ID: 900613315

View in Genome Browser
Species Human (GRCh38)
Location 1:3553496-3553518
Sequence GCCTCCCCACACCCCAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 1, 2: 4, 3: 70, 4: 655}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900613308_900613315 12 Left 900613308 1:3553461-3553483 CCATGCAGGATAGAGGCTGGAGC 0: 1
1: 0
2: 3
3: 19
4: 242
Right 900613315 1:3553496-3553518 GCCTCCCCACACCCCAGGCAGGG 0: 1
1: 1
2: 4
3: 70
4: 655
900613306_900613315 17 Left 900613306 1:3553456-3553478 CCTCACCATGCAGGATAGAGGCT 0: 1
1: 0
2: 0
3: 12
4: 163
Right 900613315 1:3553496-3553518 GCCTCCCCACACCCCAGGCAGGG 0: 1
1: 1
2: 4
3: 70
4: 655
900613312_900613315 -10 Left 900613312 1:3553483-3553505 CCACGGGAGAGAGGCCTCCCCAC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 900613315 1:3553496-3553518 GCCTCCCCACACCCCAGGCAGGG 0: 1
1: 1
2: 4
3: 70
4: 655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900613315 Original CRISPR GCCTCCCCACACCCCAGGCA GGG Intronic