ID: 900617929

View in Genome Browser
Species Human (GRCh38)
Location 1:3573662-3573684
Sequence GCTCCTGGAAGGGCGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900617929_900617950 25 Left 900617929 1:3573662-3573684 CCAGAGCCCGCCCTTCCAGGAGC 0: 1
1: 0
2: 2
3: 33
4: 263
Right 900617950 1:3573710-3573732 TGGGGCACAGAGTCTGAGTCTGG 0: 1
1: 0
2: 3
3: 16
4: 296
900617929_900617940 6 Left 900617929 1:3573662-3573684 CCAGAGCCCGCCCTTCCAGGAGC 0: 1
1: 0
2: 2
3: 33
4: 263
Right 900617940 1:3573691-3573713 CTCCCCTCCCACCACTCCCTGGG 0: 1
1: 0
2: 7
3: 74
4: 670
900617929_900617941 7 Left 900617929 1:3573662-3573684 CCAGAGCCCGCCCTTCCAGGAGC 0: 1
1: 0
2: 2
3: 33
4: 263
Right 900617941 1:3573692-3573714 TCCCCTCCCACCACTCCCTGGGG 0: 1
1: 0
2: 5
3: 67
4: 519
900617929_900617939 5 Left 900617929 1:3573662-3573684 CCAGAGCCCGCCCTTCCAGGAGC 0: 1
1: 0
2: 2
3: 33
4: 263
Right 900617939 1:3573690-3573712 CCTCCCCTCCCACCACTCCCTGG 0: 1
1: 0
2: 13
3: 163
4: 1142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900617929 Original CRISPR GCTCCTGGAAGGGCGGGCTC TGG (reversed) Intronic
900159864 1:1218412-1218434 GCACCTCGCAGGGCCGGCTCCGG + Intronic
900354543 1:2253941-2253963 GCTGCTGGAAGAGAAGGCTCTGG + Intronic
900473044 1:2863872-2863894 CCTCCGGGCAGGGCCGGCTCTGG + Intergenic
900606733 1:3527024-3527046 GCCCCTGGAAGCGAGGGATCAGG - Intronic
900617929 1:3573662-3573684 GCTCCTGGAAGGGCGGGCTCTGG - Intronic
900953524 1:5873150-5873172 CCTCCTGGAGGGGAGGGCTGGGG - Intronic
901090129 1:6635403-6635425 GTTCCTGGAGGGAAGGGCTCTGG - Exonic
901702938 1:11055066-11055088 GCTCCTGGAAGTTCGTGCTCTGG + Exonic
901749470 1:11397146-11397168 GCCCCTGGGAGGGCGGGCTTGGG + Intergenic
901789918 1:11648733-11648755 TCTACTGGAAGGGCTGGTTCGGG - Exonic
901855022 1:12039066-12039088 GCTCCTGGAAGGGCTGTTGCTGG + Intergenic
902472290 1:16657266-16657288 CCTCCTGGGAAGGCAGGCTCAGG + Intergenic
902486513 1:16750180-16750202 CCTCCTGGGAAGGCAGGCTCAGG - Intronic
902504345 1:16929790-16929812 CCTCCTGGGAAGGCAGGCTCAGG - Intronic
903066204 1:20701047-20701069 GCTCCTGGAAACCCGGGGTCAGG - Intronic
904469612 1:30728315-30728337 GCATCTGGAGGAGCGGGCTCAGG + Intergenic
904495195 1:30882542-30882564 GCTCCTGGGAGGGAGGGGGCTGG - Intronic
904773341 1:32893179-32893201 GGGCCTGGAGCGGCGGGCTCAGG - Intronic
907246949 1:53114696-53114718 GGACCTGGCAGGGCAGGCTCGGG + Intronic
910237084 1:85047928-85047950 GCGGCTGGAAGTGGGGGCTCAGG - Intronic
911019676 1:93374294-93374316 GGTCCTGGAATGGTGGCCTCAGG + Intergenic
912493293 1:110074669-110074691 CTTCCTGGAAGGGCAGGCTGAGG + Intergenic
912553779 1:110501387-110501409 GCACCTGGGAGGGCGGGCCAGGG + Intergenic
912822537 1:112879316-112879338 GCTACTGGAAGGGAGGCCACAGG + Intergenic
912906525 1:113713965-113713987 GGTCCTGGAATGGGGGCCTCAGG - Intronic
914337006 1:146724648-146724670 GGGCCTGGAAGTGCAGGCTCGGG - Intergenic
