ID: 900616310

View in Genome Browser
Species Human (GRCh38)
Location 1:3567214-3567236
Sequence GGTCCCTCCCAGGGATGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900616303_900616310 5 Left 900616303 1:3567186-3567208 CCGGGCCACACGGCGAAGACAGA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 900616310 1:3567214-3567236 GGTCCCTCCCAGGGATGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 230
900616304_900616310 0 Left 900616304 1:3567191-3567213 CCACACGGCGAAGACAGAGCCCT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 900616310 1:3567214-3567236 GGTCCCTCCCAGGGATGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900616310 Original CRISPR GGTCCCTCCCAGGGATGCAC TGG Intronic
900119587 1:1042832-1042854 AGTCACACCCAGGGCTGCACGGG - Intronic
900372307 1:2337429-2337451 GGTCCCACTGAGGGATGCACAGG - Intronic
900616310 1:3567214-3567236 GGTCCCTCCCAGGGATGCACTGG + Intronic
900965017 1:5951881-5951903 GCTCCGTCCCAGCGATGCTCTGG - Intronic
901771236 1:11531365-11531387 GGCCCCTCCCAGGGACACCCCGG - Intronic
902372758 1:16016262-16016284 CGTCCCTGCCAGGGATGCCATGG - Intronic
904254410 1:29245429-29245451 GATGCCTCCCTGTGATGCACTGG - Intronic
904314494 1:29651506-29651528 GGCCCCACACAGGGCTGCACAGG + Intergenic
904384675 1:30133474-30133496 GGCCCCACACAGGGCTGCACAGG - Intergenic
905547077 1:38808338-38808360 GGTCCCTCCAAGGGAGTCACAGG - Intergenic
905793026 1:40800226-40800248 GGCCCCTCCCAGGGAGGGATGGG + Intronic
906529825 1:46517320-46517342 AGCCCCTCCCAGGGAGGCAGGGG - Intergenic
907493824 1:54828369-54828391 GGTGCCACCCAGGGCTGCAGTGG + Intronic
909300813 1:74010993-74011015 TGTCCCTCCCACGTATGCATAGG - Intergenic
916543857 1:165783792-165783814 GGACCCTCCGAGCCATGCACGGG + Intronic
917207914 1:172597074-172597096 GGACCCTCCGAGCCATGCACGGG + Intronic
919459375 1:197858155-197858177 TTTCCCTCCCAGGGCTGCTCTGG + Intergenic
919603165 1:199647666-199647688 GGACCCTCCGAGCCATGCACGGG - Intergenic
920417115 1:205806261-205806283 TGTCCCGCCCAGGGATGCTGCGG + Intronic
922249935 1:223839376-223839398 CTTCCCTCCCAGGGATGAAGAGG - Intronic
923407921 1:233681060-233681082 TGGCCCACCCAGTGATGCACAGG + Intergenic
923562133 1:235049424-235049446 GCTCCTTCCCAGGGCTGCACTGG + Intergenic
923738433 1:236633904-236633926 GGTGCCTCCCAGATATTCACTGG + Intergenic
923945009 1:238875197-238875219 GTTTCATCCCAGGGATGCAGGGG - Intergenic
924704804 1:246491788-246491810 AGGCCCTCACAGGGAGGCACTGG + Intronic
924940841 1:248811768-248811790 GGCCTCTCCCAGGGAAGCACTGG + Exonic
1062857289 10:785576-785598 GGCTCCTCCCAGGGCTGCGCGGG - Intergenic
