ID: 900610989

View in Genome Browser
Species Human (GRCh38)
Location 1:3544586-3544608
Sequence CGGTGTGTGGAGCACTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900610989_900610999 20 Left 900610989 1:3544586-3544608 CCTGGGGAGTGCTCCACACACCG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 900610999 1:3544629-3544651 CCTGCCAGGCAGCCCCCAGCAGG 0: 2
1: 0
2: 4
3: 71
4: 2142
900610989_900610993 -5 Left 900610989 1:3544586-3544608 CCTGGGGAGTGCTCCACACACCG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 900610993 1:3544604-3544626 CACCGCAGCCCTGGAGCATCGGG 0: 1
1: 0
2: 0
3: 17
4: 213
900610989_900611000 21 Left 900610989 1:3544586-3544608 CCTGGGGAGTGCTCCACACACCG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 900611000 1:3544630-3544652 CTGCCAGGCAGCCCCCAGCAGGG 0: 2
1: 0
2: 21
3: 1645
4: 2372
900610989_900610997 6 Left 900610989 1:3544586-3544608 CCTGGGGAGTGCTCCACACACCG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 900610997 1:3544615-3544637 TGGAGCATCGGGAACCTGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 113
900610989_900611003 28 Left 900610989 1:3544586-3544608 CCTGGGGAGTGCTCCACACACCG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 900611003 1:3544637-3544659 GCAGCCCCCAGCAGGGTCTTGGG 0: 1
1: 0
2: 1
3: 31
4: 251
900610989_900611002 27 Left 900610989 1:3544586-3544608 CCTGGGGAGTGCTCCACACACCG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 900611002 1:3544636-3544658 GGCAGCCCCCAGCAGGGTCTTGG 0: 1
1: 2
2: 2
3: 52
4: 371
900610989_900610992 -6 Left 900610989 1:3544586-3544608 CCTGGGGAGTGCTCCACACACCG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 900610992 1:3544603-3544625 ACACCGCAGCCCTGGAGCATCGG 0: 1
1: 0
2: 0
3: 15
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900610989 Original CRISPR CGGTGTGTGGAGCACTCCCC AGG (reversed) Intronic
900228285 1:1543080-1543102 CGGTGCGTGGGGCTCTCCTCAGG + Intronic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
902598851 1:17527361-17527383 TTGTGTGTGGAGCACCCGCCAGG - Intergenic
903918671 1:26783958-26783980 CTGTGTGTGGAGCATTACCTAGG + Intergenic
905939886 1:41854467-41854489 CTGTGTCTGGAGCACTGCTCAGG + Intronic
906127276 1:43434651-43434673 TGGGTTGTGGAGCACTCCCAAGG - Intronic
912709173 1:111937539-111937561 CCCAGTGTGGAGCAGTCCCCTGG - Intronic
923231751 1:231993238-231993260 AGGTGTGTGGAGAACTCACAGGG + Intronic
923566405 1:235079762-235079784 AGGGGTGTGGAGCACACACCTGG + Intergenic
1065879515 10:30026981-30027003 CGGTCTGTGGGGCTCACCCCTGG - Exonic
1068607851 10:59025922-59025944 CTGGGGGTGGAGCCCTCCCCAGG - Intergenic
1069557437 10:69407370-69407392 CTGTGTGTGGAGCAGTTCCCAGG - Intronic
1069944867 10:71978887-71978909 CGATGTCTGGACCCCTCCCCAGG + Intronic
1070865400 10:79705639-79705661 CTGAGTGCGGAGCACTGCCCTGG + Intronic
1072790300 10:98312858-98312880 AGGTGTGTGGCCCACTCCTCTGG + Intergenic
1082710304 11:56546969-56546991 CTGTGGGTGGAGCCCTCACCAGG - Intergenic
1083308402 11:61772418-61772440 CCCTGTGGGGACCACTCCCCTGG + Intronic
1083626450 11:64074407-64074429 CTGTGGGTGGACCACACCCCTGG - Intronic
1083900466 11:65640939-65640961 CGGTGTGGGGAGCCCTCGGCGGG + Exonic
1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG + Intergenic
1090270056 11:125379716-125379738 AGGTGTGTGCAGCTGTCCCCGGG - Intronic
