ID: 900606937

View in Genome Browser
Species Human (GRCh38)
Location 1:3527929-3527951
Sequence GAAAATGCACAGGCCCAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 270}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900606932_900606937 -10 Left 900606932 1:3527916-3527938 CCACGCTCCCTCTGAAAATGCAC 0: 1
1: 0
2: 1
3: 11
4: 150
Right 900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG 0: 1
1: 0
2: 3
3: 20
4: 270
900606928_900606937 11 Left 900606928 1:3527895-3527917 CCACTAGTCCCTCCAGAAATTCC 0: 1
1: 0
2: 2
3: 13
4: 165
Right 900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG 0: 1
1: 0
2: 3
3: 20
4: 270
900606927_900606937 21 Left 900606927 1:3527885-3527907 CCTCTCTCAGCCACTAGTCCCTC 0: 1
1: 0
2: 5
3: 29
4: 315
Right 900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG 0: 1
1: 0
2: 3
3: 20
4: 270
900606926_900606937 24 Left 900606926 1:3527882-3527904 CCACCTCTCTCAGCCACTAGTCC 0: 1
1: 0
2: 5
3: 30
4: 303
Right 900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG 0: 1
1: 0
2: 3
3: 20
4: 270
900606931_900606937 -1 Left 900606931 1:3527907-3527929 CCAGAAATTCCACGCTCCCTCTG 0: 1
1: 0
2: 1
3: 14
4: 130
Right 900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG 0: 1
1: 0
2: 3
3: 20
4: 270
900606929_900606937 3 Left 900606929 1:3527903-3527925 CCCTCCAGAAATTCCACGCTCCC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG 0: 1
1: 0
2: 3
3: 20
4: 270
900606930_900606937 2 Left 900606930 1:3527904-3527926 CCTCCAGAAATTCCACGCTCCCT 0: 1
1: 0
2: 0
3: 13
4: 125
Right 900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG 0: 1
1: 0
2: 3
3: 20
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900606937 Original CRISPR GAAAATGCACAGGCCCAGGT CGG Intronic
900011402 1:113055-113077 GAAAAATCACAGGGCTAGGTGGG - Intergenic
900027504 1:289621-289643 GAAAAATCACAGGGCTAGGTGGG - Intergenic
900041461 1:469063-469085 GAAAAATCACAGGGCTAGGTGGG - Intergenic
900062895 1:704040-704062 GAAAAATCACAGGGCTAGGTGGG - Intergenic
900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG + Intronic
900931247 1:5739235-5739257 CAGAATGCACAGGCCTGGGTGGG - Intergenic
901306973 1:8239830-8239852 GCAAATGCCCAGCCCCAGGGAGG + Intergenic
901408169 1:9064121-9064143 TAAAGTACACAGGCCCAGGCTGG - Intronic
902125581 1:14207870-14207892 GAAAATGGACAGGCCAAGGAGGG + Intergenic
902382977 1:16061306-16061328 GGAAAGGCACAGGCCAATGTGGG + Intronic
903022159 1:20401924-20401946 GAAAGAGGAGAGGCCCAGGTTGG + Intergenic
905457073 1:38095753-38095775 GAAAATGGGCAGGCCCTGGCGGG + Intergenic
907673757 1:56499867-56499889 GAAAACCCAGAGGCCCAGGCTGG + Intronic
912719048 1:112004357-112004379 GGAAGGGCACAGGCCCAGGATGG + Intergenic