1066274302 10:33853532-33853554 GGACCCTCCAAGCCATGCACGGG + Intergenic
1066726655 10:38402511-38402533 GGACGCTCCCGGGGATCCACGGG + Intergenic
1070605971 10:77898747-77898769 TGGCCCTCTCAGGCATGCACAGG - Intronic
1071466227 10:85942235-85942257 TGCCCCTCCCAGGGGAGCACAGG - Intronic
1071748023 10:88443669-88443691 GGACCCTCCAAGCCATGCACGGG - Intronic
1074805872 10:117051576-117051598 GATTCATCCCAGGAATGCACAGG + Intronic
1075415309 10:122258342-122258364 GCTCCGTCCCTGGGATGCTCGGG + Intergenic
1076496616 10:130901596-130901618 AGGCCAGCCCAGGGATGCACTGG - Intergenic
1076591855 10:131588909-131588931 GGTGCCTCCCAGGCCTGCTCTGG + Intergenic
1077250424 11:1558403-1558425 GGGCCCTCCCCTGGATACACTGG - Intronic
1077416465 11:2426435-2426457 TGCCCCACCCTGGGATGCACAGG - Intergenic
1077508317 11:2942454-2942476 GATCCCTCCCAGGCAGTCACCGG + Intergenic
1077979793 11:7288146-7288168 GGTCCCTCCCAGGGTTTCCCAGG - Intronic
1078032221 11:7764444-7764466 GGACCCTCCGAGGCAGGCACGGG - Intergenic
1080764225 11:35280805-35280827 ACTGCCTCCTAGGGATGCACAGG - Intronic
1080858074 11:36129573-36129595 GGTCCCTTCCCGGGAGCCACAGG + Intronic
1082273719 11:50199548-50199570 GGACCCTCCGAGCCATGCACGGG + Intergenic
1084721507 11:70908671-70908693 GTTACCTCCCAGGGATGCTGGGG + Intronic
1085493652 11:76946656-76946678 GGACCCTCCCAGGGGTACATGGG + Intronic
1086409124 11:86526223-86526245 GGACCCTCCGAGCCATGCACGGG - Intronic
1086589123 11:88491069-88491091 GATTCATCCCAGGGATGCAAGGG + Intergenic
1087117845 11:94544004-94544026 GTACCTTCCCAGGGATGAACCGG + Exonic
1089859286 11:121574415-121574437 GCTCCCTCACAGGGCTGTACTGG + Intronic
1090051405 11:123382934-123382956 GGTCCTGCCAAGGGAGGCACTGG - Intergenic
1092117505 12:6019664-6019686 GGTGCCTCCCACAGATGCCCCGG - Exonic
1092718457 12:11416508-11416530 GGACCCTCCGAGCCATGCACGGG - Intronic
1095102812 12:38201730-38201752 GCTCCCTGCCAGGGACGCAGTGG + Intergenic
1095103749 12:38207548-38207570 GGACCCTCCGAGCCATGCACAGG - Intergenic
1095913950 12:47457585-47457607 GGACCCTCCGAGCCATGCACGGG + Intergenic
1097196778 12:57246758-57246780 GGTCCCTCCCAGAGATCCCATGG - Intronic
1098202336 12:68069113-68069135 GGACCCTCTCAGGGGTGCATGGG + Intergenic
1099520291 12:83651816-83651838 GATTCATCCCAGGGATGCAAGGG + Intergenic
1100330179 12:93573809-93573831 TTTCCCTCCCGGGGAGGCACCGG + Intronic
1100919249 12:99463640-99463662 GGACCCTCCGAGCCATGCACAGG - Intronic
1101575605 12:105993894-105993916 ATTCCCTTCCAGGGATCCACTGG - Intergenic
1101869645 12:108554416-108554438 GGTCTATCCCAGGAATGCAAGGG + Intronic
1102004244 12:109578896-109578918 GGTTGTTCCCAGGGATGTACAGG - Intronic
