCCTGGCTCTCCCCGG - Intronic
1084494723 11:69497290-69497312 ACGCCCGGCCTGGGACTCTCAGG - Intergenic
1084765890 11:71308109-71308131 TCCCCATTCCTGGCATCCTCTGG - Intergenic
1084923247 11:72489940-72489962 ACCCCGTTCCTCTCAGTCTCTGG - Intergenic
1085126041 11:74003363-74003385 ACCTCCTCCCTAACACTCTCAGG - Intronic
1090442005 11:126732050-126732072 CCCCCATTCCTGGCACTCGCTGG - Intronic
1091727886 12:2858213-2858235 ACCCACCTTCTGGCAGTCTCTGG + Exonic
1091860366 12:3776103-3776125 TCCCTCTTCCTGGCATGCTCTGG - Intergenic
1091960703 12:4691797-4691819 CCCCCCATCCTGGCCCTCACAGG - Exonic
1095961117 12:47834917-47834939 ATCCCCTCCCTGTCCCTCTCCGG + Intergenic
1096692080 12:53327593-53327615 GCCCCCCTCTTGGCACCCTCTGG + Exonic
1096763670 12:53865120-53865142 AATCCCTTCCTTGCCCTCTCAGG + Intergenic
1098044252 12:66383563-66383585 AGCCCATTCCTGGCTTTCTCTGG + Intronic
1098079586 12:66769851-66769873 CCCACCTTGCTGACACTCTCAGG + Intronic
1098599711 12:72316507-72316529 GCACCCATCATGGCACTCTCAGG + Intronic
1098670627 12:73225778-73225800 ACCCACTACCTGGGATTCTCAGG - Intergenic
1099244701 12:80180751-80180773 ACCCCCTCCTTGACACTGTCAGG - Intergenic
1099377026 12:81904283-81904305 ACCCCTTTCCAGCCACTCACTGG + Intergenic
1101453100 12:104799668-104799690 ACTCACTTCCTGGCAGGCTCAGG + Intergenic
1106409663 13:29502562-29502584 CCCAGCTTCCTGGCAGTCTCAGG + Intronic
1106903899 13:34384918-34384940 ACACTCTTCCTGGAACTGTCAGG + Intergenic
1107828451 13:44351928-44351950 GCCCCCTTCCTGGCCCTCATAGG - Intergenic
1111649601 13:91072743-91072765 ACCTGCTTCCAAGCACTCTCAGG - Intergenic
1113435313 13:110286611-110286633 ACCGCCTTTCTGGCACTCCGGGG - Intronic
1114248465 14:20936101-20936123 AACCCTTTCCTGGAACTCCCAGG - Intergenic
1115754098 14:36516723-36516745 GCCCCCTCCCCGGCACCCTCTGG - Exonic
1118609525 14:67529222-67529244 ATCCGCTGCCTGGCTCTCTCTGG + Intronic
1118999887 14:70872250-70872272 GCCCCCTCCCTGTCACTTTCAGG - Intergenic
1119001882 14:70889718-70889740 ACACCCTACCTGGCACTGGCTGG - Intergenic
1119360125 14:74042290-74042312 AGACCCTCCCTGGCACTGTCAGG + Intronic
1119653982 14:76403670-76403692 TCCACCTCTCTGGCACTCTCAGG - Intronic
1119675513 14:76550708-76550730 ACCCCATTCCTGCCTCTCTTTGG + Intergenic
1119895978 14:78220365-78220387 GCCCCCTTCCTGGCATGTTCGGG - Intergenic
1121099575 14:91241286-91241308 ACCAGCTTCCTGCCACTCACAGG + Intronic
1121174965 14:91884196-91884218 AACTCCTTCCTGTCTCTCTCAGG + Intronic
1121631167 14:95422851-95422873 ACCCCCTTCCTGGGAGTCTTGGG - Intronic
1121736330 14:96220623-96220645 ACCCCCTTTAAGGCCCTCTCTGG + Intronic
1122384560 14:101335075-101335097 ACTAGCTTCCTGGCACTCTAGGG - Intergenic