913066599 1:115261404-115261426 GAAAATGCACAGGAGCATTTGGG + Intergenic
913189650 1:116402784-116402806 GCAAGTGCACAGGCCCTGGAGGG - Intronic
915228620 1:154429413-154429435 GCAAGTGCACAGTCCCAGCTGGG - Exonic
915755681 1:158257069-158257091 GAAAAAGCTAAGGCCCAGGCTGG + Intronic
917060989 1:171039102-171039124 CAAAATGCCAAGGCCTAGGTAGG - Intronic
918440611 1:184563004-184563026 GAAAATACACAGGACTAGGAAGG - Intronic
919703926 1:200658215-200658237 GAAATGGCACATGCCCAGGGTGG + Intronic
921610556 1:217207627-217207649 TAAAATGCTCAGTCTCAGGTAGG + Intergenic
922259841 1:223929065-223929087 GAAAAATCACAGGGCTAGGTGGG - Intergenic
924044315 1:240011887-240011909 GAAAATACCTAGGACCAGGTAGG - Intergenic
924240419 1:242034679-242034701 AAAAAGGCACAGGGCCAGGAGGG - Intergenic
924325548 1:242890871-242890893 CAAAGGGCACAGGCCCAGGCAGG + Intergenic
924341005 1:243031627-243031649 GAAAAATCACAGGGCTAGGTGGG - Intergenic
1063038248 10:2310589-2310611 GAAAATACACAGGCTCAGACAGG + Intergenic
1063513229 10:6667871-6667893 CAAATTGCACAGGGCCAGGAGGG - Intergenic
1064666519 10:17657581-17657603 CAGAAAGCACAGGCCCAGATGGG - Intronic
1064674220 10:17745353-17745375 GAAAATGCACACGCCCTAATGGG - Intergenic
1064842477 10:19610354-19610376 GAAAAAGGACAGGCAGAGGTTGG - Intronic
1066304354 10:34125549-34125571 GAAATTGCCCAGGCACAGGGAGG + Intronic
1066606387 10:37178434-37178456 AAAAATGCAGAATCCCAGGTCGG - Intronic
1066735467 10:38473794-38473816 GAAAAATCACAGGGCTAGGTGGG + Intergenic
1069756132 10:70775405-70775427 GAAAAGGCACAGACCCTTGTGGG - Intronic
1070618522 10:77988155-77988177 GAAAGTGCAGAGGCCCACGGAGG + Intronic
1071516477 10:86301049-86301071 CAAAATGCACAGGCCCTGGAGGG + Intronic
1074346461 10:112690944-112690966 GCATATGCACAGGCCCAGCCTGG - Intronic
1076089127 10:127664494-127664516 GAAAATGTATAGGCACAGGGAGG - Intergenic
1076191082 10:128483880-128483902 GAAGTTACACAGCCCCAGGTGGG + Intergenic
1076516765 10:131050001-131050023 GAAATTTCACATTCCCAGGTTGG + Intergenic
1076842394 10:133052233-133052255 GTAAATGCACAGCCCCAGGCTGG - Intergenic
1076967735 11:105291-105313 GAAAAATCACAGGGCTAGGTGGG - Intergenic
1077232229 11:1462979-1463001 GAAAAGGCCCAGGCCCTGGGTGG - Intergenic
1077341314 11:2027635-2027657 GAGAATGCACAGGCTCAGCCCGG + Intergenic
1077918442 11:6625868-6625890 GAAACTGGACAGGCCCAAGATGG + Intronic
1078583508 11:12558840-12558862 GAAGGTCCACAGGCCAAGGTAGG + Intergenic
1078745184 11:14106867-14106889 GAATATGCACAGACTCAGGAAGG - Intronic
1079713727 11:23718408-23718430 GAAAAGCCACAGGCCCAGCCAGG + Intergenic
1081244692 11:40750232-40750254 AAAAATCCACAGGACCAGATGGG + Intronic
1081481192 11:43490652-43490674 GCAAATGCACTGGCCTAAGTGGG + Intronic
1081737439 11:45413899-45413921 GAAGAAGCAGAGGCCCAGGTAGG + Intergenic