916025545 1:160830463-160830485 GCACATTGAAGGGAGGGCTCAGG - Intronic
916075700 1:161198850-161198872 GATCCAGGAAAGGAGGGCTCAGG - Exonic
916433385 1:164754024-164754046 GCCACTGGAAGGGTGGGCTTGGG + Intronic
917365855 1:174231655-174231677 GCTTCTGGGAGGGAGGCCTCAGG + Intronic
921925012 1:220704076-220704098 GCTCCTGGTGGGGTGGGCTGAGG - Intergenic
922568778 1:226619390-226619412 GCTCAGGGAGGGGTGGGCTCTGG - Intergenic
924437479 1:244054965-244054987 GCTCGCGGAAGTGCGTGCTCAGG - Exonic
1063189219 10:3678432-3678454 TTTCCTGGAAGGGTGGGCTCTGG - Intergenic
1063974573 10:11405068-11405090 CCTCCTGGGAGGCCTGGCTCGGG - Intergenic
1066588137 10:36960801-36960823 GCTCCTGGAAGGTGGGGGTTTGG + Intergenic
1066986910 10:42475999-42476021 GCGCCGGGGAGGGCGGCCTCAGG + Intergenic
1067524242 10:47028669-47028691 GCCCCTGGAACGGGCGGCTCAGG + Intergenic
1067682042 10:48447564-48447586 GATCCTGGTAGGGAGGGCTCAGG - Intronic
1068967149 10:62924382-62924404 GCACCTAGGAGGGCGGCCTCAGG + Intergenic
1071125418 10:82329095-82329117 GCTCCTGGAAGAGCTGTCTCTGG - Intronic
1072581989 10:96747771-96747793 GCTCCTGGAAGCGCTGCCTGTGG + Intergenic
1074514748 10:114156006-114156028 GCTCATGAAAGGAAGGGCTCTGG + Intronic
1075129525 10:119726169-119726191 GCTCCCCGAGGCGCGGGCTCTGG + Exonic
1076694657 10:132241289-132241311 GCTGCGGGAAGGCAGGGCTCAGG + Intronic
1077431251 11:2517039-2517061 GCTCCTGGAAAGGAGGGATCAGG + Intronic
1077529415 11:3088153-3088175 GTGCCTGGGAGGGAGGGCTCAGG + Exonic
1078131867 11:8620064-8620086 GTTCATGGAAGGGCAGGCTGAGG + Exonic
1078147372 11:8730863-8730885 GCCCCGGGAATGGCGTGCTCTGG + Exonic
1081957548 11:47106755-47106777 GCTCCTGCATGGGTGGGCTTTGG - Intronic
1083690800 11:64407380-64407402 GCCTCTGGAAGGGCCGGCTCAGG + Intergenic
1084089544 11:66870889-66870911 GCTCCTGCGAGGGCGGGCAGGGG + Exonic
1084155774 11:67311749-67311771 GCTCCTGGAAGGCCTGGGTCCGG - Exonic
1085644405 11:78213831-78213853 GCTCCTGGAGGGAAGGGGTCAGG - Exonic
1088174827 11:107040686-107040708 GCTCCAGGATGGGATGGCTCTGG - Intergenic
1088797090 11:113273465-113273487 GCTCCGGGCTGGGTGGGCTCCGG - Intronic
1089729444 11:120511484-120511506 GCTGCGGGCAGGGCGGGCGCGGG - Intergenic
1090264467 11:125345233-125345255 GCTCCTGGAGGGGAGGACTAAGG - Intronic
1092377917 12:7970838-7970860 GCTGCAGGAAGGCGGGGCTCAGG + Intergenic
1094524020 12:31219890-31219912 GCTCCTGGAGGAGGGGGCTAAGG - Intergenic
1096111577 12:49031969-49031991 GCTCCTGGTAGGGTGGGGTCTGG + Exonic
1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG + Exonic
1097284311 12:57865601-57865623 GCTGCAGGAAGGGCAGGCTGGGG - Intergenic
1099222736 12:79934515-79934537 GCTGGTGGAAGGGAGGGCGCTGG - Intronic
1103743593 12:123107475-123107497 CCTTCTGGAAGGAAGGGCTCTGG + Intronic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1104668134 12:130662098-130662120 GCACCTGGGAGGGAGTGCTCAGG - Intronic
