ID: 900613312

View in Genome Browser
Species Human (GRCh38)
Location 1:3553483-3553505
Sequence GTGGGGAGGCCTCTCTCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900613312_900613317 -9 Left 900613312 1:3553483-3553505 CCACGGGAGAGAGGCCTCCCCAC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 900613317 1:3553497-3553519 CCTCCCCACACCCCAGGCAGGGG 0: 1
1: 0
2: 15
3: 122
4: 831
900613312_900613315 -10 Left 900613312 1:3553483-3553505 CCACGGGAGAGAGGCCTCCCCAC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 900613315 1:3553496-3553518 GCCTCCCCACACCCCAGGCAGGG 0: 1
1: 1
2: 4
3: 70
4: 655
900613312_900613324 9 Left 900613312 1:3553483-3553505 CCACGGGAGAGAGGCCTCCCCAC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 900613324 1:3553515-3553537 AGGGGAGCTGTCCTCAGAGATGG 0: 1
1: 0
2: 3
3: 42
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900613312 Original CRISPR GTGGGGAGGCCTCTCTCCCG TGG (reversed) Intronic