1082718965 11:56649854-56649876 GAGAATGCACAGACACAGGGAGG + Intergenic
1087093634 11:94299968-94299990 GAAAATGAAGAGGCTCTGGTTGG + Intergenic
1088295675 11:108291144-108291166 GAAAATGGCCAGAACCAGGTAGG + Intronic
1088796917 11:113272751-113272773 GAGGAAGCACACGCCCAGGTGGG - Intronic
1090279596 11:125444591-125444613 AAAAAAGCAGAGGCCCAGGAAGG + Intergenic
1090837925 11:130466819-130466841 GAAAGTGCACAGGCCCTGAGAGG - Intronic
1091323535 11:134667900-134667922 GGAGAAGCACAGGCCCAGGATGG + Intergenic
1202824299 11_KI270721v1_random:82824-82846 GAGAATGCACAGGCTCAGCCCGG + Intergenic
1091596509 12:1882453-1882475 GAAAATGCAGGGACCCAGGAAGG + Intronic
1091765907 12:3119818-3119840 GAATATGCCCTAGCCCAGGTTGG + Intronic
1091786973 12:3248975-3248997 AAAAATGCACAGGAACGGGTGGG - Intronic
1091841875 12:3627345-3627367 GAAAATGCAGAGGCCCACGTGGG + Intronic
1093424299 12:19010855-19010877 GAAAAAGCACAGGCCCTCTTGGG + Intergenic
1093478084 12:19576937-19576959 TAAAATGGACAGTCCCAGTTTGG + Intronic
1098737050 12:74118359-74118381 AAAAAGGTACAGGCCCAGGTTGG + Intergenic
1100426530 12:94492528-94492550 GAAAATGGACAAGCCCAGCATGG + Intergenic
1101740776 12:107498237-107498259 GAAAAGGCAAAGGCCGAGGAAGG + Intronic
1102030052 12:109735147-109735169 GAAGACGCAGTGGCCCAGGTCGG - Intronic
1102168094 12:110821985-110822007 GAAAATGCCCAGCACAAGGTAGG - Intergenic
1102306377 12:111807768-111807790 CAGAATGCACAGGCCCTTGTTGG + Intronic
1105547574 13:21362015-21362037 GAAAGTGCTCAGCCCAAGGTGGG - Intergenic
1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG + Intronic
1107732791 13:43365478-43365500 GATAAAACACAGGTCCAGGTGGG + Intronic
1111429313 13:88131375-88131397 CAGAAAGCACAGGCCCAGATGGG + Intergenic
1111897271 13:94157172-94157194 GAGAATGCTAAGGCCCAGGCAGG - Intronic
1113956551 13:114102600-114102622 GAAGATGCTGAGGCCCAGGGCGG + Intronic
1114207592 14:20587558-20587580 GAAACTGAACAGGAACAGGTAGG - Exonic
1116498117 14:45587142-45587164 CAGAATACACAGGCCCAGGATGG - Intergenic
1116788439 14:49313367-49313389 GAATATGCACAGCTCCAGATTGG - Intergenic
1119220563 14:72903329-72903351 GGAAATCCACAGGGCCAGGAAGG + Intergenic
1119284661 14:73443229-73443251 TAAAATGCACATGCCATGGTGGG + Intronic
1119638212 14:76293706-76293728 GTAAATGCTAAGGCACAGGTAGG - Intergenic
1121918921 14:97862193-97862215 GAAAATGCAGAGGCCAAGGTGGG - Intergenic
1123144139 14:106111456-106111478 GGCCATGCACAGGCACAGGTGGG + Intergenic
1123220911 14:106854545-106854567 GGCCATGCACAGGCACAGGTGGG + Intergenic
1124345685 15:28919985-28920007 GCAAATGCAAAGGCCGAGGAGGG - Intronic
1125991893 15:44117693-44117715 ATAAATGCTAAGGCCCAGGTGGG - Intronic
1126244044 15:46482535-46482557 CAAAAAGCCCAGGCCCAGATGGG - Intergenic