1104845758 12:131845984-131846006 GTTCCTGGAACGGTGGGCACCGG - Intronic
1104897713 12:132172451-132172473 GCAGCGGGAATGGCGGGCTCCGG - Intergenic
1104897723 12:132172482-132172504 GCAGCGGGAATGGCGGGCTCCGG - Intergenic
1105013144 12:132769258-132769280 GCTCCTCGAAGGGAGGCCCCAGG + Exonic
1107339955 13:39395438-39395460 GATCCTGGAAGAGGAGGCTCTGG - Intronic
1112005444 13:95249692-95249714 TCTGCTGGAAGGGAGGTCTCGGG - Intronic
1112338925 13:98536967-98536989 GAGCCGGGAGGGGCGGGCTCCGG - Intronic
1113335821 13:109374687-109374709 GCTCCTGGAAGGCAGAGGTCAGG + Intergenic
1113531642 13:111031906-111031928 GCTCCTGGAAGGTCTGGCTTGGG + Intergenic
1113892549 13:113744012-113744034 GCTCCAGGAGGGGCAGGCCCAGG - Intergenic
1114200677 14:20517153-20517175 GCTCCTGGAAGTGACGTCTCTGG - Intergenic
1114224261 14:20723650-20723672 GCTCCAGGGCGGGCGCGCTCAGG - Intergenic
1114270573 14:21098114-21098136 GCTCCTGGGGGGGCGGGGTGGGG - Intronic
1118257450 14:64217392-64217414 GCTCCTGGGAGGGCAGCCTAGGG + Intronic
1119696312 14:76716007-76716029 GCTCCTGGAAGGGAGGATTTAGG - Intergenic
1122787858 14:104172175-104172197 CTTCCCGGGAGGGCGGGCTCCGG - Intronic
1122792727 14:104191183-104191205 GCTCCTGCAAGGCCAGGCTGTGG - Intergenic
1122880371 14:104688100-104688122 GCACCTGGAAGGCCGGCCTCCGG - Intergenic
1122906754 14:104805169-104805191 GCTCCCGCCAGGGAGGGCTCAGG - Intergenic
1202893736 14_KI270722v1_random:183562-183584 GCTGCTGGGAGGGCGGGCGTGGG + Intergenic
1202923414 14_KI270724v1_random:4235-4257 GCTCCTGGAAGGAAGGGCGGAGG - Intergenic
1123806393 15:23877957-23877979 GCTCCCGGAAAGGGAGGCTCGGG + Intergenic
1124426640 15:29568948-29568970 AAACCAGGAAGGGCGGGCTCAGG + Intronic
1125465648 15:39949199-39949221 AATGCTGGAAAGGCGGGCTCAGG + Exonic
1126143672 15:45457064-45457086 GCTCCTCCAAGAGGGGGCTCGGG - Intergenic
1126172214 15:45704526-45704548 GCTCCTGGAACCGGGGGTTCGGG - Intergenic
1128818074 15:70629063-70629085 GCCCGTGGAAGGGAGAGCTCTGG + Intergenic
1129193501 15:73951308-73951330 GCTCTTGGAAGGAAGGGCTTTGG - Intronic
1129602701 15:77009605-77009627 GCTCCTGGAAGGGCAGCCGAGGG - Intronic
1130460524 15:84155971-84155993 GCTCCGTGAAGGGAGGGCTGAGG + Intergenic
1132418118 15:101638999-101639021 GCTCCACGAAGGCAGGGCTCTGG - Intronic
1132586750 16:708916-708938 GCTCCAGGAAAGGAGTGCTCTGG - Intronic
1132844339 16:1993006-1993028 TCTCGGTGAAGGGCGGGCTCTGG - Exonic
1132903428 16:2270571-2270593 GCTCCTGGAAGGGCAGGGTGGGG - Intergenic
1132913142 16:2326136-2326158 GCTCCTGGATGGACTGGCCCGGG + Exonic
1132978251 16:2721094-2721116 GCTCCGGGAAGGCCGGGCCGGGG + Intergenic
1133020478 16:2964741-2964763 GCTCCTGCAGGGGCGGGTGCGGG + Intronic
1133190726 16:4131812-4131834 GGTCCAGGAAGGGCCGGCACTGG + Intergenic
1134009508 16:10841361-10841383 GATCCTTGAAGGGCGGCCTGTGG - Intergenic