1104837945 12:131804043-131804065 GGTCACACCCAGGGACACACAGG - Intergenic
1106377620 13:29204425-29204447 AGTCCCACCCAGTGATGCTCAGG + Intronic
1112972160 13:105273784-105273806 GCTCCATCCCAGGGAAGTACAGG + Intergenic
1114386559 14:22261353-22261375 GGTCCCTCCAAGCCAGGCACAGG + Intergenic
1116532366 14:45988446-45988468 TGTCACTCCCAGAGATGCAGTGG - Intergenic
1116540983 14:46101186-46101208 GGACCCTCCGAGCCATGCACGGG + Intergenic
1117511369 14:56454790-56454812 GGACCCTCCAAGCCATGCACAGG - Intergenic
1118483372 14:66189515-66189537 GGACCCTCCCAGCCAGGCACGGG + Intergenic
1120607669 14:86599377-86599399 GGTGCCTGCCAGTGATGAACTGG + Intergenic
1121582331 14:95040214-95040236 GGACCCACCCACAGATGCACCGG + Intergenic
1122776264 14:104118230-104118252 AGTCCCTCCCAGGGCCGCCCGGG - Intergenic
1122883244 14:104699456-104699478 GGTCCCTCCCAGGCAGCCTCAGG - Intronic
1123397165 15:19948558-19948580 GGACCCTCCAAGATATGCACAGG - Intergenic
1126542514 15:49839005-49839027 GGACCCTCCGAGCCATGCACGGG + Intergenic
1127505745 15:59596300-59596322 TCTCCCTGCCAGGGAGGCACAGG - Intronic
1127607753 15:60606226-60606248 GGGCCCCACCAGGGATACACAGG - Intronic
1129411766 15:75354362-75354384 GGTGACTCCCAGGGTTGCAGGGG - Intronic
1130975448 15:88769911-88769933 GGTGCCTCCCAGGCCTGCCCGGG + Intergenic
1131555587 15:93395741-93395763 GGACCCTCCCAGCCATGCACAGG + Intergenic
1132063745 15:98713624-98713646 CGTCCCTCCCAGGGCAGAACTGG - Intronic
1132218292 15:100084197-100084219 GGACCCTCCCAGCCATGCGCGGG - Intronic
1132802629 16:1761883-1761905 GGTGCCTCCCGGGGACTCACCGG + Intronic
1133368972 16:5233763-5233785 GGTCCCTCCCTGTGTTGCCCAGG - Intergenic
1135524727 16:23205718-23205740 AGTCCCTCCCAGGTCTGCACAGG + Intronic
1135810360 16:25581269-25581291 GGTCCCTCCCAGGGACCCATGGG - Intergenic
1135990791 16:27217509-27217531 GGTCCCTCCCAGGGCTGTGAGGG - Intronic
1136382337 16:29901368-29901390 GGTCCTTCCCCGGGATCCCCAGG - Exonic
1136684568 16:31986613-31986635 GCTCCCTCCCTGGGAGGCCCAGG - Intergenic
1136785192 16:32930149-32930171 GCTCCCTCCCTGGGAGGCCCAGG - Intergenic
1136884590 16:33923655-33923677 GCTCCCTCCCTGGGAGGCCCAGG + Intergenic
1136930800 16:34416477-34416499 GGACCCTCCAAGCCATGCACGGG + Intergenic
1136973773 16:34995331-34995353 GGACCCTCCAAGCCATGCACGGG - Intergenic
1137250375 16:46736804-46736826 GGTCCCTCCGAGAGAAGCCCGGG + Intronic
1137317942 16:47347399-47347421 AGACCCTCCCAGCCATGCACAGG - Intronic
1139750688 16:69107313-69107335 GGTCCCGCCCAGGGAAGGAGAGG + Intronic
1141821170 16:86447061-86447083 GGTTCCTTCCAGGGCTGCAAGGG + Intergenic