1126983030 15:54268299-54268321 GAAGATGCAAAGACCCAGTTAGG - Intronic
1127021933 15:54757874-54757896 GAAAAAGCCCAGGACCAGTTGGG + Intergenic
1128907744 15:71483181-71483203 GAAGATGCATAGGCCAAGTTGGG + Intronic
1129667210 15:77586018-77586040 GCAGATGCCCAGGCCCCGGTGGG + Intergenic
1131294274 15:91133581-91133603 GAAAATGCCCAGGCCAGAGTGGG + Intronic
1131315672 15:91334722-91334744 GAAACTGCCAAGGCCCAGGCTGG - Intergenic
1134242936 16:12518995-12519017 GCAAATGCACTGGCCCACGGAGG + Intronic
1136189919 16:28609470-28609492 GCAAAAGCACAGGCCTAGGCAGG + Intronic
1137310452 16:47251579-47251601 GAACATGCACAGGAACAGGAGGG + Intronic
1138241118 16:55427913-55427935 GACTATGCACAGGCTCAGGAAGG + Intronic
1138415839 16:56870807-56870829 GAAAAGGCAGAGGACCAGGGAGG - Intronic
1139523528 16:67499165-67499187 GAAAATGAGCAGGGCCAGGTTGG - Intergenic
1140501242 16:75435269-75435291 GAAAATGCACACGCCAACATAGG + Intronic
1142421751 16:89974969-89974991 GAAAATGCACTGCCCTAGGGTGG + Intergenic
1142452945 16:90193848-90193870 GAAAAATCACAGGGCTAGGTGGG + Intergenic
1142590772 17:1004835-1004857 GCAAAGGCACAGGCCCACGGTGG - Exonic
1142622914 17:1176235-1176257 CAAGAGGCACAGGGCCAGGTTGG + Intronic
1143186112 17:5011424-5011446 GAAGCTGCTCAGGCCCAGGCTGG - Intronic
1143988768 17:10938828-10938850 GAAAATGCACAGGTACTGGAGGG + Intergenic
1144721052 17:17470222-17470244 GAGGATGCAGAGGCCCAGGGAGG - Intergenic
1145165134 17:20608107-20608129 GAAAAAGCACTAGCTCAGGTCGG - Intergenic
1146832919 17:36085374-36085396 GAAAGTGCACATCCCCAGCTGGG + Intergenic
1146891708 17:36510641-36510663 CAATAGGCACAGGCCCAGGGTGG - Intronic
1147548294 17:41420091-41420113 CCAAATGCAGAGGCCCAGATTGG - Intergenic
1147818793 17:43229460-43229482 TTAAATGCACAGTCCCAGGCTGG - Intergenic
1147832076 17:43304162-43304184 TTAAATGCACAGTCCCAGGCTGG - Intergenic
1148899127 17:50862932-50862954 TAAAATGCACGGGCCCAAGGGGG - Exonic
1149029158 17:52064440-52064462 GAGCATGCACAGCCCCAGGCTGG + Intronic
1150341609 17:64372823-64372845 GAAAATGCACAGGCCAGGTGTGG + Intronic
1150592170 17:66572779-66572801 GAAAAGCCTCAGGGCCAGGTGGG - Intronic
1151353208 17:73543643-73543665 GAAGAGCCACTGGCCCAGGTTGG + Intronic
1153521585 18:5959293-5959315 GAAGAAGCTCAGGCCCAGGAAGG - Intronic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1155782833 18:29859744-29859766 GAAAAAGCACACGCACAGGAAGG + Intergenic
1159493716 18:69172846-69172868 GACAATGCACAGGCACAGAATGG + Intergenic
1160644540 19:174914-174936 GAAAAATCACAGGGCTAGGTGGG - Intergenic
1161331915 19:3692599-3692621 GGGACTGCACTGGCCCAGGTGGG - Intronic
1161437411 19:4272116-4272138 AAAAAGACACAGGCCCAGGCTGG + Intergenic
1161778937 19:6279072-6279094 GAGAAGGCTCAGGTCCAGGTAGG + Intronic
