ID: 900614107

View in Genome Browser
Species Human (GRCh38)
Location 1:3556751-3556773
Sequence CAGTGAAAACACAAGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2151
Summary {0: 1, 1: 0, 2: 8, 3: 139, 4: 2003}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900614103_900614107 13 Left 900614103 1:3556715-3556737 CCTTCAAAACAGGACACTGGAGA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG 0: 1
1: 0
2: 8
3: 139
4: 2003

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900614107 Original CRISPR CAGTGAAAACACAAGGATGC AGG Intronic
Too many off-targets to display for this crispr