ID: 900615410

View in Genome Browser
Species Human (GRCh38)
Location 1:3563437-3563459
Sequence CTGGAGTCACAGCTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 462}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900615394_900615410 25 Left 900615394 1:3563389-3563411 CCACAGACCAGGCCACGCCCCAG 0: 1
1: 0
2: 3
3: 57
4: 454
Right 900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG 0: 1
1: 0
2: 3
3: 49
4: 462
900615395_900615410 18 Left 900615395 1:3563396-3563418 CCAGGCCACGCCCCAGCTATAGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG 0: 1
1: 0
2: 3
3: 49
4: 462
900615403_900615410 -10 Left 900615403 1:3563424-3563446 CCCCTCGTCGTAGCTGGAGTCAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG 0: 1
1: 0
2: 3
3: 49
4: 462
900615400_900615410 6 Left 900615400 1:3563408-3563430 CCAGCTATAGGTCCGTCCCCTCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG 0: 1
1: 0
2: 3
3: 49
4: 462
900615393_900615410 30 Left 900615393 1:3563384-3563406 CCTGTCCACAGACCAGGCCACGC 0: 1
1: 0
2: 2
3: 11
4: 141
Right 900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG 0: 1
1: 0
2: 3
3: 49
4: 462
900615398_900615410 8 Left 900615398 1:3563406-3563428 CCCCAGCTATAGGTCCGTCCCCT 0: 1
1: 0
2: 0
3: 1
4: 57
Right 900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG 0: 1
1: 0
2: 3
3: 49
4: 462
900615397_900615410 13 Left 900615397 1:3563401-3563423 CCACGCCCCAGCTATAGGTCCGT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG 0: 1
1: 0
2: 3
3: 49
4: 462
900615402_900615410 -6 Left 900615402 1:3563420-3563442 CCGTCCCCTCGTCGTAGCTGGAG 0: 1
1: 0
2: 1
3: 2
4: 79
Right 900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG 0: 1
1: 0
2: 3
3: 49
4: 462
900615399_900615410 7 Left 900615399 1:3563407-3563429 CCCAGCTATAGGTCCGTCCCCTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG 0: 1
1: 0
2: 3
3: 49
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900615410 Original CRISPR CTGGAGTCACAGCTGGGGCA GGG Intronic
900030278 1:366393-366415 CTAGAGCCACAGCTGATGCATGG - Intergenic
900050932 1:595457-595479 CTAGAGCCACAGCTGATGCATGG - Intergenic
900161842 1:1227618-1227640 CTGGAGGCAGAGCAGGGTCAGGG - Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900593837 1:3471572-3471594 CTGGGGGCAGAGCTGGGGGAGGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
901012192 1:6208205-6208227 CTGGAGTCACACTTGGGGGCGGG - Intronic
901229342 1:7633323-7633345 CAGGAGGCACAGCTGGGTTAAGG + Intronic
901284207 1:8063742-8063764 CGGGAGTTACAGCTTGGGCTAGG + Intergenic
901634149 1:10662945-10662967 CTGGGGTCACGGCTCGGCCATGG - Intronic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
903658297 1:24962106-24962128 CTGGTATCACAGCGGGGTCAGGG + Intronic
904046921 1:27614731-27614753 CTGGAGGCACAGCTGATGCAGGG + Intronic
904214074 1:28905608-28905630 CTGGAGTCAGAGATCAGGCATGG - Intronic
904373643 1:30066255-30066277 GTGGAGGCAGGGCTGGGGCACGG - Intergenic
904756207 1:32770156-32770178 CTGGATTGACAGGAGGGGCAGGG + Exonic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
905548003 1:38815563-38815585 CTGAAGTCACAGCTGAGACTTGG + Intergenic
905682719 1:39885703-39885725 CTGCAGTCCCAGCTGGGGTGGGG - Intergenic
906034065 1:42740090-42740112 CAGGACTCAGAGCTGGGCCAGGG + Exonic
906102890 1:43274361-43274383 CTGGTTTCAGAGGTGGGGCAGGG - Intergenic
906448166 1:45921720-45921742 CAGGAGTCACAGCTCAGGCTCGG + Intronic
906731824 1:48089506-48089528 CTGGAGTTCCAGCTGGTGCCCGG + Intergenic
907103538 1:51859503-51859525 CAGGAGGCAAAGCTAGGGCAGGG - Intronic
907445936 1:54507740-54507762 TGGGAGTCACAGCTGGGGGCGGG + Intergenic
908525611 1:64984886-64984908 CTGCCATCACAGCTGGGCCAGGG + Intergenic
911620754 1:100064533-100064555 TTGGGGTCACAGGTGGAGCATGG - Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
914451643 1:147798069-147798091 CTGCAGTCACAGCTGGGCTCAGG + Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915527697 1:156486219-156486241 CTGGGGTCACAGGTGAGGAATGG - Intronic
915556430 1:156663423-156663445 CTGGAGACACAGCTGAGTCATGG + Intergenic
915590251 1:156866569-156866591 CTGAGGCCACAGCTGGGGGAAGG - Intronic
916091332 1:161309896-161309918 CAGGAGCCATAGCTGGGGCAGGG + Exonic
917647796 1:177046198-177046220 TTGGAGTTACAGCTGGTGCCAGG - Intronic
919761575 1:201101524-201101546 CAGGGGTCCCGGCTGGGGCAGGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
921067066 1:211630760-211630782 CTGGATTCTCAGCTGGGGTGGGG - Intergenic
