ID: 900613193

View in Genome Browser
Species Human (GRCh38)
Location 1:3553112-3553134
Sequence CCGCCTAACTACCAGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900613185_900613193 9 Left 900613185 1:3553080-3553102 CCTGTTCTGAGGGTACAGGGAGG 0: 1
1: 0
2: 3
3: 26
4: 242
Right 900613193 1:3553112-3553134 CCGCCTAACTACCAGGGCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 82
900613184_900613193 10 Left 900613184 1:3553079-3553101 CCCTGTTCTGAGGGTACAGGGAG 0: 1
1: 0
2: 9
3: 41
4: 290
Right 900613193 1:3553112-3553134 CCGCCTAACTACCAGGGCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 82
900613179_900613193 29 Left 900613179 1:3553060-3553082 CCTCAAAGGTAACGCACAGCCCT 0: 1
1: 0
2: 0
3: 5
4: 94
Right 900613193 1:3553112-3553134 CCGCCTAACTACCAGGGCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900613193 Original CRISPR CCGCCTAACTACCAGGGCCT TGG Intronic
900187198 1:1338021-1338043 CCGCCTGCCTACCAGGACCCGGG - Exonic
900613193 1:3553112-3553134 CCGCCTAACTACCAGGGCCTTGG + Intronic
909811447 1:79936010-79936032 CCACCTACCTACCATGGCTTAGG - Intergenic
918662734 1:187109110-187109132 CCACCTAAAAACCAGGTCCTGGG + Intergenic
920232384 1:204479312-204479334 CCTCATAACTACCATGCCCTTGG - Intronic
922213994 1:223506321-223506343 CTTCCTACCTCCCAGGGCCTGGG + Intergenic
1063023902 10:2158456-2158478 CAGCCTAGCTACCGTGGCCTGGG + Intergenic
1064264040 10:13809963-13809985 CCACCTGATTCCCAGGGCCTCGG + Intronic
1064418640 10:15171319-15171341 CAGCCTAGCCACCAGGCCCTGGG + Intergenic
1068055285 10:52005478-52005500 CTGCCTAACTACCAGTGGCAGGG - Intronic
1069560052 10:69422915-69422937 GCGCCAAACTCCCAGGGCCCAGG - Intergenic
1089298356 11:117483016-117483038 CCACCAAACAACCAGGGCCCAGG + Intronic
1091795496 12:3295438-3295460 CCTCCTGCCCACCAGGGCCTGGG - Intergenic
1095773868 12:45991216-45991238 CCGCCTGACTCCCCGAGCCTAGG + Intronic
1096718621 12:53505487-53505509 CCTTCTAACTACCAGGCCCTGGG - Intronic
1100368330 12:93942237-93942259 TCTCCTAAATTCCAGGGCCTTGG + Intergenic
1101692229 12:107093233-107093255 ACGCATAACTTCGAGGGCCTCGG + Exonic
1102396782 12:112592796-112592818 CCGCTTAACTACAAGGGTCTGGG - Intronic
1107196785 13:37661869-37661891 CCTCATAACTAGCATGGCCTAGG - Intronic
1115385143 14:32788681-32788703 CCCACTAACTACCAGGTCTTTGG + Intronic
1130118885 15:81029599-81029621 CCACCTAACTACAAGGGGGTAGG - Intronic
1133056487 16:3147927-3147949 CTGCCTTCCTTCCAGGGCCTGGG + Intronic
1133339653 16:5028093-5028115 CCGCCTGACTGCCACGGCCACGG - Exonic
1144068003 17:11641615-11641637 CCGCCAAACTTCCAGGGCTGGGG - Intronic
1144952636 17:19002434-19002456 CTGGCTAACTGACAGGGCCTTGG - Intronic
1147176759 17:38660629-38660651 CTGCCACACTACCAGGGCCATGG + Intergenic
1154030989 18:10754284-10754306 CCACCTAACTATCAGGGCTCTGG + Intronic
1155078850 18:22387795-22387817 CTCCCTACCTACCAGGCCCTTGG - Intergenic
1158337179 18:56425932-56425954 CCGCCTGACTACCAGTGGCAGGG - Intergenic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1163385827 19:16999870-16999892 CAGCCTGACCACCATGGCCTGGG - Intronic
926205086 2:10830094-10830116 CCCTCTACCTCCCAGGGCCTGGG - Intronic
929749087 2:44691322-44691344 CAGCCCTACGACCAGGGCCTCGG + Intronic
930455993 2:51608017-51608039 ATGTCTAACAACCAGGGCCTGGG - Intergenic
931747028 2:65299601-65299623 ACGCCTAACTGCAAGGGACTTGG + Intergenic
933728409 2:85438944-85438966 CGGCCTAAGTACCTGGGCCCAGG - Intergenic
935201403 2:100859710-100859732 TGGCAAAACTACCAGGGCCTTGG - Intronic
937150611 2:119683282-119683304 CGTCCTAGGTACCAGGGCCTGGG - Intronic
