ID: 900611606

View in Genome Browser
Species Human (GRCh38)
Location 1:3546762-3546784
Sequence CCATTGCCACCCCGCCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 87}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900611606_900611625 22 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611625 1:3546807-3546829 AGGCCGAGGTGGGGTGGCAGTGG 0: 2
1: 1
2: 6
3: 75
4: 658
900611606_900611629 28 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611629 1:3546813-3546835 AGGTGGGGTGGCAGTGGGCTGGG 0: 2
1: 6
2: 9
3: 77
4: 757
900611606_900611628 27 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611628 1:3546812-3546834 GAGGTGGGGTGGCAGTGGGCTGG 0: 2
1: 3
2: 10
3: 147
4: 1150
900611606_900611616 -1 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611616 1:3546784-3546806 GCCTGGGAAGGGGGCTGCCAGGG 0: 1
1: 3
2: 9
3: 63
4: 670
900611606_900611618 2 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611618 1:3546787-3546809 TGGGAAGGGGGCTGCCAGGGAGG 0: 3
1: 3
2: 17
3: 114
4: 791
900611606_900611626 23 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611626 1:3546808-3546830 GGCCGAGGTGGGGTGGCAGTGGG 0: 2
1: 1
2: 3
3: 46
4: 478
900611606_900611622 13 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611622 1:3546798-3546820 CTGCCAGGGAGGCCGAGGTGGGG 0: 2
1: 1
2: 11
3: 132
4: 1109
900611606_900611621 12 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611621 1:3546797-3546819 GCTGCCAGGGAGGCCGAGGTGGG 0: 2
1: 9
2: 298
3: 5004
4: 51690
900611606_900611614 -10 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611614 1:3546775-3546797 GTGGCAATGGCCTGGGAAGGGGG 0: 1
1: 2
2: 10
3: 46
4: 424
900611606_900611615 -2 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611615 1:3546783-3546805 GGCCTGGGAAGGGGGCTGCCAGG 0: 1
1: 4
2: 13
3: 95
4: 850
900611606_900611620 11 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611620 1:3546796-3546818 GGCTGCCAGGGAGGCCGAGGTGG 0: 2
1: 1
2: 24
3: 514
4: 5678
900611606_900611619 8 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611619 1:3546793-3546815 GGGGGCTGCCAGGGAGGCCGAGG 0: 2
1: 0
2: 10
3: 112
4: 895
900611606_900611624 16 Left 900611606 1:3546762-3546784 CCACCATGGCGGGGTGGCAATGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 900611624 1:3546801-3546823 CCAGGGAGGCCGAGGTGGGGTGG 0: 3
1: 1
2: 23
3: 371
4: 3123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900611606 Original CRISPR CCATTGCCACCCCGCCATGG TGG (reversed) Intronic
900155260 1:1201261-1201283 CCAGCGCGAACCCGCCATGGAGG - Intergenic
900611537 1:3546576-3546598 CCACTGCCACCCCGCCTCAGCGG - Intronic
900611606 1:3546762-3546784 CCATTGCCACCCCGCCATGGTGG - Intronic
900611642 1:3546854-3546876 CCACTGCCACCCTGCCTTGGCGG - Intronic
900668065 1:3829083-3829105 CCAATTCCACCTCTCCATGGAGG + Intronic
903364267 1:22796273-22796295 CCCTGGCCCCCCAGCCATGGGGG - Intronic
904304401 1:29578253-29578275 CCGTTGCCACCCCACAATGAAGG + Intergenic
905294795 1:36947350-36947372 CCACTGCCACCCCTCCACGCTGG + Intronic