1094836938 12:34326484-34326506 GGGTGTGTGGCGCACCCACCTGG - Intergenic
1105722931 13:23134732-23134754 CTGAGTGGGGAGCATTCCCCTGG + Intergenic
1109548515 13:63860667-63860689 GGCTGTGTGGGCCACTCCCCAGG - Intergenic
1112190795 13:97175436-97175458 TGGTGTGTGGGTCAGTCCCCAGG - Intergenic
1113783212 13:112988370-112988392 CGGTGTGGGGAGCAGGGCCCGGG + Intronic
1113957184 13:114105166-114105188 GGGTGGGTGGGGCTCTCCCCAGG + Intronic
1118456287 14:65948044-65948066 AGGTGTGCTGAGCTCTCCCCAGG - Intergenic
1125250829 15:37701209-37701231 TGGTGTGTGGAGCATTATCCAGG - Intergenic
1125795613 15:42402159-42402181 AGTTGTGTGCAGCACTACCCAGG + Intronic
1126841475 15:52721394-52721416 TGGTCTATGGATCACTCCCCTGG + Intergenic
1128692806 15:69738047-69738069 CCATGAGTGGAGCACACCCCTGG - Intergenic
1132046532 15:98567378-98567400 CGGTGTGTGTTGCCCTCCCCCGG + Intergenic
1132314017 15:100878150-100878172 CAGTGTGTGCAGCAGGCCCCAGG - Intronic
1135323749 16:21513113-21513135 TGGTGTGTCCAGCACCCCCCTGG - Intergenic
1137696413 16:50464977-50464999 TGGTTTTTGGAGGACTCCCCAGG + Intergenic
1141658524 16:85429220-85429242 CTGTGTCCGGAGCACCCCCCAGG + Intergenic
1142769633 17:2087344-2087366 CGGTGTGTGCCGCACTTTCCTGG - Intronic
1147550900 17:41440735-41440757 CCGTGTGGGGTCCACTCCCCTGG - Exonic
1148027810 17:44600432-44600454 CGGGGTGTGCAACACTCCCCCGG - Intergenic
1148839173 17:50483739-50483761 CGATGTGGGGATCACTCACCAGG + Exonic
1154014496 18:10604401-10604423 CCGTGGGTGCAGCTCTCCCCAGG - Intergenic
1155816399 18:30316643-30316665 AGGGATGTGGAGCACTCTCCTGG + Intergenic
1157806586 18:50662903-50662925 TGCTGTGCGTAGCACTCCCCTGG - Intronic
1162391936 19:10395207-10395229 AGGTGAGTGGAGCTTTCCCCGGG - Exonic
1163466042 19:17469290-17469312 GTGTGAGTTGAGCACTCCCCCGG + Intronic
927857019 2:26534279-26534301 CCCTGTGTGGAGCAGGCCCCAGG - Intronic
930026468 2:47032099-47032121 CAGTGAGTGGAGCACTTCCTGGG - Intronic
932280768 2:70489876-70489898 CAATGTGTGGAGGACTCTCCTGG - Intronic
933140951 2:78792537-78792559 CTGAGGGTGGAGCCCTCCCCAGG + Intergenic
934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG + Intronic
935367359 2:102308532-102308554 CGCTGTGAGGATCGCTCCCCAGG - Intergenic
936985944 2:118311288-118311310 CAGTTTCTGCAGCACTCCCCAGG - Intergenic
937448253 2:121976486-121976508 CAGTGTGTGGAGCCTTCACCAGG - Intergenic
937996044 2:127695743-127695765 CGGCGTGCGGGGCCCTCCCCCGG - Intergenic
940362634 2:152812964-152812986 GGTTGTGTGGACCAGTCCCCAGG + Intergenic
945067064 2:205956349-205956371 CGGTGTGTGGACACCTCCGCAGG - Intergenic
946329269 2:219000571-219000593 GGGTGTGTGCAGCCCTCTCCTGG - Intergenic
946642150 2:221795746-221795768 TGTTCTTTGGAGCACTCCCCAGG + Intergenic
948644533 2:239395675-239395697 CGGGGTCTGGAGCAGTCCCCGGG - Intronic
948880800 2:240856277-240856299 GGGTATGTGGAGCACCTCCCTGG - Intergenic
948912292 2:241010678-241010700 CGGGGCGTGGGGCACTCACCGGG + Intronic
1169198000 20:3693612-3693634 CCTTGTGTGGACCACTCACCCGG - Exonic
1172105742 20:32516386-32516408 CTGTGTGCGGTGCAGTCCCCAGG + Intronic
1174036594 20:47672365-47672387 CAGTGTGTGGAGGACGCCACGGG - Exonic
1178350093 21:31866739-31866761 ATTTGTGTTGAGCACTCCCCAGG + Intergenic
1178741373 21:35205351-35205373 GGGTGTGGGGAGCTCTCTCCTGG - Intronic
1178850607 21:36209352-36209374 CGGTGGGTGGATCACCCGCCAGG - Intronic