1134227134 16:12399857-12399879 GCTCCTGGAACGGCAGAGTCCGG + Intronic
1136605294 16:31329773-31329795 GCACCGGGGAGGGCGGGGTCAGG - Intronic
1137578159 16:49617544-49617566 GGTCCTGGAGGGGCTGGCACTGG - Intronic
1137614275 16:49837609-49837631 TCTCCTGGAAGGGCTGGAGCAGG - Intronic
1139750838 16:69107853-69107875 TCTCCGGGAAGCGCGGCCTCCGG - Intronic
1139997263 16:70992671-70992693 GGGCCTGGAAGTGCAGGCTCGGG + Intronic
1141421248 16:83917947-83917969 GCCGCTGGGAGGACGGGCTCAGG + Exonic
1141744944 16:85919465-85919487 GGGCCTGGAAGGGCGGGTGCAGG + Intronic
1142006015 16:87689911-87689933 GCTCCTGGAGGGCCGGGCCGGGG + Exonic
1142469707 17:156449-156471 GCAGCCGGATGGGCGGGCTCAGG - Intronic
1143861121 17:9891468-9891490 GCTCTTGCAAGTGCAGGCTCTGG + Exonic
1144006623 17:11106174-11106196 GCTCCTGGAAGGTAGGGGTGTGG - Intergenic
1146970000 17:37064956-37064978 ACTCCTGGAAGCTCAGGCTCTGG + Intergenic
1148406966 17:47424039-47424061 GCTCCGGGAGGTGCGCGCTCGGG + Intronic
1150830130 17:68511894-68511916 GCCCCTGCAAGGGAGGGCCCCGG - Intronic
1151604568 17:75128469-75128491 ACTTCTGGAAGGGTGGGCTGTGG + Intronic
1154194396 18:12254893-12254915 CCTCCTGGAAGCGCGGGCTCTGG + Intronic
1154496253 18:14963460-14963482 GCTGATGGAGGGGCGGCCTCTGG + Intergenic
1156486731 18:37471199-37471221 GCTCCTGGAAAGGGGGACTGAGG + Intronic
1157107937 18:44792445-44792467 GCTCCCTGAATGGTGGGCTCAGG - Intronic
1157760961 18:50265507-50265529 GCTCCTTGAAGGGAGGGCTCAGG + Intronic
1160492214 18:79347963-79347985 GGTCCAGGAAGGGCAGGGTCCGG + Intronic
1160492221 18:79347979-79348001 GGTCCGGGAAGGGCAGGGTCCGG + Intronic
1161146824 19:2683870-2683892 GCTCCTGCAGGGGCTGGCTAGGG + Intronic
1161256459 19:3312699-3312721 GCTCCTGGAGGGCAGGGCCCGGG - Intergenic
1161845026 19:6707394-6707416 GCTCCTGCACGGCCGGGCTGGGG + Intronic
1162124097 19:8490131-8490153 GCTCCTGGGTGAGCGGGCGCTGG + Exonic
1162267139 19:9584725-9584747 CCTGCTGGAAGGGCGGGCGTGGG + Intergenic
1162501767 19:11058204-11058226 GCTCCCGGGTGGGCGGACTCGGG + Intronic
1162508860 19:11105102-11105124 GCCCCTGGAAAGGCGGGCTGGGG - Intronic
1163795428 19:19335157-19335179 GCTCCAGGAAGGGCTGACACAGG - Intronic
1164625204 19:29723279-29723301 GCTGATGGAGGGGCGGGTTCTGG + Intergenic
1165099157 19:33428319-33428341 GGTCCTGGAAGAGGGAGCTCGGG - Intronic
1165899702 19:39163347-39163369 GCCCCTGGAAGGGAGGGGGCTGG - Intronic
1166087668 19:40487818-40487840 GCTCCTGGAAGTGCTGTCTGGGG + Exonic
1166329223 19:42069181-42069203 GGTCCTGGAAGGCTGGGCTCTGG - Intronic
1167327881 19:48836506-48836528 GATCCTGGAAGTCCGGCCTCGGG + Exonic
1167379062 19:49128192-49128214 GCGCCTGGAAGGGAGGAGTCTGG + Intronic
1167674610 19:50876679-50876701 GCTCCTGGGTGGGCAGGCCCAGG - Exonic
1168604470 19:57747372-57747394 CCTCCTGGAAGAGCAGGCTGAGG + Intronic
1168628100 19:57934863-57934885 TCTCCTGGAAGAGCAGGCTGGGG - Intronic