937267951 2:120629284-120629306 CCTCCTACCTACCAGGTGCTGGG + Intergenic
937312536 2:120910952-120910974 CCACCTCCTTACCAGGGCCTGGG + Intronic
944846386 2:203672461-203672483 CAGCCTAGCCACCAGGCCCTGGG + Intergenic
944866859 2:203870885-203870907 CCGCCATACTACCTGGGCATAGG + Exonic
946689246 2:222298487-222298509 CCGCCTGGATCCCAGGGCCTGGG - Intronic
1169852723 20:10070210-10070232 CCACCTAACTACAAGGGAATGGG - Intergenic
1173363326 20:42363899-42363921 CAGTCTTACTTCCAGGGCCTGGG + Intronic
1179574583 21:42299785-42299807 CCCCCTCACCCCCAGGGCCTGGG - Intergenic
1180024043 21:45148449-45148471 CTGCCTTAGCACCAGGGCCTGGG + Intronic
1182706879 22:32288281-32288303 CCACCTAACTACCAGGTAGTAGG - Intergenic
1184070449 22:42143430-42143452 GCGCCCATCTACCAGGTCCTGGG - Intergenic
1184072182 22:42153049-42153071 GCGCCCATCTACCAGGTCCTGGG - Intergenic
1184395203 22:44231396-44231418 CCACCTAACTACCAGGAAGTAGG - Intergenic
949543319 3:5051139-5051161 CCTCCTAAGTACCAGGCACTGGG + Intergenic
950154061 3:10708779-10708801 CCACCTGACTCCCAGTGCCTGGG + Intergenic
956192443 3:66620692-66620714 CAGCCCAACTGCCAGGCCCTGGG - Intergenic
956671421 3:71695021-71695043 CTGGCTAACTGCCATGGCCTTGG - Intronic
958815890 3:98915122-98915144 CCGGCTAACCTCCAGGACCTGGG - Intergenic
965747229 3:171938119-171938141 CTGCATAACTACCTGGGCCGTGG - Intronic
980087711 4:128409126-128409148 CAGCATAACTACCAGGCTCTGGG + Intergenic
985823512 5:2177194-2177216 CCTCCTTCTTACCAGGGCCTAGG - Intergenic
996404671 5:123093882-123093904 CCGCCTCCCTCCCAGGTCCTAGG - Intronic
997323827 5:133003058-133003080 CAGCCTAGCCACCAGGCCCTGGG - Intronic
1002302975 5:178268036-178268058 CCGCCCAACCACCAGGGCTGCGG - Intronic
1002484317 5:179524109-179524131 CCTCCTTCCTACCAGGACCTAGG + Intergenic
1002500256 5:179643379-179643401 CCTTCTTCCTACCAGGGCCTAGG - Intronic
1002501716 5:179651382-179651404 CCTCCTTCCTACCAGGACCTAGG + Intergenic
1004722195 6:18277386-18277408 TCGCCTAGCTACCAGCCCCTTGG - Intergenic
1004999337 6:21225029-21225051 CCTCCTAGGTACCAGGTCCTGGG + Intronic
1007465691 6:42049596-42049618 CCGCCTCACTCCCAGGGCGTGGG - Intronic
1008374251 6:50773455-50773477 CCGCTTAACTACCAGTGCCTTGG + Intergenic
1018286003 6:162238586-162238608 CCACTTAACTCCCAGGGTCTTGG - Intronic
1018892650 6:167993821-167993843 CCTCCTACCTAGCAGGGTCTCGG - Intergenic
1020429678 7:8106288-8106310 CTGCCTAATTGCAAGGGCCTGGG - Intergenic
1024023649 7:45392327-45392349 CCGCCTGGGAACCAGGGCCTGGG - Intergenic
1024275182 7:47671538-47671560 CCGCCTAACCCCCCGGGGCTGGG + Intergenic
1024566138 7:50682366-50682388 CCACCTAAATCCCAGAGCCTGGG - Intronic
1025779012 7:64582772-64582794 CCCCCCAGCTGCCAGGGCCTCGG - Intergenic
1029424049 7:100485719-100485741 CCGCCTCTCTCCCAGGGTCTAGG + Intronic
1029949985 7:104573647-104573669 CCTCCTAACAGCCAGGGCCTGGG + Intronic
1040573205 8:48627470-48627492 CAGCCCAGCTTCCAGGGCCTGGG + Intergenic
1042932257 8:74025208-74025230 CCTACTACCCACCAGGGCCTGGG - Intronic
1044281785 8:90365019-90365041 CCACCTAACTGCCAGGGAGTTGG + Intergenic
1044452338 8:92352184-92352206 CAGCCTAGCCACCAGGCCCTGGG + Intergenic
1047438607 8:124856926-124856948 CAGCCTACCTCCCAGGGCGTGGG - Intergenic
1049707810 8:144050927-144050949 CCGCCCCCCTACCAGGGCCCTGG + Intergenic
1050126269 9:2359458-2359480 CCGCATATCAAACAGGGCCTTGG + Intergenic
1050598534 9:7227770-7227792 TCACCTAACTGCCAGGGGCTGGG - Intergenic
1196467008 X:115983006-115983028 GTGCCTAACCACCAGGGCCCTGG + Intergenic
1202149918 Y:21835294-21835316 TTGCCTAACTACAAGGCCCTTGG + Intergenic