912712878 1:111962036-111962058 CCATTGCCACCCAAGCATGAGGG + Intronic
912840538 1:113035294-113035316 CCATTCTCACCCTGCCCTGGGGG + Intergenic
914703005 1:150150552-150150574 CCATTGTCTCCTCGCCACGGCGG - Intronic
921213520 1:212919108-212919130 CCATTGCAACCACCCCATGAGGG + Intergenic
1063829879 10:9940554-9940576 CCACTGACACCCCGCGATGAGGG + Intergenic
1078360801 11:10666140-10666162 CCATCCCCACCTCTCCATGGTGG - Intronic
1082166474 11:48955838-48955860 CCACTGCCACCCCGTCTGGGAGG - Intergenic
1083713761 11:64564241-64564263 CCCTTTCCACCCCGCCCCGGGGG + Intronic
1084353124 11:68618068-68618090 CCTTTCCTACCCCGCCAAGGAGG + Intergenic
1089902061 11:121996876-121996898 CCATTGCCAGCCCCGCTTGGAGG - Intergenic
1090921479 11:131209845-131209867 CAAGTGCCAGCCCGGCATGGTGG - Intergenic
1091743562 12:2976778-2976800 CCATTGCCGCCCGGGCCTGGGGG + Intronic
1092265279 12:6976264-6976286 CCCTCTCCACCCCCCCATGGGGG + Exonic
1107597182 13:41975078-41975100 CCATAACCACCCTGCCTTGGGGG - Intergenic
1108585251 13:51865377-51865399 TCATGGCCACCCCGCCATTCCGG + Exonic
1122909497 14:104820295-104820317 CCATTGTCGGCCGGCCATGGTGG - Intergenic
1129245697 15:74277460-74277482 CCATTAACCCCCAGCCATGGAGG - Intronic
1130146732 15:81280202-81280224 CCTTTGCCACCCCCCCAGGTGGG + Intronic
1132177830 15:99729221-99729243 CCATTGCCATCGAGCCATTGGGG + Exonic
1134846549 16:17445613-17445635 CCAGTGCCGCCCCAGCATGGAGG + Intronic
1137441682 16:48503761-48503783 TGATTGCCACCCTGACATGGTGG - Intergenic
1137443137 16:48512851-48512873 CCAGTGCCACCCAGTCATGAGGG + Intergenic
1137632105 16:49954063-49954085 CCTTTGCCAGCCGGGCATGGTGG + Intergenic
1140922659 16:79553264-79553286 CCATTGCCACCTCTCCATCATGG + Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1143169857 17:4922513-4922535 CCATTGCACCCCAGCCTTGGTGG - Intergenic
1144710770 17:17400059-17400081 CCATTCCCACTCCGACAAGGAGG + Intergenic
1146341165 17:32020938-32020960 CCCTTCCCACCCCGCCAGGCCGG - Intronic
1149977396 17:61279736-61279758 CCAGTGCCACCTCACCATGGAGG - Intronic
1154008990 18:10559618-10559640 CCCTTGCCACCCTCCCAGGGTGG - Intergenic
1154367758 18:13726784-13726806 CCAGTTCCACCCCTCCACGGCGG - Intronic
1157412446 18:47474815-47474837 CCTTTCTCACCCAGCCATGGTGG - Intergenic
1157882466 18:51333624-51333646 CCATTGCCCCCTCTCCCTGGGGG + Intergenic
1158680180 18:59559951-59559973 CCATTGTCACCCTCCCATGAAGG - Intronic
1166065906 19:40358847-40358869 CCACTGCCACCCTCCCCTGGGGG + Intronic
1166894379 19:46014983-46015005 CCATTCCCACTACTCCATGGGGG - Intronic
933722529 2:85407423-85407445 CCAGTGCCAGCCAGGCATGGTGG + Intronic
935632370 2:105222705-105222727 CCATAGCCACCCTGCCATCCTGG + Intergenic
948525229 2:238567233-238567255 CCAGGGCCACCTGGCCATGGAGG - Intergenic
948821704 2:240553128-240553150 TCATTGCCAACCAGGCATGGTGG - Intronic
1171447738 20:25216773-25216795 CCGAGGCCACACCGCCATGGGGG + Intronic
1172367953 20:34363885-34363907 CCATTGTCCCCCCGGCGTGGTGG + Intronic
1172631880 20:36384088-36384110 TCATTGCCACCTCAGCATGGGGG + Intronic