1203087852 16_KI270728v1_random:1194158-1194180 GCTCCCTCCCTGGGAGGCCCAGG - Intergenic
1142766127 17:2065261-2065283 GATCCCTCCCATGCATGCGCTGG + Intronic
1143164488 17:4891095-4891117 GGTCCCTCCTGGGGCTCCACCGG - Exonic
1143256380 17:5560919-5560941 GGTCCCTCCCTGGGAAACAATGG - Intronic
1143322927 17:6079711-6079733 GCTGACTCCCAGGGGTGCACTGG - Intronic
1143344703 17:6241297-6241319 AGCCCCTCCCAGGGCTGCCCAGG + Intergenic
1143542325 17:7576859-7576881 GGACACTGCCAGGGCTGCACTGG - Intronic
1144783003 17:17817219-17817241 TGTCCCTCCCAAAGATGCCCAGG + Intronic
1146732344 17:35204596-35204618 GGACCCTCCAAGTCATGCACAGG + Intergenic
1147145502 17:38482294-38482316 GCTCCCTCCCTGGGAGGCCCGGG - Intronic
1151977119 17:77489300-77489322 GGCCCCTTCCAGGGCTGGACGGG + Intronic
1152363343 17:79842323-79842345 GGCCCCTCCCAGGGAGCCGCAGG + Intergenic
1152816038 17:82408601-82408623 GCTCCCTCCCAGGGCTCCAGGGG + Intronic
1153419859 18:4893130-4893152 GCACCCTCCAAGGCATGCACGGG - Intergenic
1153912300 18:9715047-9715069 GGTCCCTGCCTGGGATGGAGAGG + Intronic
1154002147 18:10490947-10490969 GGTCCCTATCAGGGATGTGCTGG - Intergenic
1155788333 18:29931266-29931288 GGTGGGTCCCAGGGAGGCACAGG + Intergenic
1158259193 18:55588527-55588549 AGTGCCTCCGAGGGATGCAACGG - Intronic
1160263344 18:77316271-77316293 GGCTGCTCCCAGGCATGCACTGG + Intergenic
1160569132 18:79804483-79804505 GGGCCCTCCCATGGGTGCTCAGG + Intergenic
1161420621 19:4174447-4174469 GGTCCCTCCCTGGGCTCCAGGGG - Exonic
1161562445 19:4981128-4981150 GGTCCCTGCCAGGGCCCCACTGG - Intronic
1162115061 19:8424157-8424179 GGTCCTTCCCAGGGCAGCTCAGG - Intronic
1164677793 19:30113364-30113386 GGCCCCTCCCATGGAAGCCCAGG - Intergenic
1165772017 19:38385648-38385670 GGTCGCGCCCCGGGCTGCACGGG + Exonic
1165889330 19:39101061-39101083 GGTCCCTCCCTGGGAGACAGTGG + Intronic
1166698087 19:44865625-44865647 GGTCCGTCCGAGGGATGACCTGG + Exonic
1166938829 19:46350840-46350862 GGTTCCTCCCAGAGCTGTACTGG + Intronic
1168120333 19:54248476-54248498 GGTTTCTACCAGGGCTGCACTGG - Intronic
927494478 2:23543372-23543394 AGTCCCTCCCCGGGATGTGCGGG + Intronic
930477133 2:51895748-51895770 GGTCCTTCACAGGGATGCGAAGG + Intergenic
932463292 2:71897201-71897223 GGCCCCTCCCTGGGATGGGCTGG - Intergenic
934550401 2:95257854-95257876 GGACCCTCCAAGCCATGCACGGG + Intronic
934659639 2:96136411-96136433 GGTGCTTCCCAGGAAAGCACTGG + Intronic
934997426 2:98978161-98978183 GGACCCTCCCAGCCAGGCACAGG - Intergenic
937997972 2:127709407-127709429 GGGCCCTCTCTGGGGTGCACCGG - Intronic
938156854 2:128949079-128949101 GGACCCTCCGAGCCATGCACGGG + Intergenic