1162771447 19:12951793-12951815 GCAAGTGCAAAGGCCCAGGGTGG - Intronic
1162775494 19:12976385-12976407 GTAAATGCACAGGGGTAGGTTGG + Intergenic
1162872658 19:13598212-13598234 GCAAAGGCACAGGCCTAGGGTGG - Intronic
1162958956 19:14114899-14114921 GAAAATGCCCAGGCCTTGGGAGG - Intronic
1163144209 19:15369792-15369814 GGAAATGCACTGGCCGAGGAGGG + Intronic
1163793015 19:19319327-19319349 GTAAATGCAGAGGCCCTGGTAGG - Intronic
1165222578 19:34328896-34328918 AAAACTGCCTAGGCCCAGGTCGG - Intronic
1165346853 19:35253941-35253963 GATCAAACACAGGCCCAGGTGGG - Intronic
1165829227 19:38722307-38722329 GAAAATCCACAGGCCCTCGAGGG + Intronic
1165890618 19:39110177-39110199 GAAACTGCCCAGGCCTGGGTGGG + Exonic
1166274607 19:41744133-41744155 GAAAAGGCACAGGCATTGGTAGG + Intronic
1167119159 19:47506551-47506573 GAAAAAGCACAGACCCTGGATGG + Intronic
1167787030 19:51645472-51645494 GAAATGGCACAGGCACAGGTAGG - Exonic
926210104 2:10863071-10863093 GGGAATGCAGAGGCCCAGGGCGG - Intergenic
926361177 2:12088892-12088914 AAAAATGCAAGGGCCCAGGATGG - Intergenic
927266248 2:21154839-21154861 GAAGATGTACAGGACCAGGAAGG - Intergenic
928000191 2:27517256-27517278 GAAAATGTACTGGCCAAGGTGGG - Intronic
929588916 2:43132823-43132845 GGAAGTGCACAGGCCCGGGGTGG - Intergenic
930203555 2:48566577-48566599 TAAAATGCCCAGTCACAGGTCGG - Intronic
930489321 2:52048059-52048081 GCACATGCACAGGCCCAGACAGG + Intergenic
933168175 2:79097182-79097204 GAAAATGCCCAAATCCAGGTAGG - Intergenic
933262864 2:80149954-80149976 GATAATGAACAGGCCTAGGGTGG - Intronic
934024745 2:87992237-87992259 GAAACTCCACAGGCACAGGCAGG - Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
935709132 2:105881813-105881835 AAAAATGCCCGGGGCCAGGTGGG + Exonic
936376772 2:111947740-111947762 GAGAATTCACAGGCCAAGGTGGG + Intronic
936915615 2:117636611-117636633 TAAATTGCACAGTCTCAGGTAGG + Intergenic
937009322 2:118548014-118548036 CAAAATGCACATTCACAGGTGGG - Intergenic
937028088 2:118715674-118715696 GAAAATCCACAGCCTCAGATGGG + Intergenic
937079579 2:119130780-119130802 GAAAATTCAGAGGCTCAGGGAGG + Intergenic
939963917 2:148592199-148592221 CAATATGCACAGTCCCAGCTAGG + Intergenic
940205430 2:151196848-151196870 CAAAAAGCAAAGGTCCAGGTAGG + Intergenic
941923252 2:170872136-170872158 AAAAAACCAAAGGCCCAGGTGGG - Intergenic
944413046 2:199460186-199460208 GAAAATGCACAGTTCGAAGTCGG + Intronic
947153923 2:227141821-227141843 TTAAATGCCCGGGCCCAGGTCGG + Intronic
948663424 2:239520386-239520408 GGACAGGCAGAGGCCCAGGTGGG - Intergenic
949084388 2:242138511-242138533 GAAAAATCACAGGGCTAGGTGGG + Intergenic
1169268348 20:4181277-4181299 GGAGCTGCACAGGCCCAGGGAGG + Intronic
1169726275 20:8736501-8736523 GAAAATGGACAAACACAGGTTGG - Intronic
1170138742 20:13104021-13104043 GAACAGGCACAGGCTCAGGCTGG + Intronic
