ID: 900613324

View in Genome Browser
Species Human (GRCh38)
Location 1:3553515-3553537
Sequence AGGGGAGCTGTCCTCAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 306}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900613318_900613324 -8 Left 900613318 1:3553500-3553522 CCCCACACCCCAGGCAGGGGAGC 0: 1
1: 0
2: 3
3: 67
4: 875
Right 900613324 1:3553515-3553537 AGGGGAGCTGTCCTCAGAGATGG 0: 1
1: 0
2: 3
3: 42
4: 306
900613312_900613324 9 Left 900613312 1:3553483-3553505 CCACGGGAGAGAGGCCTCCCCAC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 900613324 1:3553515-3553537 AGGGGAGCTGTCCTCAGAGATGG 0: 1
1: 0
2: 3
3: 42
4: 306
900613319_900613324 -9 Left 900613319 1:3553501-3553523 CCCACACCCCAGGCAGGGGAGCT 0: 1
1: 0
2: 5
3: 46
4: 357
Right 900613324 1:3553515-3553537 AGGGGAGCTGTCCTCAGAGATGG 0: 1
1: 0
2: 3
3: 42
4: 306
900613316_900613324 -5 Left 900613316 1:3553497-3553519 CCTCCCCACACCCCAGGCAGGGG 0: 1
1: 1
2: 8
3: 114
4: 885
Right 900613324 1:3553515-3553537 AGGGGAGCTGTCCTCAGAGATGG 0: 1
1: 0
2: 3
3: 42
4: 306
900613320_900613324 -10 Left 900613320 1:3553502-3553524 CCACACCCCAGGCAGGGGAGCTG 0: 1
1: 1
2: 8
3: 75
4: 601
Right 900613324 1:3553515-3553537 AGGGGAGCTGTCCTCAGAGATGG 0: 1
1: 0
2: 3
3: 42
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900613324 Original CRISPR AGGGGAGCTGTCCTCAGAGA TGG Intronic