938158406 2:128960584-128960606 GCTCTCTTCCAGGGAGGCACTGG - Intergenic
938208571 2:129444618-129444640 GCTCCCTCCCAGTCATGCCCAGG + Intergenic
939376591 2:141376042-141376064 GGACCCTCCCAGGATTGCAGAGG + Intronic
942286373 2:174421526-174421548 GGTCCATTCTAGGGATACACAGG + Intronic
944106955 2:196089502-196089524 GGACCCTCCAAGCCATGCACGGG - Intergenic
944600707 2:201300278-201300300 GGACCCTCCCAGCCATGCATGGG - Intronic
945261963 2:207851916-207851938 TGACCCGCCAAGGGATGCACAGG + Intronic
947826439 2:233108737-233108759 GCTCCCTCCCAGGGCAGCACGGG + Intronic
947910672 2:233798889-233798911 GGACCCTGCCAGGGAGGCAAAGG + Intronic
948828845 2:240587521-240587543 GGCACCTCCAAGGGATGCCCTGG + Intronic
1170695325 20:18652531-18652553 GGACCCTTTCAGGGATACACGGG + Intronic
1170861345 20:20106458-20106480 GGTCGCTCCCAGGGCTGAAGAGG - Intronic
1172800992 20:37576082-37576104 GTTCCCCTCCAGGGAAGCACAGG - Intergenic
1173658164 20:44715300-44715322 GGTCACTCCCAGGCACACACAGG - Intronic
1176743676 21:10631429-10631451 GGACCCTCCAAGATATGCACGGG - Intergenic
1179016218 21:37596159-37596181 TGCCCCTCCCAGGGATGTGCAGG - Intergenic
1179080730 21:38168604-38168626 GCTCCCTCCCAGGCAAGCACAGG + Intronic
1179156752 21:38857662-38857684 AGGACCTCCCAGGGATGCCCAGG - Intergenic
1179779423 21:43689876-43689898 GGTCCCTCACAGGCAGGCCCAGG - Intronic
1180568939 22:16698077-16698099 GGTACCTCCCACAGATGCCCCGG - Intergenic
1180669636 22:17542942-17542964 GTGCCCTCCCAGGGTTGCCCAGG - Exonic
1180874803 22:19170162-19170184 GGTGGCACCCAGGGCTGCACTGG - Intergenic
1181168726 22:20996629-20996651 GCACCCTCCCAGGGAAGGACAGG - Intronic
1181847829 22:25726846-25726868 GCACCCTCCCATGGAGGCACAGG + Exonic
1182356008 22:29722473-29722495 GGGCCCTCCCTGGGATGGGCAGG + Intronic
1184244679 22:43230080-43230102 GCTCCCTCCCAGGGAGGATCTGG + Intronic
1184760698 22:46542455-46542477 GGCCCATCTCAGGGCTGCACTGG + Intergenic
1184836150 22:47022315-47022337 CCTCCCTCCCAGGGATGGCCCGG - Intronic
1184840998 22:47052379-47052401 GGTCCCTCCCAGGCATCCCCAGG - Intronic
1185220373 22:49626527-49626549 GGCCCATCCCAGGGAGACACTGG + Intronic
953414206 3:42706125-42706147 GGTCCCTCCCAGGCCTGGAGAGG + Intronic
953524722 3:43679295-43679317 GGACCCTCCGAGCCATGCACGGG - Intronic
956737638 3:72250376-72250398 GGTCCCTTCCAGGGAGACGCAGG - Intergenic
958677657 3:97287736-97287758 GATTCATCCCAGGGATGCAAGGG - Intronic
963714416 3:148786427-148786449 GGACCCTCCGAGCCATGCACGGG + Intergenic
965987057 3:174767018-174767040 GCTACCACCCAGGGCTGCACAGG - Intronic
966433117 3:179853554-179853576 GGTCCCTAGGAAGGATGCACAGG - Intronic