1173262781 20:41451478-41451500 GAAAAGGCACAGACAGAGGTGGG + Intronic
1174302299 20:49591600-49591622 GAAAAAGCAGAGGCCCAGGAAGG + Intergenic
1174794693 20:53512216-53512238 GAAGACACAGAGGCCCAGGTGGG + Intergenic
1175252952 20:57620724-57620746 AAAAATGTAGAGGTCCAGGTGGG - Intergenic
1175900748 20:62359041-62359063 GCAAATGGGGAGGCCCAGGTGGG - Intronic
1176280968 20:64310994-64311016 GAAAAATCACAGGGCTAGGTGGG + Intergenic
1178998749 21:37433391-37433413 GAAAATGCCCAGGCTGAGTTAGG + Intronic
1181316864 22:21976264-21976286 CAAAATGCAGATGCCCAGGCTGG + Intronic
1181590216 22:23879594-23879616 AGGAATGCACTGGCCCAGGTTGG - Intronic
949488722 3:4566761-4566783 GCCAAGGCCCAGGCCCAGGTTGG - Intronic
949902534 3:8829542-8829564 GAAAATCAACAGGCCAAAGTTGG + Intronic
950313982 3:11984172-11984194 GAAAATGCAGATGCTCAGCTAGG - Intergenic
951581787 3:24172346-24172368 GGAAATGCAAATCCCCAGGTGGG + Intronic
952247653 3:31612543-31612565 GGAAATGAAAAAGCCCAGGTGGG - Intronic
954036837 3:47855294-47855316 GAGAAGGCCCAGGCCAAGGTGGG - Exonic
954075547 3:48176604-48176626 GAAAATACCCAGCCTCAGGTAGG + Intronic
954421404 3:50420918-50420940 GGAACTGCCCAGGCCCAGGCTGG - Intronic
954496282 3:50966817-50966839 GAAAGGGTACAAGCCCAGGTTGG + Intronic
954783214 3:53075175-53075197 CAAATTGCCCAGGACCAGGTTGG - Intronic
954800238 3:53183095-53183117 GAAGAGGCACAGGCCCAGGAGGG - Intronic
955515047 3:59718081-59718103 GAGAATGCAAAGGACCAGGCAGG + Intergenic
955754947 3:62217191-62217213 GAAAATGGGCAGGCACAGCTAGG + Intronic
956213588 3:66826179-66826201 GTATGTGCACAGGCACAGGTAGG - Intergenic
960242300 3:115359449-115359471 CAAAATGCTCAGGCCCAGCATGG - Intergenic
962373749 3:134842447-134842469 GGAATGGCACAGGCCCAGGATGG - Intronic
963065807 3:141263617-141263639 GAAAATGCAAGGGCCAAGGAGGG - Intronic
963154295 3:142079091-142079113 GAAAATACACAGTCCCAGCCTGG + Intronic
964627992 3:158777407-158777429 GAAAATACACAGGACAAGTTTGG - Intronic
969241707 4:5903002-5903024 GAAAATGCAGAGGCCCAGGGAGG - Intronic
969414971 4:7052195-7052217 GAAGCTGCACAGGCCAAGGCCGG + Intronic
969714931 4:8863783-8863805 GAAATGGGGCAGGCCCAGGTCGG + Intronic
969808278 4:9627652-9627674 GACCATGCACAGGTCCAGTTAGG + Intergenic
970233285 4:13933026-13933048 GAAAATGCACAGGACAAGGATGG - Intergenic
970824122 4:20252815-20252837 GGAAAGGCAAAGGCCAAGGTTGG - Intergenic
972347518 4:38205300-38205322 TAAAATACACAAGCACAGGTTGG + Intergenic
972794005 4:42398400-42398422 GAGGATGCACAGACCCAGGCAGG + Intronic
976361955 4:84190181-84190203 GAAGATGCAAAGGCCAAGATGGG + Intergenic
976593113 4:86869154-86869176 AAAAAAGCACAGGGCCTGGTAGG + Intergenic
977408173 4:96627405-96627427 GAAAATTGAGAGGCCAAGGTGGG + Intergenic