921385781 1:214568436-214568458 CAGGACTCACAGCTAGGCCATGG + Intergenic
921939887 1:220828420-220828442 GTGGAGCCACAGCTGAGGCATGG - Intergenic
922847704 1:228702424-228702446 CAGGAGGCAAAGCTGGGCCAGGG + Intergenic
923022395 1:230175035-230175057 CTAGAGACACAGCAGGGGCCAGG - Intronic
923445569 1:234067717-234067739 CTGGAGGCTCAGCTCGGGCTAGG - Intronic
923593055 1:235337704-235337726 CTGTAGTCCCAGCTGAGGCACGG + Intronic
923864039 1:237919666-237919688 CTGGCGTCACAGCTAGACCAAGG + Intergenic
1063666173 10:8061960-8061982 CTGCAGTCCTAGCTGGGACAGGG + Intronic
1065923192 10:30411475-30411497 CTGCAGTCAGGGCTGGGGGAAGG - Intergenic
1067421802 10:46158680-46158702 CGGGAGTCACAGCTCTGGCCTGG + Intergenic
1067507108 10:46864769-46864791 CGGGAGTCACAGCTCTGGCCTGG + Intergenic
1067565070 10:47330586-47330608 CTGGAGGCAGCGCTGGGCCAGGG - Intergenic
1067948280 10:50705457-50705479 CTGGGGTAAAAACTGGGGCATGG - Intergenic
1068604271 10:58988463-58988485 CTGGACTCACACCTGTGGGATGG - Intergenic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1068989215 10:63133648-63133670 CTGGAGCCGCAGTTGGGCCAGGG - Intronic
1069800086 10:71076561-71076583 CTGCAGTGACAGCTGAGACAGGG - Intergenic
1069900152 10:71702340-71702362 TAGGAGTCACAACTGGGGCGTGG - Intronic
1071389236 10:85154276-85154298 CCAGAGGCACAGCTGGGCCAGGG - Intergenic
1071526172 10:86360627-86360649 ATGGATTCACAGTTGGGTCAAGG + Intronic
1071650154 10:87386762-87386784 CTGGGGTAAAAACTGGGGCATGG - Intergenic
1072972408 10:100028690-100028712 TAGGAGGCAAAGCTGGGGCAGGG - Intergenic
1073118689 10:101108200-101108222 GAGGGGTCACAGCAGGGGCAGGG + Intronic
1073774139 10:106767265-106767287 CTTCAGTGACAGCTGGGGAATGG - Intronic
1076115107 10:127890033-127890055 CTGCACTCACTGCTGGAGCATGG - Intronic
1076443667 10:130497455-130497477 CTGGGGTTACAGCAGAGGCATGG + Intergenic
1076491662 10:130866006-130866028 CTGGGCTCACATCTGTGGCAGGG - Intergenic
1076744871 10:132507774-132507796 CTGGAGCCAGGGATGGGGCAAGG + Intergenic
1076744896 10:132507922-132507944 CTGGAGCCACAGCAGGGTCACGG + Intergenic
1076870348 10:133189832-133189854 CTGGGGGCAGGGCTGGGGCAGGG - Intronic
1077877537 11:6320555-6320577 CCTGAGTCACAGCTGGAGCTGGG - Exonic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1080447663 11:32352306-32352328 CGTGAGTCACCGGTGGGGCAGGG + Intergenic
1080587600 11:33695657-33695679 CAGGAGTTACATCTGTGGCATGG - Intergenic
1081330512 11:41794278-41794300 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1081577765 11:44329923-44329945 CTGGAGTCACAGCTGGCACTTGG - Intergenic
1081711924 11:45222679-45222701 CTGAAGTCAAACATGGGGCAGGG + Intronic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1082764045 11:57152463-57152485 CAGGTGTCACAGCTAAGGCAAGG + Intergenic
1083006877 11:59355335-59355357 CAGGAGTCACAGCTCAGCCAAGG + Intergenic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1083995882 11:66272061-66272083 TCGGAGACCCAGCTGGGGCAGGG + Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084222755 11:67694400-67694422 CTGGAGTGGCAGCTGGGTCAGGG + Intergenic
1084336587 11:68461144-68461166 CTGGAGCCAGAGCCGGGTCAGGG - Intronic
1084392488 11:68887147-68887169 CAGGAGGCAGAGCTGGGCCAGGG + Intergenic
1084950398 11:72662135-72662157 CTGGAGGAGAAGCTGGGGCAGGG + Intronic
1085181002 11:74535976-74535998 ATGGAGTCACAGCTGGCTCCAGG + Intronic
1085331135 11:75652368-75652390 CAGAAGGGACAGCTGGGGCATGG - Intronic
1085449013 11:76620574-76620596 CTGGAACCCCAGCAGGGGCATGG + Intergenic
1087016799 11:93561831-93561853 CTGGACCCACAGCCAGGGCAGGG + Intergenic
1087913526 11:103780925-103780947 CTGTAGTCCCAGCTAGGGCGTGG - Intergenic
1088625555 11:111727783-111727805 CTGGAGTCACAGTTGGTCCCAGG + Exonic
1089009149 11:115118788-115118810 CTTGAGGAACAGCAGGGGCAAGG - Intergenic
1089294469 11:117459447-117459469 CTGGACTCCCAGTTGGGGTAAGG + Intronic
1089301940 11:117504214-117504236 CTTGCATCAGAGCTGGGGCAAGG - Intronic
1089340022 11:117750930-117750952 CAGACTTCACAGCTGGGGCAGGG - Intronic
1089447509 11:118565445-118565467 CTGGAGTCACCTCTGGGGTGGGG + Intronic
1089523977 11:119084774-119084796 CTCATGTCACAGCTGGGGAATGG + Intergenic
1089751433 11:120654154-120654176 CTGTAGTCAAAGCAGGGGCCTGG + Intronic
1090175231 11:124642968-124642990 CTGGAGTCTCATCTGAGGCTTGG - Intronic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090425186 11:126602669-126602691 GCGGATCCACAGCTGGGGCAGGG - Intronic