967864326 3:194177873-194177895 CTTCCCTCCCAGGGTTGCAGGGG - Intergenic
968376041 4:42341-42363 GGACCCTCCAAGCCATGCACAGG + Intergenic
969853329 4:9979495-9979517 GATGCCTCCCAGGGATGCAGGGG - Intronic
970796594 4:19920475-19920497 GGACCCTCCAAGCCATGCACGGG - Intergenic
971950645 4:33340693-33340715 GGACCCTCCCAGGGTTTCATGGG + Intergenic
975286965 4:72632393-72632415 GGACCCTCCAAGCCATGCACGGG - Intergenic
976289023 4:83398246-83398268 GGACCCTCCAAGCCATGCACGGG - Intergenic
976795807 4:88931138-88931160 GGACCCTCCCATGGGTGCATGGG + Intronic
978658978 4:111100426-111100448 GGACCCTCCAAGCCATGCACAGG + Intergenic
981459487 4:144996456-144996478 GGACCTTCCCAGGGGTGCATGGG - Intronic
986034898 5:3927906-3927928 AGTCCCTCCCATGGAGGCAGTGG - Intergenic
987957887 5:24763770-24763792 GGACTCTCCCAGGGGTGCATGGG + Intergenic
996543070 5:124649599-124649621 GGCCCCTCCCAGGTATGAACAGG - Exonic
1001384168 5:171324703-171324725 GGTCCCTCCCAGGGCGGGCCGGG - Intergenic
1004018056 6:11750228-11750250 GGTCTGTCCCAGGCCTGCACTGG - Intronic
1006745164 6:36336564-36336586 GGGCCCTCCCAGAGAGGCAATGG - Intronic
1007808747 6:44471697-44471719 GGTCCTTCCCAGGGCTGGTCAGG + Intergenic
1010878531 6:81138866-81138888 CGTCCTTCCCAGGGAAGCATAGG - Intergenic
1012251560 6:96986658-96986680 GGACCCTCCAAGCAATGCACGGG + Intronic
1014277213 6:119400322-119400344 GGACCCTCCGAGCCATGCACGGG - Intergenic
1017326880 6:153150620-153150642 AGGCTCGCCCAGGGATGCACCGG + Intergenic
1020106768 7:5425837-5425859 TGGCCGTCCCGGGGATGCACCGG - Intergenic
1021342287 7:19479817-19479839 GGACCCTCCTAGCCATGCACGGG + Intergenic
1025158874 7:56635765-56635787 GCTCCATCCCAGGGAGGTACAGG - Intergenic
1029130684 7:98328386-98328408 GGAACTTCCCGGGGATGCACAGG - Intronic
1031344732 7:120651402-120651424 GGACTCTCCCAGCCATGCACGGG + Intronic
1032265284 7:130366164-130366186 GGTCCTCCCCAAGAATGCACAGG - Intronic
1032541410 7:132705951-132705973 GGTCTCACCCTGGGAGGCACTGG + Intronic
1032780146 7:135158768-135158790 AGACCCTCCCAGGGGTGCATGGG + Intronic
1033902256 7:146157589-146157611 GGACCCTCCAAGCCATGCACGGG - Intronic
1035814626 8:2526271-2526293 CGTGCTTCCCAGAGATGCACAGG + Intergenic
1037916419 8:22775917-22775939 TGTCCCTACCAGGGATGGCCAGG + Intronic
1038581314 8:28751555-28751577 AGGCGCTCCCAGGGATTCACTGG - Exonic
1039300980 8:36208500-36208522 GGTCCTTCCCAGCTATGCATAGG + Intergenic
1040877083 8:52165174-52165196 TGTCCCACGCCGGGATGCACAGG - Exonic
1042172388 8:66004786-66004808 GGTCCATACCTGAGATGCACAGG - Intergenic
1042630302 8:70808651-70808673 GGACCCTCCAAGTCATGCACAGG - Intergenic