1202704687 1_KI270713v1_random:14060-14082 CCTCCTGGGAAGGCAGGCTCAGG + Intergenic
926153787 2:10439406-10439428 GCTCCCGGAAGGTAGGGCTGTGG + Intergenic
926165746 2:10521539-10521561 GCTCCCTGAGGGGCGGGGTCAGG + Intergenic
926914484 2:17879011-17879033 GCTCCAGCGACGGCGGGCTCTGG - Intronic
927704970 2:25291312-25291334 GCTGCCGGAAGGGCGGGGGCGGG - Intronic
928025456 2:27735644-27735666 TATCCGGGAAGGGCGGGCGCGGG + Intergenic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
931253232 2:60551231-60551253 GCGCCTGGAAAGGCGGGCGGTGG - Intronic
932592414 2:73075356-73075378 GCTGCTGGAAGGGGGCCCTCTGG - Exonic
933259542 2:80116714-80116736 GCTACTGGAAGAACAGGCTCAGG + Intronic
933864744 2:86505886-86505908 GCTCCTGGAGGTTCTGGCTCTGG + Exonic
935150279 2:100427709-100427731 GCTTCTGGGAGGCCGGGCTCTGG + Intergenic
935233692 2:101120282-101120304 GCACCAGGAAGGGTGGGCACCGG - Intronic
935447092 2:103168204-103168226 GCTCCTGGCAGGGCGGGGGCAGG - Intergenic
936041742 2:109155049-109155071 GCTCATGGAAGCTGGGGCTCTGG + Intronic
936125848 2:109788705-109788727 GCTCTTGGAAGGGAGGGTTCTGG - Intergenic
936218845 2:110582763-110582785 GCTCTTGGAAGGGAGGGTTCTGG + Intergenic
937540156 2:122939971-122939993 GCTTCTGGCAGGCCAGGCTCTGG + Intergenic
937810482 2:126194407-126194429 GCAGCTGGGAGGGCAGGCTCAGG + Intergenic
942151105 2:173076304-173076326 GCGCCTGGAGGCGCGGGCGCAGG + Intronic
942444806 2:176070893-176070915 GCTGCTGGGAGGGTGGGCTTGGG - Intergenic
942972304 2:181971371-181971393 GGTCCTGGAATGGGGGACTCAGG + Intronic
943581988 2:189694704-189694726 GCTCCTGGAAGGCCTAACTCTGG - Intronic
946032542 2:216716561-216716583 GCTCCTGGAAAAGCTGGGTCTGG + Intergenic
946389896 2:219408947-219408969 GCTGCTGGAGGGAGGGGCTCTGG + Intergenic
946634252 2:221707048-221707070 GCTCCTGGAAGGGCTGGGTGGGG - Intergenic
946886499 2:224227537-224227559 GCTCCTGGGAGAGGAGGCTCTGG - Intergenic
948197493 2:236106541-236106563 GCTTCGAGAAGGGTGGGCTCTGG + Intronic
948415037 2:237797005-237797027 GACCCTGGAAGGGGTGGCTCTGG - Intronic
948767048 2:240227863-240227885 GCTCCTGGGAGGGCGGGGACAGG - Intergenic
948897250 2:240933226-240933248 GCTCCAGCAGGAGCGGGCTCGGG + Intronic
948902867 2:240965050-240965072 CCTCCTGTAATGGCGGCCTCGGG + Intronic
1169262428 20:4148716-4148738 GCTCCCGGCGGGGCGGGCCCGGG + Intronic
1170983678 20:21238821-21238843 GCTCTTGGAAGGCCTGGCTGAGG + Intronic
1171232508 20:23498916-23498938 GCCCCTGGAAGGCAGGGCTGTGG - Intergenic
1172066980 20:32228282-32228304 GCTCCTGGCAGGGCAAGCACCGG - Exonic
1173865537 20:46310038-46310060 GCACCTGGAAGGCTGGCCTCTGG - Intergenic
1173952124 20:47001639-47001661 GCTCCCAGATGGGAGGGCTCAGG - Intronic
1174210292 20:48872854-48872876 CCTCCTGAAAGGGCTGACTCAGG - Intergenic
1174881595 20:54285121-54285143 GCTCCTGAAAGAGCAGTCTCAGG - Intergenic
1175160287 20:57003173-57003195 GTGCATGGAAGGGAGGGCTCAGG - Intergenic