1122425313 14:101602203-101602225 CCCGCCCTCCTGGCACTCCCAGG + Intergenic
1122969244 14:105145792-105145814 ACCCCCTGCCTGCCACGCTCCGG - Exonic
1124372474 15:29111451-29111473 TAACCCTCCCTGGCACTCTCAGG - Intronic
1125547103 15:40513847-40513869 TCCCCCTTCCAGGGGCTCTCAGG + Intergenic
1127290416 15:57565529-57565551 CCCCACTTCCTTGCTCTCTCAGG + Intergenic
1128377793 15:67089769-67089791 ACCCACTTCCAGGGACTGTCAGG - Intronic
1129271985 15:74423814-74423836 ACCCTCTTCCTGGCCATATCAGG - Intronic
1129361244 15:75025836-75025858 TCACCCTTCCTGGAATTCTCAGG + Intronic
1130929616 15:88414201-88414223 ACCCACTTCCAAGCTCTCTCAGG + Intergenic
1131411758 15:92213359-92213381 ACCCCTTTCCAGCCACTCACTGG + Intergenic
1131829836 15:96347266-96347288 CCCACCTCCCTGGCCCTCTCTGG + Intergenic
1132014974 15:98307545-98307567 ACCTCCTTACTGGAACCCTCAGG + Intergenic
1132661215 16:1062345-1062367 GCACCCTTCCTGGCACCCACTGG + Intergenic
1132854291 16:2037984-2038006 AGCCCCTTCCTGCCTGTCTCGGG + Exonic
1133129178 16:3665693-3665715 GCCCTCTTCCTGCCACTCCCTGG + Intronic
1133156399 16:3879960-3879982 ACCCCCGTCCGGGCCCTCGCCGG - Exonic
1134264688 16:12683120-12683142 ACCCCCTTCTTGGCTTTCCCTGG - Intronic
1134335017 16:13290663-13290685 ACCCCCTGCCTCCCTCTCTCTGG + Intergenic
1135588963 16:23691779-23691801 TCCGCCATCTTGGCACTCTCTGG - Intronic
1137354700 16:47749687-47749709 ACCCCCTTCCAGGAAATCACTGG - Intergenic
1139163455 16:64538584-64538606 ACCCCCTTTCTGGCTCTCTCTGG + Intergenic
1141698163 16:85630188-85630210 ACCTCCTTCCTGGCCCTCTTGGG - Intronic
1142803651 17:2360434-2360456 ACCCTCTTCCTGTCCCTGTCGGG + Intronic
1142851754 17:2707855-2707877 AGCCCCTTCCTGGGAGTCACTGG + Intronic
1143569440 17:7746012-7746034 AACCCTTTCCTGGCATTATCGGG + Intronic
1146318172 17:31825585-31825607 GCACCCTTCCTGGCACACCCAGG - Intergenic
1147120106 17:38330732-38330754 ACCCCCATCTTGGCCCTGTCTGG - Exonic
1147954126 17:44123074-44123096 ACCCCTTTCTTGGTACTCTGAGG - Intronic
1148748312 17:49930744-49930766 ACCCCCTTCCTGCAGGTCTCTGG - Intergenic
1148770307 17:50062596-50062618 ACCCCCTTCCCAGCACCCGCAGG + Intronic
1150059135 17:62049013-62049035 ATCACCATCCTTGCACTCTCAGG + Intronic
1150343311 17:64385964-64385986 ACACCCCTCCTGACACCCTCAGG - Intronic
1151703934 17:75757087-75757109 ACCTCCATCCTGGGACTCTATGG - Exonic
1152794940 17:82302128-82302150 AGGCCCTCCCTGGCACTCCCAGG - Intergenic
1155678446 18:28459266-28459288 AACCCATTCCTGGGACTTTCAGG - Intergenic
1156337336 18:36183395-36183417 ACCCCGATCCAGCCACTCTCAGG + Intergenic
1157425436 18:47580552-47580574 GCCCCCTTCCTGGCCCTCTCAGG - Intergenic