1090820167 11:130334977-130334999 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091218283 11:133916812-133916834 GAGGAGTCACAGCTGGGACAGGG + Intronic
1091466854 12:692255-692277 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091789159 12:3261482-3261504 CGGGAGTCACAGCTTGGACCTGG - Intronic
1091893919 12:4084879-4084901 CGGGAGGCACCACTGGGGCAGGG - Intergenic
1092281596 12:7101794-7101816 CTTGAGTGACAGCTGAGGCTGGG - Intronic
1093387002 12:18569296-18569318 ATGGAGTCCCAGCTGGGGACTGG - Intronic
1095478335 12:42608897-42608919 CTGGTTTCACAGCTGGGCCCTGG + Intergenic
1095756037 12:45768347-45768369 CTGGATTACAAGCTGGGGCATGG - Intronic
1096604003 12:52752128-52752150 TTGGAAGCTCAGCTGGGGCAGGG + Intergenic
1097249535 12:57624947-57624969 CTGGAGTGGCACCTGGGGCTCGG + Exonic
1098848387 12:75565851-75565873 ATGGAGTAACAGATGGGGGAAGG + Intergenic
1099422926 12:82485581-82485603 TTGGAGTCCTCGCTGGGGCATGG + Intergenic
1100707120 12:97212959-97212981 CTTGAGTCTGAGCTGGGTCAAGG + Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101728827 12:107410037-107410059 CTGGAACCTCAGCTGGGCCAGGG - Intronic
1101963333 12:109265801-109265823 CCAAAGTCACAGCTGGAGCAGGG + Intronic
1102470224 12:113155541-113155563 ATCGAGCCACGGCTGGGGCAAGG - Intronic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1104702957 12:130921146-130921168 CAGGAATCACAGCTGAGGCCAGG + Intergenic
1104729577 12:131097592-131097614 CTGGAGTCACAGATCCGCCAGGG + Intronic
1105975556 13:25469155-25469177 GTGGAGTCACAGCTGGGAAGGGG + Intronic
1107255745 13:38424955-38424977 CAGGAGGCAAAGCTGGGGCAGGG + Intergenic
1108062167 13:46544299-46544321 CTGTAGTCAGAGCTGGTCCAAGG - Intergenic
1108321244 13:49292945-49292967 CTGCAGTCACAGCCCTGGCATGG - Exonic
1108869986 13:54973019-54973041 CAAGAGGCACAGCTGGGCCAGGG + Intergenic
1111970081 13:94902895-94902917 CCAGAGTCAAAGCTGGGCCAGGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112805168 13:103156789-103156811 GTGCAGGCAAAGCTGGGGCAGGG - Intergenic
1113038110 13:106073625-106073647 TTGGAGTGACATCTGGGGAAAGG + Intergenic
1113822607 13:113225722-113225744 CTGGAGTCAGAGCTGCAGGATGG + Intronic
1113856819 13:113451056-113451078 CTGGCGTCACAGCTAGACCAAGG + Intronic
1113860635 13:113483604-113483626 GTGGAGTCAGCGATGGGGCAGGG - Intronic
1113884599 13:113651986-113652008 CAGGAGGCAGAGCTGGGGCGGGG + Intronic
1115715118 14:36094924-36094946 CTGCAGTTGCTGCTGGGGCAAGG + Intergenic
1117285613 14:54283115-54283137 GGGGAGGCACAGCTGGGGCTGGG - Intergenic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1119190110 14:72675620-72675642 CTGGAGGCAAAGCAGAGGCATGG - Intronic
1119264519 14:73256070-73256092 CTGGTGCCTCAGCTGGGGCCTGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121050524 14:90816538-90816560 CCGGAGCCAGGGCTGGGGCAGGG + Intergenic
1121638300 14:95468422-95468444 CTGGAGGCTCAGCTGGGCCCTGG - Intronic
1121676071 14:95754046-95754068 CTGGCGTCAGATCTTGGGCATGG - Intergenic
1122138893 14:99650389-99650411 GTGGACTCACAGGTGGGGGAGGG + Intronic
1124663518 15:31570727-31570749 CTGGCATCACACCTGGTGCAGGG - Intronic
1125731921 15:41897331-41897353 CGGGAGTCACAGCCGCGGCCTGG - Exonic
1126096747 15:45095630-45095652 CTGGTCTCAGAGCTGGGGCAGGG - Intronic
1127727891 15:61768279-61768301 CTGGTGTCAGAGCTGGGGCAGGG - Intergenic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1129661494 15:77555402-77555424 GTGAAGGCCCAGCTGGGGCAGGG - Intergenic
1129670937 15:77607386-77607408 CTGGGGTCACATATAGGGCATGG + Intergenic
1130313031 15:82771474-82771496 GTGGGGTTACAGCTGGGGTAGGG - Intronic
1131515531 15:93073868-93073890 CTGGAGTGGCAGCTGTGCCAAGG - Exonic
1131872345 15:96775753-96775775 GGGGAGTCAGAGCTGGGTCAAGG - Intergenic
1132256996 15:100384525-100384547 TTGCTGTCACAGCTGGGGCCTGG - Intergenic
1132646847 16:1003172-1003194 CTGGAGCCAGGGCTGGGCCAAGG + Intergenic
1132693935 16:1193839-1193861 CTGGAGTGACAGGTGGGGGCAGG + Intronic
1133099500 16:3470571-3470593 CTGCAGTCACAGCAGGCCCAAGG - Intronic
1133161217 16:3913035-3913057 CTGCAGTTTCAGCTGGGGCTGGG - Intergenic
1133233162 16:4375889-4375911 CTGGCGTCACAGGTGGGAGACGG + Intronic
1133277548 16:4647927-4647949 CTGGAATCACTGTTGGGGCCCGG + Intronic
1133640182 16:7709178-7709200 CTGAGGTCCCAGCTGGGGAAAGG - Intronic
1134247687 16:12552231-12552253 TAGGAGGCAAAGCTGGGGCATGG - Intronic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1134548082 16:15125622-15125644 CTGGAGTCCAAGCTGCGCCAAGG + Intronic