1043177590 8:77042196-77042218 GGACCCTCCGAGCCATGCACGGG - Intergenic
1043836974 8:85059871-85059893 GGTCCCTGAGAGGCATGCACAGG + Intergenic
1049074375 8:140382494-140382516 GGACCCTCCCAGCCATGCGCGGG - Intronic
1050356450 9:4788076-4788098 GATTCATCCCAGGGATGCAAGGG + Intergenic
1051879414 9:21824887-21824909 GGACCCTCCGAGCTATGCACGGG + Intronic
1052975718 9:34408472-34408494 GGACCCTACCAGGGCAGCACTGG + Intronic
1053267114 9:36723528-36723550 GGACTCTCCCAGGGGTGCACTGG + Intergenic
1053521021 9:38779728-38779750 GGACCCTCCGAGCCATGCACGGG - Intergenic
1060332139 9:122682865-122682887 GGATCCTCCCAGGGGTGCACGGG - Intergenic
1061368943 9:130187180-130187202 GGCCCTGCCCAGGGAGGCACCGG + Intronic
1061625946 9:131840718-131840740 AGACCCTCTCAGGGAAGCACCGG - Intergenic
1061856058 9:133442602-133442624 CTTCCCTCCCAGGGCTGCGCTGG + Exonic
1062330309 9:136039640-136039662 GGTTTCTCCCAGGAATGCAAGGG + Intronic
1062352025 9:136143932-136143954 GCCCCCTCCCCGGCATGCACAGG - Intergenic
1062410601 9:136422214-136422236 AGCCCCTCCCAGGGGTGCAGAGG - Intronic
1203573185 Un_KI270744v1:151809-151831 GGACCCTCCAAGCCATGCACAGG - Intergenic
1186403395 X:9280256-9280278 GGTACCACCCTGGGCTGCACAGG - Intergenic
1186832602 X:13405033-13405055 GCTCCCTCCCAGAGCGGCACTGG - Intergenic
1186982755 X:14974787-14974809 GGACCCTCCGAGCCATGCACAGG + Intergenic
1189208422 X:39262010-39262032 GGTTCCTCACAGGGGTGCATGGG + Intergenic
1190962861 X:55269435-55269457 GGACCCTCCAAGCCATGCACGGG - Intronic
1191208845 X:57863513-57863535 GGACCCTCCTAGCCATGCACAGG - Intergenic
1191211746 X:57892071-57892093 GGACCCTCCCAGGGGTGCTTGGG - Intergenic
1191251250 X:58261201-58261223 GGGTCCTCCCACGGATGAACGGG + Intergenic
1191990153 X:67026518-67026540 GGACCCTCCAAGCGAGGCACGGG - Intergenic
1192324248 X:70118837-70118859 GGTCCCTGCCAGTGAGGCCCTGG + Intergenic
1192557440 X:72101660-72101682 GCTCCCTCCCAGGCAGCCACAGG - Intergenic
1192802543 X:74480269-74480291 GGACCCTCCCAGCCATGCACGGG + Intronic
1192985669 X:76396231-76396253 GGACCCTCCCAGCCATGCACGGG + Intergenic
1193367340 X:80650918-80650940 GGTCCCTCCGAGCCAGGCACAGG - Intergenic
1194145500 X:90256528-90256550 GTTTCATCCCAGGGATGCAGGGG + Intergenic
1195435834 X:104842764-104842786 GCTCCCTCCCAGAGGGGCACTGG + Intronic
1195830555 X:109054023-109054045 GGTTTATCCCAGGGATGCAAGGG - Intergenic
1196478782 X:116121543-116121565 GGACCCTCCGAGCCATGCACGGG - Intergenic
1199271698 X:145890957-145890979 TTTCCCCCCCAGGGATGCAAAGG - Intergenic
1200398256 X:156003791-156003813 GCTCCCTCCCAGACATGCAGTGG - Exonic
1200491253 Y:3825828-3825850 GTTTCATCCCAGGGATGCAGGGG + Intergenic