1158601319 18:58858560-58858582 ACCTACTTCCTGTCACTGTCAGG - Intergenic
1159108373 18:64028542-64028564 TCCCCCTCTCTTGCACTCTCTGG + Intergenic
1159182114 18:64921463-64921485 ACCCCTTTCTTGTCACTCTTTGG - Intergenic
1159567166 18:70064666-70064688 CCCCCATTCTTGGCACTCTACGG - Intronic
1161397504 19:4052431-4052453 GCCCCCTGCCTGGCACTCCTGGG + Intronic
1161566301 19:5004713-5004735 ACCGCCTTCCTGCCCCTCTGTGG - Intronic
1161663240 19:5560047-5560069 ACCCCCCTCCAGGCACACCCAGG + Intergenic
1162954145 19:14089187-14089209 ACCCTCTCCTTGGCACTCTGAGG + Exonic
1163935196 19:20436176-20436198 AGCCCATTCCTGGCAGCCTCTGG - Intergenic
1164261381 19:23570939-23570961 GCCCCCTATCTGGAACTCTCTGG + Intronic
1165445587 19:35855388-35855410 TTCCCCTTCCTGGCTCTCTGGGG - Intronic
1166383604 19:42368600-42368622 ACCCCCATCCTGGCCCCCCCAGG - Exonic
1167169650 19:47822609-47822631 ATCACATTCCTGGCTCTCTCGGG - Intronic
1167358446 19:49017667-49017689 ACCCACTTCCGGGGACGCTCCGG - Intergenic
1167359776 19:49023904-49023926 ACCTCCTTCCAGGCAATCACTGG - Intronic
1167363782 19:49044255-49044277 ACCTCCTTCCAGGCAATCACTGG + Intronic
1167364715 19:49048672-49048694 ACCTCCTTCCAGGCAATCACTGG - Intronic
1167374533 19:49103827-49103849 TCCCCTTTCCTGGCAGGCTCAGG + Intronic
1167932176 19:52874845-52874867 TCCCCCTACCTAGGACTCTCTGG - Intronic
1168311528 19:55463358-55463380 ACTCCCTTCCTGGCAGCCCCTGG - Intergenic
925001559 2:406985-407007 ACCCCCTTCCTGACAACCTGCGG + Intergenic
927239823 2:20911475-20911497 ACCCACTGCCTGGCACTCCCCGG + Intergenic
927674103 2:25091806-25091828 TCCCCCTGGCTGCCACTCTCTGG + Intronic
928320754 2:30281335-30281357 AATTCCTTCCTGGCTCTCTCAGG + Intronic
928395399 2:30939758-30939780 AGGCCCTTCCTGCCACACTCTGG + Intronic
928871621 2:35987606-35987628 CCCTCCTTCCTAGCTCTCTCAGG + Intergenic
929924703 2:46198556-46198578 ACCCCCATCCTGGTGCTGTCTGG - Intergenic
932075521 2:68659315-68659337 AACCCCTGTCTGGCCCTCTCTGG + Intergenic
932958461 2:76384038-76384060 ACCCACTTCCTGACATTTTCTGG - Intergenic
935563688 2:104584612-104584634 GCCCACTTGCTGGCAATCTCTGG + Intergenic
936034730 2:109101764-109101786 ACCCCCTGCTCGGCTCTCTCCGG - Intergenic
936914183 2:117623367-117623389 ACCCGCTGTCTGGCACTCCCTGG - Intergenic
937670956 2:124536695-124536717 GCCCCCTCCCTGGCCCGCTCTGG - Intronic
938754107 2:134364069-134364091 AACCACCTCCTAGCACTCTCTGG + Intronic
939852422 2:147317719-147317741 ACCCCTTTCCAGCCACTCACCGG + Intergenic
942563102 2:177241022-177241044 ACCACCTTCCTGTCATTCTCAGG - Intronic
942588939 2:177519727-177519749 ACCCTTTTCCTGTCACACTCTGG - Intronic
946206146 2:218110242-218110264 ACCCCTTTCCAGCCACTCACTGG - Intergenic