1173181639 20:40810532-40810554 CCTTTACCACCCTGCCCTGGAGG + Intergenic
1176332421 21:5560629-5560651 CCATCACCACCCAGGCATGGAGG - Intergenic
1176395336 21:6260322-6260344 CCATCACCACCCAGGCATGGAGG + Intergenic
1176441821 21:6728782-6728804 CCATCACCACCCAGGCATGGAGG - Intergenic
1176466083 21:7055851-7055873 CCATCACCACCCAGGCATGGAGG - Intronic
1176489644 21:7437629-7437651 CCATCACCACCCAGGCATGGAGG - Intergenic
1179437228 21:41370106-41370128 CCTTTACCCACCCGCCATGGTGG - Intronic
1185015541 22:48340528-48340550 CCAGGGCCACACAGCCATGGAGG + Intergenic
950164146 3:10780922-10780944 CCATTGCCAACCCAGCCTGGAGG + Intergenic
953918413 3:46935397-46935419 CCATTGCCACCCTGCCTTGTGGG - Intronic
954583819 3:51717976-51717998 CCACTGCCTGCCCTCCATGGAGG + Intronic
954590059 3:51775671-51775693 CCATCCCCACCCTGCCAGGGTGG - Intergenic
954665359 3:52248530-52248552 ACAGTGCCACCCTGCCAAGGTGG - Intronic
959596284 3:108132380-108132402 CCATTTCCACCATGCCATGTGGG + Intergenic
968852830 4:3094838-3094860 CCACTGCCACCCCGTCTGGGAGG - Intronic
969570391 4:8004877-8004899 GCATTGCCACCCCTCCAAAGAGG - Intronic
975605798 4:76153091-76153113 CCACTGACTCCCCACCATGGAGG - Intergenic
989655928 5:43746286-43746308 CCACTGCCACCCCGTCTGGGAGG - Intergenic
997676123 5:135714479-135714501 CCACTGCAAGCCCGACATGGTGG - Intergenic
1002478883 5:179486299-179486321 CCATTGGCACCCGGCCCTTGGGG - Intergenic
1004590421 6:17046135-17046157 CCTCTGCCACCCAGCCATGCTGG - Intergenic
1004735218 6:18399230-18399252 CCATTCCCACCCCACCATAGTGG + Intronic
1006430651 6:33993597-33993619 CCACCCCCGCCCCGCCATGGGGG + Intergenic
1012691067 6:102311848-102311870 GCATTGCCTCCCCAGCATGGTGG - Intergenic
1014908033 6:127054547-127054569 CCATTGCCACTTTGCCAGGGTGG - Intergenic
1016014406 6:139168964-139168986 CCATCTCCACCCCTCCATGAAGG + Intronic
1016403850 6:143709598-143709620 GCCTTGTCACCCCGACATGGAGG + Intronic
1017747851 6:157462769-157462791 CCAGTGCCCCCCAGCCCTGGAGG + Intronic
1030546278 7:110900243-110900265 CCCTTGACACCCTGCCATGTAGG + Intronic
1031515256 7:122691656-122691678 CCATTGTCACCCTCCCATGAAGG + Intronic
1038150711 8:24940913-24940935 CCATCGCCACCCCAACCTGGGGG + Intergenic
1038743587 8:30236744-30236766 CCATTGAAACCCAGGCATGGTGG + Intergenic
1047710148 8:127543536-127543558 CCATTCCCTCCCTGCCATGTTGG - Intergenic
1049258675 8:141627257-141627279 CCATGGACACCCTGCCATCGGGG - Intergenic
1049619243 8:143590501-143590523 GCCTGGCCACCCCACCATGGTGG + Intronic
1049843593 8:144789139-144789161 GCATTCCCACCCCGCCATGGTGG - Intergenic
1059490968 9:114667087-114667109 CCCTTCCCACCCCCCCATAGGGG - Intergenic
1062004904 9:134234168-134234190 CCATGGCCACCCGCCCCTGGAGG - Intergenic
1203429672 Un_GL000195v1:79703-79725 CCATCACCACCCAGGCATGGAGG + Intergenic
1189732335 X:44034287-44034309 ACATGGCCACCCCTCCATGATGG + Intergenic
1190784354 X:53629715-53629737 CCATTCCCAACCAGCAATGGAGG + Intronic
1198189169 X:134286138-134286160 CCACTGCCACCCCGTCTGGGAGG - Intergenic
1200000195 X:153056258-153056280 CCCTAGCCCCCCCGCCACGGGGG - Intergenic