1181017892 22:20081510-20081532 CGCTGTGTGGAGCACTTCCCAGG + Intronic
1181259881 22:21589942-21589964 AGGTGTGTGGCTCACTCCCATGG + Intronic
1181291309 22:21795678-21795700 CGGTGGGTGGATTACTCGCCAGG - Intronic
1183014316 22:34973341-34973363 CTGTGTGTGGAGGAGGCCCCAGG + Intergenic
1183905076 22:41034404-41034426 GGTGGTGTGGAGCACTCCTCAGG + Intergenic
1184810477 22:46828095-46828117 GGGAGTGTGGAGCAGCCCCCTGG - Intronic
1185010761 22:48312534-48312556 CTGTGCCTGGTGCACTCCCCTGG + Intergenic
949806331 3:7959481-7959503 CAGGGTGTGGAGCCCTCGCCAGG + Intergenic
954049139 3:47958656-47958678 CCGGGTGTGGTGCACACCCCTGG - Intronic
962259213 3:133892497-133892519 CAGGGTGTGGAGCACACCCTGGG - Intronic
962272129 3:133985001-133985023 CAGGATGTGGAGCACTCACCAGG - Intronic
962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG + Intronic
963566227 3:146934518-146934540 CTGTGTGAGGAGGACTCCACCGG - Intergenic
967882334 3:194310587-194310609 CCTTGTGTGGGGTACTCCCCAGG - Intergenic
968582353 4:1400977-1400999 CGCTGTGTGCAGCCCTCCCATGG - Intergenic
973240755 4:47953872-47953894 CCGAGTGTGGAGCCCTCGCCGGG - Intronic
977766678 4:100806362-100806384 CGGTGGGTGAAGCACTAACCAGG + Intronic
982559097 4:156907624-156907646 CGGTGGGTGGAGCTCTTGCCAGG + Intronic
985684634 5:1275568-1275590 AGGGGTGTGGAGGCCTCCCCTGG - Intronic
986160023 5:5219087-5219109 CTGAGTGTGGAGCCCTCTCCAGG + Intronic
989285836 5:39699006-39699028 CTGTGTTTGGAACACTTCCCAGG - Intergenic
992092390 5:73328911-73328933 GGGTGTGTGGAACATACCCCAGG + Intergenic
992990039 5:82274584-82274606 CGGGGTGGGCAGCTCTCCCCGGG - Exonic
998526559 5:142848014-142848036 CTGTGTGTGGAGCCCCTCCCAGG - Intronic
1003761873 6:9188001-9188023 CTGTGTGTGGAGCACCCGCCTGG + Intergenic
1014307361 6:119758698-119758720 GGGAGGGTGGAGCACTGCCCAGG + Intergenic
1017643110 6:156513407-156513429 CTGTGTTTGGAGGACTCCACTGG - Intergenic
1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG + Intronic
1029172346 7:98639953-98639975 GGCTGTGAGGAGCAGTCCCCAGG - Intergenic
1032708854 7:134445203-134445225 CAGTGTGAGGAGCAGTTCCCAGG - Intronic
1035385575 7:158470391-158470413 CGCTGTGTTGAGCACCCACCGGG - Intronic
1035589485 8:802091-802113 AGGTGTGTGGACCATTCCCCAGG - Intergenic
1035637477 8:1157204-1157226 CCGTGTGTGAAGCAGTTCCCGGG + Intergenic
1037862470 8:22415678-22415700 CAGTGTGTGAAGCACTTCCTTGG + Intronic
1037961451 8:23101525-23101547 CCCTGTGTGGAGCACTGCCTAGG - Intronic
1038646286 8:29365203-29365225 CAGTGTGTGGAGGACGTCCCCGG + Intergenic
1044104599 8:88188024-88188046 CAGTGTGTTTAGGACTCCCCTGG - Intronic
1045238467 8:100377032-100377054 GGGTGTCTGTAGCTCTCCCCTGG - Intronic
1048396823 8:134021903-134021925 CAGTGTGTGGAGCTCAGCCCTGG - Intergenic
1062303742 9:135890202-135890224 ATGTGTGTGGAGCATTCCACAGG - Intronic
1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG + Intergenic
1062629151 9:137455886-137455908 GGGTGTGGGGTGGACTCCCCCGG + Intronic
1186545494 X:10444931-10444953 AAGTGTGTGAAGCACTGCCCTGG - Intergenic
1193716106 X:84936070-84936092 CTGTGTGTGCACCACTCACCTGG - Intergenic
1197810025 X:130433067-130433089 AGGAGTGTGGAGCACTTTCCTGG - Intergenic
1199601095 X:149541496-149541518 CTGTGTGTGGAGCAGTACACGGG - Exonic
1201772118 Y:17625122-17625144 GGGTGTGCTGAGGACTCCCCAGG + Intergenic
1201829437 Y:18280864-18280886 GGGTGTGCTGAGGACTCCCCAGG - Intergenic