947340196 2:229130261-229130283 ACACCCGTCCTTGCATTCTCAGG + Intronic
1169075707 20:2758837-2758859 GCCACCTGCCTGTCACTCTCTGG - Intronic
1170016458 20:11787490-11787512 ACCCCCATCCTGAGGCTCTCTGG - Intergenic
1170715731 20:18829272-18829294 ACCCATTTCCTGGAGCTCTCAGG + Intronic
1171159430 20:22908090-22908112 ACCTCCTGCTGGGCACTCTCAGG - Intergenic
1172272987 20:33664771-33664793 CCCGCCTTCCTGCCACACTCTGG + Intronic
1172442014 20:34972374-34972396 ACCGGCTTCTTGGCACTCTCTGG + Intergenic
1172807426 20:37622521-37622543 CCCCCTTGCCTGGCACTCTCTGG - Intergenic
1173200360 20:40950284-40950306 TCCCCCTTCCTGGAGCTCCCAGG + Intergenic
1173599104 20:44280169-44280191 CCCCCCTTCCTGTCACTCCCGGG + Exonic
1173964342 20:47100426-47100448 AACCCATTCTTGGGACTCTCTGG + Intronic
1179600837 21:42476335-42476357 CTCCCCTGGCTGGCACTCTCAGG - Intronic
1179628993 21:42665366-42665388 ACCCCCATCCTGGCCCTCTGAGG + Intronic
1180008003 21:45032188-45032210 ACCCCCTTCGTGGCCACCTCCGG - Intergenic
1180014010 21:45071263-45071285 ACCCCCTTCCTGTCATGCCCAGG - Intergenic
1180950684 22:19719186-19719208 TCCCGCCCCCTGGCACTCTCCGG + Intronic
1181770245 22:25119905-25119927 TCCCCCTCCCTGGCCCTATCCGG - Intronic
1181944887 22:26508927-26508949 ACCCCCAACCTGGCACACCCTGG + Intronic
1184177127 22:42794801-42794823 ACACCCTTCCTAGCAGGCTCAGG + Intergenic
1185402144 22:50624740-50624762 ACCCCGTTCCTGGCACTCAAAGG + Intronic
950676048 3:14555112-14555134 AGCCCCTTCCTAGCACTCTGAGG + Intergenic
951463758 3:22979055-22979077 AACCACCTCCTGGCACTCTTGGG - Intergenic
952846395 3:37691168-37691190 ACCACATTACTTGCACTCTCAGG - Intronic
952848577 3:37709534-37709556 CTCCCCTTCCTCACACTCTCAGG - Intronic
954466457 3:50658012-50658034 TCCCCCTCCCTACCACTCTCAGG + Intergenic
954689612 3:52388707-52388729 ACCCCCTCCCTGGCAACCCCAGG + Intronic
955414634 3:58680649-58680671 ACCCACTTCCTGGTACAATCTGG + Intergenic
957939719 3:86990451-86990473 TCTCCCTTCCCGGCTCTCTCGGG + Intronic
960158000 3:114317563-114317585 AACCCCTTCATGACACTCTTTGG - Intergenic
961039134 3:123664444-123664466 ACCCCAGACCTGGCACCCTCAGG - Intronic
966693266 3:182762880-182762902 ACCCCCTTCCTGAATCTCTGTGG + Intergenic
968128070 3:196174927-196174949 GCCCACATCCTGGCACTCACAGG + Intergenic
968458341 4:710331-710353 ACGTCCTTCCTGTCCCTCTCTGG - Intronic
968887907 4:3345307-3345329 CCTCCCTTCCTGGCCTTCTCTGG + Intronic
969079150 4:4604821-4604843 ATTCCCTTCCTGTCAATCTCAGG + Intergenic
969504398 4:7575182-7575204 TCACCCATCCTGGCACTCTCTGG + Intronic
969511186 4:7618868-7618890 ACCACCGTCCTGGAAGTCTCGGG + Intronic
969652234 4:8474722-8474744 ACCTCCTTCCTGGTTCTCGCTGG - Intronic