1175521883 20:59607050-59607072 GATGGAGGAAGGGCGGGCTCAGG + Intronic
1175887762 20:62302319-62302341 GCTCCTGGAGGGGAGGGATCTGG - Intronic
1175939446 20:62531312-62531334 GCTCAGGGAGGGGCAGGCTCAGG - Intergenic
1175939452 20:62531328-62531350 GCTCAGGGAGGGGCAGGCTCAGG - Intergenic
1176020226 20:62958955-62958977 GATGCTGGAGGGGCTGGCTCTGG - Intronic
1176375498 21:6085207-6085229 GCTGCTGTGGGGGCGGGCTCTGG - Intergenic
1178832764 21:36070277-36070299 GCTGGTGGAAGCGCGGGCTCAGG - Exonic
1178840647 21:36135354-36135376 GTTGGTGGAAGCGCGGGCTCAGG - Exonic
1178975956 21:37221213-37221235 GCTGCTGGACGGCCGGGGTCTGG - Intergenic
1179747976 21:43453037-43453059 GCTGCTGTGGGGGCGGGCTCTGG + Intergenic
1179798616 21:43799875-43799897 GGGCCTGGGAGGGTGGGCTCAGG + Intronic
1180178101 21:46099789-46099811 GCTCTTAGAAGGGCGGCATCTGG + Intronic
1180187117 21:46145476-46145498 CCTCGCGGAAGGGCGGGATCAGG + Exonic
1180636426 22:17266069-17266091 GTCTCTGGAAGGGCGGGCCCTGG + Intergenic
1180737000 22:18024556-18024578 GCTGCTGGCTGGGCGGGCTGCGG + Exonic
1182071220 22:27465086-27465108 GCTCCTGGGAGGCCAAGCTCAGG + Intergenic
1182513598 22:30838124-30838146 GATCCTAAAAGGGTGGGCTCTGG - Intronic
1182576899 22:31278950-31278972 GCTCCAGGAAGGACAGGATCTGG - Intronic
1183317790 22:37146385-37146407 GCTCCTGTGAGGGCAGGGTCTGG - Intronic
1183544711 22:38449238-38449260 GGTCCTGGAGGGGCTGGCACTGG + Intronic
1183951829 22:41356811-41356833 GCTCCTGGGAGGGCAGGGCCTGG + Intronic
1184204556 22:42993777-42993799 CCTCCTGGAAGGGCGGCACCAGG + Intronic
1184976164 22:48063979-48064001 GCTCCTGCCAGGGCAGGGTCTGG - Intergenic
1185008982 22:48302644-48302666 GCTCCTGGAAGGAAGGGCCTTGG - Intergenic
1185248458 22:49786261-49786283 GCTTCTGGAGGTGCCGGCTCAGG - Intronic
950488143 3:13284999-13285021 GCTCCTGAAAGGCAGGGCTGAGG - Intergenic
954869655 3:53758082-53758104 GATCCTGGAAGTGCAGCCTCTGG + Intronic
961663252 3:128481475-128481497 ATTCCAGGAAGGGCGGGTTCTGG + Intronic
964853657 3:161121756-161121778 GCTCCTGGAAGTTCAGGCTAGGG + Intronic
965622508 3:170655509-170655531 GCTCCTGGAAGGTTGGGATTGGG + Intronic
966818816 3:183909289-183909311 GGTCCTGGAAGAGCGGGGTGAGG + Intergenic
967044047 3:185720126-185720148 ACTCCTGGAAGGCAGGGCACAGG - Intronic
968460667 4:723334-723356 GCACCTGGAGGGGCTGGCCCTGG + Intronic
968481220 4:833885-833907 GCGCCTGGCTGGGCCGGCTCGGG - Intergenic
968643910 4:1729016-1729038 GATCCAATAAGGGCGGGCTCAGG + Intronic
968830968 4:2932919-2932941 GCTCCTTGAAAGCCTGGCTCTGG + Intronic
970451392 4:16169657-16169679 GCTCCTGCAGTAGCGGGCTCAGG - Intronic
977584564 4:98760595-98760617 GCTCTTGAAAGGGCTGGCTATGG - Intergenic
981532095 4:145762869-145762891 GCTCCTGCAGGGCAGGGCTCAGG + Intronic
985960505 5:3299559-3299581 GCTCCTGGAGGAGCCGTCTCAGG - Intergenic
986061401 5:4195091-4195113 GCTCCTGGAAGGGTAGGGGCAGG - Intergenic