1134720271 16:16377103-16377125 CTGGAGTCCAAGCTGCGCCAAGG - Intergenic
1134947156 16:18334782-18334804 CTGGAGTCCAAGCTGCGCCAAGG + Exonic
1135356594 16:21774085-21774107 GAGGATTCACACCTGGGGCAAGG - Intergenic
1135455094 16:22590228-22590250 GAGGATTCACACCTGGGGCAAGG - Intergenic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136240018 16:28937870-28937892 CTGGTGTCAGAGCTGAGGCCAGG - Intronic
1138531333 16:57635957-57635979 CACGAGGCAGAGCTGGGGCAGGG - Intronic
1141268894 16:82521360-82521382 CGGGGCTGACAGCTGGGGCATGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142138789 16:88463407-88463429 CTGGGGTCACATCCGGGGGAGGG - Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1142990066 17:3724344-3724366 CCGGAGTCGCGGCTGGGGAAGGG - Exonic
1143308886 17:5971919-5971941 CTGGAGTTCAAGGTGGGGCAGGG + Intronic
1143518092 17:7429981-7430003 CTGGCGTCTGAGCTGGGGTAGGG - Intergenic
1143962677 17:10733647-10733669 CTGGAATCACAGCAAGGGGAGGG - Intergenic
1144956062 17:19019528-19019550 CTGCAGTCACTGGTGGGGCCAGG - Exonic
1145017665 17:19409776-19409798 CTGAAGGCAGAGCTGTGGCACGG + Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1147332358 17:39706435-39706457 CTGGAGTTGCAGCTGAGGCATGG - Intronic
1147661868 17:42121142-42121164 CTGGGGCTGCAGCTGGGGCAGGG + Exonic
1147661892 17:42121214-42121236 CAGGAGTCGGAGTTGGGGCAGGG + Exonic
1147900162 17:43778659-43778681 CGGGAGCCACAGCGGGGGCTTGG - Intronic
1148623933 17:49054677-49054699 CTGGAGTGAGACCTGGGGCTTGG + Exonic
1150131319 17:62670729-62670751 AAGGAGTCCCAGCTGGGGGATGG + Intronic
1150136381 17:62697540-62697562 CAGGTTTCACAGCTGGGGGAGGG + Intergenic
1151225985 17:72648747-72648769 CTGGGGTCCCAGCTGGGACTGGG + Intronic
1151264705 17:72945815-72945837 ATGGAGTCACAGCCGGGACGGGG - Intronic
1151386004 17:73755820-73755842 CTGGAGCCTCAGCTGAGGCCTGG - Intergenic
1151823811 17:76512526-76512548 CTGGAGTGACATCTGGGCCAAGG - Intergenic
1151828056 17:76534729-76534751 CTGGAGAGACAGCTGTGCCAGGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152068575 17:78124405-78124427 CTGGAGTCACAGCGGGGCAAGGG + Intronic
1152085112 17:78213363-78213385 CTGGAGTCACTTCTGGAGCTGGG - Intergenic
1152246726 17:79188350-79188372 CTGCAGTCTCTGCTGGGGCCAGG - Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152422718 17:80202785-80202807 TGGTTGTCACAGCTGGGGCATGG - Intronic
1152434122 17:80264744-80264766 CCTGAGTTACAGCGGGGGCAGGG - Intronic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152690596 17:81716126-81716148 CTGGAGCCTCAGCTGGGTCACGG - Intronic
1152725227 17:81941783-81941805 CTGGGGTCCCTGCTGGGCCAAGG + Exonic
1152949480 17:83220164-83220186 CTAGAGCCACAGCTGATGCATGG + Intergenic
1154260472 18:12827505-12827527 CTGGAGTCCCAGCTGGGGTTGGG - Intronic
1156354863 18:36332239-36332261 CTGGGGCCACAGCTGCTGCAGGG - Intronic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1157437730 18:47685248-47685270 CAGGAGTGACTGCTGGGGCAAGG + Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160411553 18:78678506-78678528 CTGGAGCCCCAGAGGGGGCAGGG - Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160571547 18:79820769-79820791 CTGGAGTCCCAGCTGCTCCAGGG - Intergenic
1160748561 19:722940-722962 GTGGGGTCACCTCTGGGGCATGG + Intronic
1161267958 19:3373747-3373769 CTGGATCCAGATCTGGGGCAGGG - Intronic
1161440325 19:4287849-4287871 GTTGGGTCACAGCTGGTGCATGG - Intronic
1161685335 19:5699846-5699868 CAGGAGTCAGAGCCTGGGCATGG - Intronic
1161709329 19:5838963-5838985 TTGAAGCCACAGGTGGGGCAAGG - Exonic
1161798896 19:6404394-6404416 CTGGGGTCCCAGATGGGGCTAGG - Intergenic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162100518 19:8335793-8335815 CTGGAGGCACGACGGGGGCACGG + Intronic
1163261820 19:16195524-16195546 CTGTAGTCCCAGCTGAGCCAAGG + Intergenic
1163476039 19:17526812-17526834 CTGAGGTCAGTGCTGGGGCAGGG - Intronic
1163517267 19:17772584-17772606 CTGGGGTCACTGCTGGGCAAAGG + Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1164403386 19:27919175-27919197 CTGTAGTCACAGCCTGGTCATGG - Intergenic
1164535664 19:29084947-29084969 CTGAAGTCTGAGCTGGGCCAGGG - Intergenic
1164771257 19:30811021-30811043 CTAGAATCAAAGCTGGGGGAGGG - Intergenic
1165048594 19:33126374-33126396 CTGGAGGCGCAGCTGGGTCAGGG + Intronic
1165148643 19:33748521-33748543 CTGGGGTCCCAGCTGGGGAGGGG + Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165689342 19:37851182-37851204 CCGGTGTCAGAGCTGGGGCATGG + Intergenic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166741062 19:45115088-45115110 CTGGGGACACAGCAGTGGCAAGG + Intronic