970450196 4:16158559-16158581 ACCTCGTTCCTGGCACACACAGG - Intergenic
970852393 4:20617126-20617148 CCATCCTTCCTGGCACTCGCAGG - Exonic
972168141 4:36312172-36312194 AAACACTTCCTGGCACTTTCTGG - Intronic
973163711 4:47051136-47051158 CCCTCCTTCCTGCCAGTCTCAGG - Intronic
977042792 4:92035710-92035732 ACCCCCTTTCAAGCACTCTGTGG - Intergenic
981696307 4:147562748-147562770 AACCCTTTCCTGCCACTTTCAGG - Intergenic
981856591 4:149301006-149301028 GCCCCCATCCTGACACTATCTGG - Intergenic
982079302 4:151772102-151772124 ACCCCCATGCTGGCACTCCCAGG + Intergenic
983867157 4:172781534-172781556 TACCCTTTCCTGACACTCTCAGG + Intronic
984974126 4:185215315-185215337 ACTCCCTTCCCTGCCCTCTCCGG + Intronic
986285361 5:6354731-6354753 ACCACCTTCCTGGCACGCTGTGG - Intergenic
986588057 5:9339324-9339346 ACATCTTTCCTGTCACTCTCTGG - Intronic
988500962 5:31783376-31783398 GCCCCCTGCCTGGCAAGCTCAGG - Intronic
988789235 5:34592131-34592153 ACCCCCATCCTGGCCTTCGCTGG + Intergenic
990546541 5:56827325-56827347 ACCCACTTCCTAACACTCTGTGG - Intronic
992050146 5:72934101-72934123 ACCCCTTTCCAGCCACTCACTGG + Intergenic
995627028 5:114091145-114091167 ACAGCCTTCCTGGAACTCTAGGG - Intergenic
996385519 5:122906251-122906273 ACCCCATACCTGGCTCACTCTGG + Intronic
999291663 5:150429910-150429932 ACCTCCTGCCTGGCCCTCTGAGG - Intergenic
999992447 5:157061870-157061892 ATCCCTGTCCTGGCTCTCTCTGG - Intergenic
1000781744 5:165491024-165491046 ACCTACTTCCTAGCACTCGCTGG - Intergenic
1001246174 5:170106979-170107001 ATCCTCTTCCTGGCAGTCTTGGG - Intronic
1001817117 5:174678875-174678897 AGCCCCTTCCTGGCCCTGTTTGG - Intergenic
1002140539 5:177134644-177134666 CCCCCCTTCCTGGCTCGCTAGGG - Intronic
1002307596 5:178293006-178293028 ACCCCCCTCCTGTCACTCCCTGG - Intronic
1003125341 6:3351486-3351508 CCCCGCTGCCTGGCACGCTCAGG - Intronic
1005110822 6:22280066-22280088 ACCCCCTTGAAGGCACCCTCTGG + Intergenic
1005851689 6:29827866-29827888 ACCCTCTTCCTGCTGCTCTCGGG + Exonic
1005866623 6:29942575-29942597 ACCCTCCTCCTGCTACTCTCGGG + Exonic
1007030653 6:38623039-38623061 ACCCCTTTCCAGCCACTCACCGG + Intronic
1010095806 6:72043439-72043461 ACCTCCTTCCTCACACTCACAGG - Intronic
1011734340 6:90296633-90296655 TCCCCCTTCCCGGCGCACTCGGG - Exonic
1012561523 6:100586599-100586621 ACCCACTGTCTGGCACTCCCTGG + Intronic
1013538939 6:111088209-111088231 ACCCCCCTGCTCGCACCCTCTGG - Intronic
1014061169 6:117073439-117073461 CCCCTCTTCCTGGCACTGTGTGG + Intergenic
1015571588 6:134626655-134626677 ACCACGTGCCTGGCTCTCTCTGG + Intergenic
1016678049 6:146794335-146794357 ACCCCTTTCCAGCCACTCACCGG - Intronic
1017282299 6:152637443-152637465 ACGCCCTTCCTGGGACCATCAGG - Intronic