979261820 4:118656749-118656771 GAAAAATCACAGGGCTAGGTGGG + Intergenic
979941224 4:126765579-126765601 GAAAACAGACAGACCCAGGTTGG + Intergenic
981990997 4:150920975-150920997 GAAAATGCCCAGTCACAGCTTGG - Intronic
982242685 4:153316448-153316470 AAAAATGTACAGGCCCATTTTGG + Intronic
982326873 4:154137288-154137310 GTCAAGGTACAGGCCCAGGTGGG - Intergenic
985705917 5:1401338-1401360 GAAAGTGCCCACACCCAGGTGGG + Intronic
990725295 5:58746280-58746302 GATAATGCACAGGACAATGTTGG - Intronic
991946805 5:71906040-71906062 GAGAATGCAGAGGCCTAGGGGGG + Intergenic
993936852 5:94014833-94014855 GAAAATACACAGTCACAGGAGGG + Intronic
997391904 5:133524102-133524124 GCATGTGCACAGGCCCAGGGTGG + Intronic
997579632 5:135009141-135009163 GCAAATGCACTGGCTCAGGGAGG - Intronic
998011757 5:138700850-138700872 GGAAATCCAAAGGCCCATGTTGG - Intronic
1000879366 5:166679752-166679774 TAAAATGCACAAGTCTAGGTAGG - Intergenic
1002351775 5:178588994-178589016 GAAACTGGACAGGCCCTGGTGGG - Intronic
1002732385 5:181349865-181349887 GAAAAATCACAGGGCTAGGTGGG + Intergenic
1002752154 6:124239-124261 GAAAAATCACAGGGCTAGGTGGG - Intergenic
1003404100 6:5814667-5814689 GAAAGTGCTCAGCCCAAGGTGGG + Intergenic
1008731201 6:54484711-54484733 GAAAATGCACAGGAGCTGGGAGG - Intergenic
1008793801 6:55274951-55274973 GAAAATCTCCAGGCCCAGATAGG - Intronic
1009449659 6:63786485-63786507 GAAAATGCACGGACACAGGGAGG + Intronic
1014431792 6:121379740-121379762 AAAAATAGACAGGGCCAGGTGGG - Intergenic
1017069425 6:150560857-150560879 AAAAATACACAGGCTGAGGTGGG + Intergenic
1017845669 6:158255917-158255939 GGAAATGCAGAGGCCTTGGTGGG + Intronic
1018003015 6:159596618-159596640 GAAAATGCAGAGCCCCAGTTGGG + Intergenic
1018460805 6:163996725-163996747 GAGAAGGCACAGGCCCAAGTGGG - Intergenic
1019236636 6:170622181-170622203 GAAAAATCACAGGGCTAGGTGGG + Intergenic
1019772366 7:2891681-2891703 GAAAATGCGGAGGCCGAGGCGGG + Intergenic
1020430466 7:8112310-8112332 GCAAACACACAGGCCCAGGGTGG + Intergenic
1021651539 7:22837959-22837981 GAAAATGCAAAAGCCCCGGCTGG - Intergenic
1023512212 7:40965341-40965363 GCAAATACACAGGCCCATATAGG - Intergenic
1024298227 7:47863270-47863292 GAAACTGCACAGACCCAGCATGG - Intronic
1031557035 7:123190332-123190354 GGAAATCCCCAGGCCAAGGTTGG - Intronic
1032527433 7:132589955-132589977 GAAAATACTCAGTTCCAGGTGGG + Intronic
1035164955 7:156981504-156981526 GAGAAACCACAGGCCCAGGGGGG + Intergenic
1035412524 7:158656547-158656569 GAGCATGCCCAGGCCAAGGTAGG - Exonic
1035511135 8:184427-184449 GAAAAATCACAGGGCTAGGTGGG - Intergenic
1035897947 8:3425292-3425314 GAAAATGCCCTGTCCCAGCTGGG + Intronic
1036183034 8:6601164-6601186 GAAAGTGCAGCTGCCCAGGTGGG - Intronic
1036704222 8:11034709-11034731 GAGAATGGACAGGCCTAGGGAGG - Intronic