1166844487 19:45718302-45718324 CTGGAGTGTGAGCTGGAGCAGGG + Intronic
1166898033 19:46036288-46036310 CTGCAGCCACAACTTGGGCAGGG - Intergenic
1166916018 19:46196571-46196593 CTGGAGGCTCAGCTGGGGTCGGG - Intergenic
1167096031 19:47375560-47375582 CTGGCGTTTCAGCTGGTGCAGGG - Exonic
1168215253 19:54920426-54920448 ATAGAGTCACATCTGGGGTAGGG - Intergenic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168266590 19:55226957-55226979 CTGGAGTCAGAACCGGGGGAAGG + Exonic
1168288827 19:55347308-55347330 CTGGGGTCCCAGCAGGGGCTGGG - Exonic
925041898 2:738706-738728 CTGGCCTCAGGGCTGGGGCAGGG + Intergenic
926134048 2:10324367-10324389 CTGGAGTCAGGTCTGGGGCCAGG + Intronic
926808596 2:16736203-16736225 CTTGGATCACAGCTGTGGCAAGG + Intergenic
927842637 2:26455265-26455287 CGGGAGACACGGGTGGGGCAGGG + Intronic
928170683 2:29001137-29001159 CTTGAGCCCCAGCTGGGTCAGGG - Intronic
929571645 2:43026710-43026732 CTGGGGTCATAGCTGGTGCCTGG - Intergenic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
931500168 2:62856292-62856314 CGGGAGTCACAGCCCTGGCATGG - Intronic
931986861 2:67750635-67750657 CTGTACTCCCAGCTGAGGCAGGG + Intergenic
932265640 2:70365092-70365114 ATGGAGTCACAGCTGGGGGGTGG + Intergenic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
935061569 2:99612731-99612753 CTGGAATCTGAGCTGGTGCACGG + Intronic
936021873 2:109001350-109001372 GTGGGGTCACAGTAGGGGCAGGG + Intergenic
936080506 2:109429633-109429655 CCTGGGGCACAGCTGGGGCAGGG - Intronic
937093223 2:119220415-119220437 CAGCAGTCAGAGCTGAGGCAGGG - Intergenic
937162764 2:119781194-119781216 CTGATTTCAGAGCTGGGGCAAGG - Intronic
937430773 2:121836191-121836213 CTGGAGAGACCCCTGGGGCAGGG - Intergenic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938081989 2:128374957-128374979 GTGGAGGCACAGGTGGTGCAGGG + Intergenic
938199543 2:129361857-129361879 CAGGAGCCTCAGCTGGTGCATGG + Intergenic
938630801 2:133165064-133165086 CGGGTGTCACAGCTGGGGATGGG + Intronic
938919798 2:135985235-135985257 CTGGCCCCACTGCTGGGGCAAGG + Intronic
938923560 2:136018119-136018141 CTGGAGTGAGAGCAGCGGCACGG + Intergenic
940305469 2:152221214-152221236 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
940957051 2:159739162-159739184 CTACAGCCACAGCTGGGTCAGGG + Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943349314 2:186778996-186779018 CTGGAGTCACAGCTGATCCTAGG - Intergenic
945058651 2:205889528-205889550 CTGGAGGCACAGGAAGGGCAGGG + Intergenic
945303389 2:208235361-208235383 CTGGCTTCACACCTGGGGAAAGG - Intergenic
946327543 2:218992591-218992613 CTGGGACCTCAGCTGGGGCAGGG + Intronic
946804041 2:223452042-223452064 CTGCAGGCAGAGCTGGCGCAGGG + Intergenic
947551668 2:231050911-231050933 CAGGAGCCCCAGCTGGGGCTGGG - Intergenic
948780729 2:240320141-240320163 CTGGCGTCTCAGCTGTGGGAGGG + Intergenic
948824935 2:240569430-240569452 CTGGAGTGTCAGCTGCGGAAGGG + Intronic
948859310 2:240745225-240745247 ATGGATTTACAGCTGGGGCATGG - Intronic
949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG + Intergenic
1169202660 20:3720348-3720370 CTGGACACACAACTGAGGCAAGG - Intergenic
1169391142 20:5192221-5192243 AGGGAGTCTCAGCTGGGGCCTGG + Exonic
1170003999 20:11646487-11646509 GAGGAGGCACAGCTGGGTCAAGG + Intergenic
1170493055 20:16898038-16898060 CTGGGGTCTCAGGTGGGGCCTGG + Intergenic
1170579392 20:17686448-17686470 GTGGTGTCACTGCTGGGGCAAGG + Intergenic
1171030102 20:21669403-21669425 CTGAAGTCAGAGGTGGGTCAGGG - Intergenic
1171199997 20:23233171-23233193 CAGCAGTCACAGCTGGGGTTGGG - Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172883547 20:38217050-38217072 CTGGGGGCACAGCAGGGACAGGG - Intronic
1173307329 20:41862906-41862928 CTGGATTTATAGCAGGGGCAGGG - Intergenic
1173318914 20:41970039-41970061 CTGGGGTCACAGGAAGGGCAGGG - Intergenic
1174506815 20:51022683-51022705 CGGGAGTCACCGCTGGTGCGTGG - Intronic
1174789246 20:53462511-53462533 CTGAAGCCAGGGCTGGGGCAGGG - Intronic
1175418042 20:58814682-58814704 CAAGGGTCACAGCTGGGACATGG - Intergenic
1175705121 20:61171084-61171106 CTGGAGTTACAGCTAGAGGAAGG - Intergenic
1175728048 20:61332784-61332806 CTGGCGCCACAGCCGGGGCAGGG - Intronic
1175777901 20:61664391-61664413 CAGAAACCACAGCTGGGGCATGG + Intronic
1175835395 20:61990601-61990623 CCGCAGTCAAACCTGGGGCAGGG + Intronic
1176059110 20:63164480-63164502 CTGGGGTGCAAGCTGGGGCAGGG + Intergenic