1017563778 6:155662505-155662527 ACCTCATTCCTGCCACTCCCCGG - Intergenic
1018186993 6:161273936-161273958 ACCTCCTTCCTGGCAGCCTTTGG + Exonic
1018191751 6:161315068-161315090 TTCCCCTTCCGGGCAGTCTCTGG - Intergenic
1018814988 6:167323880-167323902 CCACCCTTCCTCGCACGCTCAGG + Intergenic
1019412223 7:911578-911600 GCCCCCTTCCTGGCCCTCCGTGG - Intronic
1019412238 7:911608-911630 GCCCCCTTCCTGGCCCTCCGTGG - Intronic
1019412253 7:911638-911660 GCCCCCTTCCTGGCCCTCCGTGG - Intronic
1019412268 7:911668-911690 GCCCCCTTCCTGGCCCTCCGTGG - Intronic
1019412283 7:911698-911720 GCCCCCTTCCTGGCCCTCCGTGG - Intronic
1019412298 7:911728-911750 GCCCCCTTCCTGGCCCTCCGTGG - Intronic
1019412313 7:911758-911780 GCCCCCTTCCTGGCCCTCCGTGG - Intronic
1019412328 7:911788-911810 GCCCCCTTCCTGGCCCTCCGTGG - Intronic
1019595911 7:1858320-1858342 ACTCCGTTCCTGGCCCACTCTGG + Intronic
1019652015 7:2164969-2164991 AGCCCTTTCCTGGCCCTCCCGGG - Intronic
1020131844 7:5563131-5563153 AGCCCAGTCCTGGCCCTCTCCGG + Intronic
1023116588 7:36868799-36868821 ACACCCTTCCTGGTCTTCTCTGG + Intronic
1023870375 7:44260205-44260227 CCCCCCTTCCTTGCATGCTCCGG + Intronic
1023871038 7:44263200-44263222 ACACCCTTCGTGGCACCCCCTGG + Intronic
1024486526 7:49926214-49926236 ACACCATTCATGGCACTATCAGG - Intronic
1024578856 7:50785543-50785565 AACCCCTTCCCAGCACTGTCTGG + Intronic
1024788973 7:52940863-52940885 GCCTCCTTCCTGGCATTCTTTGG - Intergenic
1027201399 7:76066067-76066089 GACCCCTGCCTGGCACCCTCTGG + Intronic
1028343316 7:89748957-89748979 AGCCGATTCCTAGCACTCTCAGG + Intergenic
1029154342 7:98504342-98504364 ACCCTCTTCCTCACACCCTCTGG - Intergenic
1030392419 7:108943548-108943570 ACCCACTTTCTGGCACTCCCCGG + Intergenic
1031999138 7:128253570-128253592 ACCCCCTGCATGGAGCTCTCTGG + Intronic
1034137627 7:148785855-148785877 ACCCTATTCTTGGCACTCTTGGG - Intronic
1035283450 7:157792081-157792103 GGCCCCTGCCTGGAACTCTCTGG + Intronic
1036184788 8:6613661-6613683 TCCCACTTCCTGGAAGTCTCAGG - Intronic
1036797408 8:11766315-11766337 ACTCCCTTCCTCGCATTCTTTGG + Intergenic
1037969585 8:23162778-23162800 AACCGCTTCCTGCCACTTTCAGG + Intronic
1038508412 8:28106595-28106617 AGCCCCTTTTTGCCACTCTCTGG + Intronic
1039999052 8:42561209-42561231 ACCCCTTTCCAGCCACTCACCGG - Intergenic
1040649686 8:49434010-49434032 ACCCCTTTCCAGCCACTCACTGG + Intergenic
1041002682 8:53467453-53467475 ACCCCTTTCCAGCCACTCACTGG + Intergenic
1041148221 8:54902592-54902614 ACCACCTTCCTGGTACTGTTTGG - Intergenic
1041758477 8:61338913-61338935 CCTCCCTTCCTGGCTCTCTCAGG + Intronic
1042940960 8:74107447-74107469 TTCCCCTTCATGGCGCTCTCTGG + Intergenic
