ID: 900613317

View in Genome Browser
Species Human (GRCh38)
Location 1:3553497-3553519
Sequence CCTCCCCACACCCCAGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 969
Summary {0: 1, 1: 0, 2: 15, 3: 122, 4: 831}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900613308_900613317 13 Left 900613308 1:3553461-3553483 CCATGCAGGATAGAGGCTGGAGC 0: 1
1: 0
2: 3
3: 19
4: 242
Right 900613317 1:3553497-3553519 CCTCCCCACACCCCAGGCAGGGG 0: 1
1: 0
2: 15
3: 122
4: 831
900613312_900613317 -9 Left 900613312 1:3553483-3553505 CCACGGGAGAGAGGCCTCCCCAC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 900613317 1:3553497-3553519 CCTCCCCACACCCCAGGCAGGGG 0: 1
1: 0
2: 15
3: 122
4: 831
900613306_900613317 18 Left 900613306 1:3553456-3553478 CCTCACCATGCAGGATAGAGGCT 0: 1
1: 0
2: 0
3: 12
4: 163
Right 900613317 1:3553497-3553519 CCTCCCCACACCCCAGGCAGGGG 0: 1
1: 0
2: 15
3: 122
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900613317 Original CRISPR CCTCCCCACACCCCAGGCAG GGG Intronic