1179173195 21:38989002-38989024 CTATAGTCACAGCTGTGGAACGG + Intergenic
1179261631 21:39763152-39763174 CTTGAGGCACAGCTGCGGCGTGG + Intronic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180233533 21:46442563-46442585 CTGGAGTCCCACCTGGGCGAGGG - Exonic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181495280 22:23284116-23284138 GTGGGGTCACTGCTGGGACAGGG - Intronic
1181545245 22:23598717-23598739 ATGGGGTCAGAGCTGGGGAATGG + Intergenic
1181815066 22:25431164-25431186 ATGGGGTCAGAGCTGGGGAATGG - Intergenic
1182242348 22:28926045-28926067 CTGGAGGACCACCTGGGGCATGG + Intronic
1182370573 22:29807466-29807488 ATGGAGTAACAGCTGAGGGAAGG + Intronic
1183086863 22:35491910-35491932 CAGGGGACACATCTGGGGCAGGG - Intergenic
1183333610 22:37234467-37234489 CCGGAGGCACAGCTGTGGCCTGG - Intronic
1183667671 22:39254794-39254816 CTGGAGAGAAAGCTGGGCCAAGG - Intergenic
1183695916 22:39422083-39422105 CTGGGTTCAAAGCTGGGGGAAGG + Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184581459 22:45420679-45420701 CTGGAGTCAGGGGTGGGTCATGG - Intronic
1184677635 22:46052423-46052445 CTGGGGCCTCAGCAGGGGCAGGG + Intronic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1185249245 22:49791130-49791152 CTGGAATCCCAGCTGTGGCGTGG + Intronic
1185298672 22:50067610-50067632 ATGGAGTCACTGATGGGGGATGG - Intronic
1185393152 22:50573404-50573426 CTGGAGGCACAACTAGGGGAGGG - Intronic
1185404070 22:50635880-50635902 CGGGGGGCACAGCTGGGCCAGGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
950006629 3:9695688-9695710 GTTGAGGCACAGCTGGGGCTGGG - Intronic
950021293 3:9789646-9789668 GTGGAGGCACTGGTGGGGCAGGG - Intronic
950921017 3:16694974-16694996 CAGGAGGCATAGCTGGGCCAGGG - Intergenic
952007705 3:28861232-28861254 TGGGAGTGACAGCTGGGGCTGGG - Intergenic
953171630 3:40512425-40512447 CTGGTCTCCCAGCTGGAGCAAGG + Exonic
953391273 3:42535268-42535290 CTGGAGCCAGGGGTGGGGCAGGG + Intronic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
954365782 3:50145312-50145334 CTGGTGGGGCAGCTGGGGCAAGG + Intergenic
954718308 3:52538256-52538278 CTGGTGGGACACCTGGGGCAGGG + Intronic
954718718 3:52541576-52541598 CCAGAGTCACAGCTGGGAGATGG + Exonic
955608808 3:60735329-60735351 CTGGAGTCAGAACTGGAGAAGGG - Intronic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
956062508 3:65361910-65361932 CTGAAGTCTCACCTGGGGAAGGG - Intronic
959574191 3:107916800-107916822 CTGGTCTCAGGGCTGGGGCAAGG + Intergenic
960696554 3:120402059-120402081 CTGGAGTCCCATCTGGGTCCTGG - Intronic
960970022 3:123132763-123132785 CTGCTGTCACGGCTGGGACAGGG - Intronic
961314660 3:126026307-126026329 GGGGGCTCACAGCTGGGGCATGG + Intronic
961391966 3:126557680-126557702 CCAGAGTCAGAGATGGGGCACGG - Intronic
961522354 3:127474032-127474054 CAGGAGTCCCAGCAGGGCCAAGG - Intergenic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
965310124 3:167116554-167116576 GAGGAGGCACAGCTGGGCCAGGG - Intergenic
965798829 3:172469714-172469736 CTGTAATCCCAGCTGAGGCAGGG + Intergenic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
967882829 3:194313975-194313997 AGGCTGTCACAGCTGGGGCAGGG - Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
969538089 4:7768950-7768972 CTGGTGTCACAGCTGGAGATGGG + Exonic
969696988 4:8740514-8740536 CGGGAGTCAGAGCTCGGGCACGG - Intergenic
970075228 4:12210803-12210825 CTGGAGTCAGAGTCGGGGCAGGG + Intergenic
971381097 4:26098703-26098725 CTGAAGGCTCAGCTGGGGAAGGG + Intergenic
973632338 4:52831285-52831307 CTGGAGTCACACCTAGGGTTGGG + Intergenic
973642373 4:52916168-52916190 CTGGTGTCACAGTTGAGGAATGG + Intronic
974061125 4:57037163-57037185 CAGGAGTCACTGATGGGTCATGG + Intronic
974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG + Intergenic
979218111 4:118190667-118190689 CAGGAGGCAAAGCTGGGGCAGGG + Intronic
983423763 4:167555855-167555877 CTGGAGGTGCAGGTGGGGCAAGG + Intergenic
983504086 4:168533684-168533706 CTGGAGAGATAGCTGGGCCATGG + Intronic
984631912 4:182070135-182070157 GTGGAGGCACAGGTGGGGGAAGG + Intergenic
984744683 4:183202817-183202839 CTGGAGTCAAGGCTGGGGAAAGG + Intronic
985275940 4:188237890-188237912 CTGGAATGACAGCTGGGATAAGG - Intergenic
985480198 5:105250-105272 GTGGATTCACAGCTGTGGCTGGG + Intergenic
986024598 5:3838736-3838758 CTGGAGCCTCTGCTGGGGGAGGG + Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
987116833 5:14732341-14732363 CAGGGGTCACATCTGTGGCAGGG + Intronic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
991613977 5:68476963-68476985 CTGGAGTTACAGCTGCCTCATGG - Intergenic