1044180638 8:89189719-89189741 ACCTCCTTCTTGTCACTCTCTGG - Intergenic
1045858752 8:106792616-106792638 ACCCCTTTCCAGCCACTCACCGG + Intergenic
1048031993 8:130641550-130641572 ACCACCTTCCTGGCACTGACTGG + Intergenic
1049353316 8:142175687-142175709 ACCCACTGCCTGGCACTCACCGG + Intergenic
1049363314 8:142224636-142224658 ACCTCCTGCCTGGCCCTCACAGG - Intronic
1049466396 8:142752896-142752918 GCCCCCTTCCAGGCAGTCTGGGG - Intergenic
1049482762 8:142834772-142834794 ACCCGCTTTCTGGAACTTTCGGG - Intronic
1049594549 8:143477413-143477435 ACCCCCAGCCGGGCACTGTCTGG + Intronic
1050528492 9:6566485-6566507 ACACCATTCCTGGCAGTCTCAGG + Intronic
1050620806 9:7450071-7450093 ACCCCCTTCCCGCCAGTCACTGG - Intergenic
1052283654 9:26760458-26760480 ATCCCCTTCCCTGCACTGTCAGG - Intergenic
1056104091 9:83329968-83329990 AACCCCTTCCGAGCACCCTCAGG + Intronic
1056158024 9:83858922-83858944 GGCCCCTTCCTGGCACTGCCAGG - Intronic
1056714041 9:89013904-89013926 GCTCCCTCCCTGGCCCTCTCAGG + Intronic
1056839924 9:89990336-89990358 CCCTCCTTCCTGTCACTCTTGGG + Intergenic
1058430899 9:104918243-104918265 AACCCCTTCCTGGCATTGTTTGG - Intronic
1058930530 9:109714726-109714748 ACCCAGTGGCTGGCACTCTCAGG + Intronic
1059566262 9:115385682-115385704 ACCCCCATCCTTGCAGGCTCAGG + Intronic
1060008911 9:120026296-120026318 AGCTCCTTGCTGCCACTCTCTGG + Intergenic
1060528131 9:124332022-124332044 GCCACCTTCCTGGCATTTTCAGG + Intronic
1061394835 9:130338173-130338195 CCCCACTTCCTGTCTCTCTCAGG + Intronic
1061879958 9:133563629-133563651 GCCCCCTCCCTGCCATTCTCTGG - Intronic
1062374117 9:136254356-136254378 ACCCCCTTTCAGGCTCTCGCTGG + Intergenic
1062416204 9:136451535-136451557 GCCCCCTTCCTGCCTCCCTCTGG - Intronic
1185835956 X:3346196-3346218 TCCCCATCCCTGGCTCTCTCTGG - Intronic
1186301612 X:8205381-8205403 ATGCCTCTCCTGGCACTCTCTGG - Intergenic
1186449084 X:9657164-9657186 ACCCGCTTCCTGCCACACACAGG - Intronic
1188216087 X:27479091-27479113 TCTCTCTTTCTGGCACTCTCTGG + Intergenic
1191914602 X:66188056-66188078 ACCACATTCCTGCCACCCTCTGG - Intronic
1196124568 X:112083935-112083957 TCTCCCTTCCTAGCGCTCTCAGG + Intergenic
1199427322 X:147717943-147717965 ACTCCTGTCCTGGAACTCTCAGG + Intergenic
1200094695 X:153651814-153651836 CACCCCTCCCTGTCACTCTCAGG - Intergenic
1200110442 X:153738112-153738134 ACCACCTTCCTTGGACTCACTGG - Intronic
1201080821 Y:10242987-10243009 ACCCACTGTCTGGCACTCCCTGG + Intergenic
1201280939 Y:12341307-12341329 AGCCCCTTCCTAACACTCTTTGG + Intergenic
1201472690 Y:14351552-14351574 ACCCCTTTCCAGCCACTCACGGG - Intergenic
1201572812 Y:15432664-15432686 ACCCCTTTCCAGCCACTCACTGG + Intergenic