1038399532 8:27272437-27272459 CCAAATCCTCAGGCCCAGGTTGG - Intergenic
1039486568 8:37914789-37914811 GAAAATGCAAAACTCCAGGTGGG - Intergenic
1040321723 8:46312939-46312961 GAAACTGCACAGGGACATGTTGG - Intergenic
1040694076 8:49974974-49974996 GAGAGTGCACAGGTCCAGGCAGG + Intronic
1042745653 8:72103074-72103096 GAAATTGCCCAGCTCCAGGTTGG + Intronic
1045183511 8:99812402-99812424 GCAAATTTCCAGGCCCAGGTGGG - Intronic
1046851113 8:118973968-118973990 GAAATGGGACAGGGCCAGGTGGG - Intergenic
1046884104 8:119343708-119343730 GAAAATGAACTGGGACAGGTGGG - Intergenic
1047952731 8:129948549-129948571 GAAAAGGCACAGGCACAGGAGGG + Intronic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1049185834 8:141252640-141252662 GGAAATTCACAGACGCAGGTGGG - Intronic
1049185846 8:141252744-141252766 GGAAATTCACAGACGCAGGTGGG - Intronic
1049185878 8:141253030-141253052 GGAAATTCACAGACACAGGTGGG - Intronic
1052385906 9:27823530-27823552 GTAAATGCAGAGGACCAGTTAGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1054869943 9:70039949-70039971 GAAAAGGCACAGACACATGTAGG - Intergenic
1054913927 9:70478847-70478869 GCCAGTGCTCAGGCCCAGGTGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056822100 9:89850315-89850337 GGAAAAGCAAAGGCCCAGGTGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060744175 9:126119258-126119280 AAAAATGCAGAGGCCCGGCTGGG - Intergenic
1060787391 9:126461200-126461222 GGCCATGCACAGGCCCAGGTGGG - Intronic
1061642631 9:131971289-131971311 GAAAGTGCTGAGGCACAGGTGGG + Intronic
1062658502 9:137616070-137616092 TAAAATGCACAGGACCAGGCCGG + Exonic
1062756787 9:138302192-138302214 GAAAAATCACAGGGCTAGGTGGG + Intergenic
1188897203 X:35683993-35684015 GCAAAAGCAGATGCCCAGGTAGG - Intergenic
1189233958 X:39473608-39473630 GAAAATATTGAGGCCCAGGTGGG - Intergenic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1190247921 X:48702690-48702712 GAAAAGTCTCAGGCCCAGGAGGG - Intronic
1192221841 X:69202758-69202780 CCAAATGCACAGGCCAAGGGTGG - Intergenic
1192419837 X:71019902-71019924 GAAAATGAACAGCCTCAGCTGGG - Intergenic
1193317290 X:80078004-80078026 GACAATGTGAAGGCCCAGGTGGG + Intergenic
1194258000 X:91657867-91657889 GAACATTCACTGGCCAAGGTGGG + Intergenic
1194980039 X:100431186-100431208 GTGAATGCACTGGCTCAGGTAGG - Intergenic
1195003884 X:100668293-100668315 GAATATTCAGAGGCCCAGGATGG + Intronic
1199119615 X:144036112-144036134 CAAAATGCACAGGCGTAGGGTGG + Intergenic
1200576765 Y:4897369-4897391 GAACATTCACTGGCCAAGGTGGG + Intergenic
1200761559 Y:7043662-7043684 TAAAATACACAGACCCATGTGGG - Intronic
1201223059 Y:11789864-11789886 CAAAGGGCACAGGCCCAGGCAGG + Intergenic
1202383907 Y:24305214-24305236 GAAAAATCACAGGACTAGGTGGG + Intergenic
1202486876 Y:25364906-25364928 GAAAAATCACAGGACTAGGTGGG - Intergenic