992689501 5:79229039-79229061 CTGGACTCACTCCTGGGCCAGGG - Intronic
995262674 5:110123471-110123493 ATGTTGTCACAGCCGGGGCATGG + Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
996826395 5:127686536-127686558 TTGGAGTTACAGCTGGGGAGAGG + Intergenic
997526256 5:134555116-134555138 CTGGGGTGGCAGCTGGGGGAGGG - Intronic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
998161081 5:139813370-139813392 CTGGAGTCAGAGCTGCTGCGGGG + Exonic
999186005 5:149709491-149709513 CTGGACTTAAATCTGGGGCAAGG + Intergenic
999317598 5:150594284-150594306 CTTGGGTCAGAGCTGGGGCTTGG + Intergenic
1000978402 5:167790139-167790161 CAGGAATCAAAGCCGGGGCATGG - Intronic
1001141902 5:169151456-169151478 CTGGAATAACAGCTTTGGCAGGG + Intronic
1001938951 5:175727670-175727692 CTGAAGGCCCAGCTAGGGCAGGG + Intergenic
1002132972 5:177092604-177092626 CTGGGGTCACAGCAGGGCCTGGG - Intronic
1002395805 5:178953183-178953205 CAGGAGTCACTGAAGGGGCAGGG - Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002743711 5:181453979-181454001 CTAGAGCCACAGCTGATGCATGG + Intergenic
1003191537 6:3879429-3879451 CGGGAGCCACAGCAGGGTCAGGG + Intergenic
1004272240 6:14205950-14205972 CTGAAGTCACTGCTGCTGCATGG - Intergenic
1004424421 6:15497751-15497773 CTGGAGTTAAAGCAGGGGCCGGG + Intronic
1004639173 6:17497625-17497647 CTGGATTCATGGCAGGGGCATGG - Intronic
1005670280 6:28098914-28098936 CAGGAGATACAGCTGGGCCAGGG - Intergenic
1006387495 6:33739453-33739475 CTGGAGCTTCAGCTGGGGCTGGG + Intronic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1006987351 6:38184699-38184721 GTGGAATCAGACCTGGGGCAGGG + Intronic
1007551392 6:42732653-42732675 CTGGAGTCAAAGCTGGTTCCCGG - Intergenic
1011594140 6:88999942-88999964 CAGGAGATACAGCTGGGTCAGGG - Intergenic
1011702909 6:89972104-89972126 CAGGAGCAGCAGCTGGGGCAAGG + Intronic
1012163415 6:95917218-95917240 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1012261909 6:97097252-97097274 CTGGAGTGACAGCTCGGTGATGG - Intronic
1012442108 6:99270423-99270445 CTGGTGGCACAGCTTGGGAAGGG - Intergenic
1013676054 6:112464274-112464296 CAGGAGGCAAAGCTAGGGCAGGG + Intergenic
1016775071 6:147896349-147896371 CTGGACTCTGAGCTGGGGCTGGG + Intergenic
1017478083 6:154819864-154819886 CTGCAGTCCCAGCTGCTGCAGGG + Intronic
1018295976 6:162344542-162344564 CTGCCCTCACAGCTGGGTCAGGG + Intronic
1018419854 6:163631667-163631689 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1018921553 6:168179374-168179396 AAGGAGTCACAGCTGAGGCGAGG + Intergenic
1019248569 6:170727208-170727230 CTAGAGCCACAGCTGATGCATGG + Intergenic
1019528082 7:1489749-1489771 CAGGTGGCAAAGCTGGGGCAGGG + Intronic
1019709003 7:2509894-2509916 CTGGAGACACAGCCAGGACAGGG + Intergenic
1019742820 7:2683254-2683276 CTGAAGTCAAGGCTGGGGCAGGG + Intronic
1020276902 7:6630137-6630159 GTGGACTCGGAGCTGGGGCAGGG - Intergenic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1022727426 7:32993700-32993722 CTGTAATCTCAGCTGAGGCAGGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023871054 7:44263227-44263249 CTGGTGGCAAGGCTGGGGCAGGG + Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1024700796 7:51902040-51902062 CTGGACTCACAGCTGGGGAGGGG + Intergenic
1025046157 7:55693949-55693971 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1026817491 7:73523560-73523582 CCAGAGTCACAGCTCTGGCAGGG - Intergenic
1026902766 7:74046206-74046228 CTGGAATCCCAGGTGAGGCAAGG + Exonic
1029531355 7:101127382-101127404 CTGCAGTCACCCCTAGGGCAGGG - Intronic
1029747706 7:102525586-102525608 ATGGAGCCACAGTGGGGGCATGG + Intergenic
1029765657 7:102624676-102624698 ATGGAGCCACAGTGGGGGCATGG + Intronic
1031040773 7:116836462-116836484 TTGGAGTCAGAGCTGGAGCCAGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1032980295 7:137274206-137274228 CTCTAGGCACAGCTGGGGTAAGG - Intronic
1033574235 7:142664757-142664779 ATGAAGTCAGAGATGGGGCAGGG - Intergenic
1034424457 7:151007287-151007309 CAGGAGTCAGAGCAGGGGCTGGG - Intronic
1035049530 7:155990509-155990531 CTGGAGGAGCAGCTGGGGAAGGG + Intergenic
1035494499 7:159311377-159311399 CAGGAGGCAAAGCTAGGGCAGGG - Intergenic
1035499478 8:80127-80149 CTAGAGCCACAGCTGATGCATGG - Intergenic
1036653727 8:10662308-10662330 CTGGAGTCAGTGCTGGCTCAGGG - Intronic
1038418645 8:27417621-27417643 GTTGAGTCACAGCTGGGGAGTGG + Intronic
1038491435 8:27974812-27974834 CTGGAGTCACAGCGGACCCAGGG + Intronic
1040513086 8:48112677-48112699 CTGAAGTCACTGCCTGGGCAAGG - Intergenic
1043873990 8:85464310-85464332 GTGGCCTCGCAGCTGGGGCAAGG - Intronic
1045822035 8:106350061-106350083 TTGAAGTCACAGCTGAGGCAAGG + Intronic
1047233219 8:123015470-123015492 CGGGAGACACAACTGGGGCCAGG - Exonic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048005843 8:130418892-130418914 CTGGAATCACTGCTGTGGAAGGG + Intronic
1048189203 8:132272949-132272971 CTGAAGTCTCATCTGAGGCAAGG + Intronic
1048341676 8:133544640-133544662 CTGGTGTCACAGGTAGGTCAGGG - Intronic
1049423416 8:142526710-142526732 CTGCAGTCTCAGATTGGGCATGG - Intronic
1049447388 8:142637597-142637619 CTGTGGTCCCAGCTGGGCCATGG - Intergenic
1049587000 8:143436889-143436911 CTGGAATCCCAGCAGGGCCAAGG + Intergenic
1049678658 8:143905221-143905243 CCAGAGTCGCAGCTGAGGCAGGG - Intergenic
1049825616 8:144665844-144665866 TTGGAGTCCCTACTGGGGCATGG + Intergenic
1050774219 9:9239759-9239781 CAGGAGTCACAACTGGGCCAGGG - Intronic
1050913643 9:11104812-11104834 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1052824193 9:33163505-33163527 CTGGGGGCTCAGCTGGGGCCTGG - Intronic
1052886693 9:33656196-33656218 ATGGAGTCAGAGATGGGGGAGGG - Intergenic
1055425774 9:76194877-76194899 CTGGAGTCACAGCTGAGGAGAGG + Intronic
1056376213 9:86014665-86014687 CTGAAGTCACTGCTGTGGGAGGG + Intronic
1056495880 9:87154810-87154832 CTGGAATCCCAGCTTGGGTAGGG - Intronic
1056574752 9:87847222-87847244 CTGGGGTAAAAACTGGGGCATGG + Intergenic
1056913859 9:90728330-90728352 CTGCAGTCTCAGCTGGGACCTGG - Intergenic
1058152556 9:101478604-101478626 CAGGTGTCACACCTGGGACAAGG + Intronic
1058216551 9:102240959-102240981 CAGGAGGCAAAGCTGGGTCAGGG - Intergenic
1058929740 9:109707373-109707395 CTGACTTCAAAGCTGGGGCAGGG - Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1060060401 9:120454563-120454585 CTGAAGTCAGAGGTGGGCCAAGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060348676 9:122838572-122838594 CTGGAGTCAGAGCTGGCACAGGG + Intergenic
1060487069 9:124054510-124054532 CCTGAGGCACAGCTGGGGCAAGG - Intergenic
1060802120 9:126551430-126551452 CTGGTGTTGCAGCAGGGGCAGGG - Intergenic
1060891987 9:127194954-127194976 CAGCTGTCACAGGTGGGGCAAGG - Intronic
1061768030 9:132894867-132894889 CTGGTGTTCCAGCTGAGGCAGGG - Exonic
1061883333 9:133578799-133578821 GGGGAGGCACAGCTGGGGCCTGG - Exonic
1062084289 9:134641026-134641048 TGGGAGTGACAGCTGGCGCAGGG - Intergenic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1203609529 Un_KI270748v1:84472-84494 CTAGAGCCACAGCTGATGCATGG + Intergenic
1185645152 X:1610566-1610588 CTGGAGTCTTAGCTGGAGTAGGG - Intergenic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1186858919 X:13652286-13652308 CGGCAGTCACAGCTGGGCCTTGG + Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189530238 X:41873199-41873221 ATGGAGTCAGAGTTGGGTCAGGG - Intronic
1190216395 X:48481980-48482002 GTGGAGTCTCCACTGGGGCAGGG - Intronic
1190333726 X:49250516-49250538 CTGCAGTCTAAGCTGAGGCATGG + Exonic
1190339481 X:49285811-49285833 CTGGAGCCATGGCCGGGGCAAGG - Intronic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1191843739 X:65531241-65531263 CTGGAGTCAAGGCTGGGACTAGG - Intronic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1195095352 X:101496312-101496334 CAGGAGTCCAAGCTGGGGCGGGG + Intronic
1196075470 X:111570921-111570943 CAGGAGGCACAGCTGGGTCAGGG - Intergenic
1196437603 X:115688991-115689013 CTGCATTCACACCTGGGCCATGG + Intergenic
1196972693 X:121126677-121126699 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1197734478 X:129840682-129840704 CTTGAGTAACAGCAGGGGGAGGG - Intronic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1199442193 X:147881013-147881035 CAGGAGGCAGAGCTGGGCCAGGG - Intergenic
1199606673 X:149584305-149584327 CTGGGGTGACAGTAGGGGCAGGG + Intronic
1199632450 X:149785063-149785085 CTGGGGTGACAGTAGGGGCAGGG - Intronic
1199635270 X:149807246-149807268 CTGGGGTGACATCAGGGGCAGGG - Intergenic
1199894243 X:152116501-152116523 CTGGAGTGACAGCAGGGGCAGGG + Intergenic
1199952356 X:152716134-152716156 CTGAAGTAACCGCAGGGGCAGGG - Intronic
1199957327 X:152752314-152752336 CTGAAGTAACCGCAGGGGCAGGG + Intronic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200077470 X:153558321-153558343 CAGGTGTCCTAGCTGGGGCATGG - Intronic
1200150570 X:153949436-153949458 CTGGAGGCCCTGCTGGTGCAGGG + Intronic
1200268567 X:154660153-154660175 CTGGAGACACAGCTACGGGAAGG - Intergenic
1201571166 Y:15415949-15415971 CTGGATTCAAAACAGGGGCAAGG - Intergenic