997941824 5:138164880-138164902 GCTCCTGAAATGACTGGCTCTGG + Exonic
998095366 5:139393238-139393260 GGTCCTGGAGAGGCGGCCTCGGG - Exonic
998174806 5:139895187-139895209 GCTCCTGGCAGAGGGGGCTGTGG - Intronic
998302831 5:141041322-141041344 GCTTCCGGTAGGGCGGGGTCGGG + Intergenic
998370256 5:141656159-141656181 GGCCCTGGAAGTGCGGGCTGGGG + Intronic
999098043 5:148998785-148998807 GCTGCTGGAAGTGCTGGCTCTGG - Intronic
999445077 5:151632753-151632775 GCGTGTGGAAGGGCGGGCACCGG + Intergenic
1001573838 5:172748825-172748847 GCTCCCGGAAGGGAGGGTTCGGG - Intergenic
1002454593 5:179338912-179338934 GATCCTGGAAGGGTGGGGTCTGG + Intronic
1002534842 5:179870414-179870436 GCTCCAGGTAGGGCAGGCTGGGG + Exonic
1003961223 6:11211051-11211073 ACTCCTGGAAGGGCTGGCACAGG + Intronic
1005987236 6:30882852-30882874 GCTCCTGGAAGGAGGGGCTGTGG + Intronic
1006028981 6:31165402-31165424 GATCCTGGAAGGGTTGGCTCTGG + Intronic
1007021819 6:38528616-38528638 GCACCTGGAATGGGGGCCTCAGG - Intronic
1007809403 6:44475685-44475707 GCTGCTGGAGCTGCGGGCTCTGG - Intergenic
1009978669 6:70700938-70700960 GGTCCTGGAATGGGGGCCTCAGG + Intronic
1010186596 6:73151237-73151259 GCTCCTGGAAAGGTGGTCTAGGG - Intronic
1013870712 6:114755868-114755890 GCTCCTGGAAAGGTGGTCTATGG + Intergenic
1014149920 6:118042849-118042871 GCTTTTGGAAGGGCTGGCTTGGG + Intronic
1016361207 6:143269029-143269051 GCTCCTAGTAGGGTGGGCTCAGG + Intronic
1018291811 6:162298963-162298985 GCTCCTGGAAGAGCGGGGGCTGG - Intronic
1018860163 6:167705445-167705467 GATCCGGGCAGGGCGAGCTCAGG + Intergenic
1018874154 6:167804956-167804978 GCTCCTGGAGTGGCGAGCTCTGG - Intergenic
1019021865 6:168925611-168925633 GCTCCTGCAAGAACAGGCTCAGG - Intergenic
1019428627 7:988570-988592 GCTCCTGGAGGGGAGGGGTGGGG - Intronic
1019686303 7:2384002-2384024 GCACCTGGGTGTGCGGGCTCTGG + Intergenic
1019770768 7:2882605-2882627 GGTCCTGCCAGTGCGGGCTCTGG + Intergenic
1020012737 7:4815520-4815542 GAGCCGGGAAGGGCAGGCTCTGG - Intronic
1023253678 7:38291480-38291502 GCTGCAGGGAGGGCAGGCTCCGG + Intergenic
1023687779 7:42754119-42754141 GCTCCAGGAAGCTTGGGCTCAGG - Intergenic
1025850574 7:65240027-65240049 GCTCCTGGATCGTCTGGCTCGGG + Intergenic
1027138407 7:75639931-75639953 ACTCCAGGAAGGGCTGGCTGTGG - Intronic
1027151895 7:75739094-75739116 GCTCCTGAAGGGGCGGGGGCGGG - Intergenic
1032174503 7:129612156-129612178 GCTGCGGGAAGGCCGGGCCCCGG - Intronic
1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG + Intergenic
1034971620 7:155423202-155423224 GCTCCAGGGAGGGCGGGCCGGGG - Intergenic
1035394453 7:158526125-158526147 GCTTCTGAAAGGGCCCGCTCTGG + Intronic
1035568146 8:655486-655508 GCTCCTGCAAGGGCAGGTGCTGG - Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036259352 8:7228054-7228076 GCTGCTGGAAGGGCTGGCCATGG + Intergenic
1036307272 8:7611470-7611492 GCTGCTGGAAGGGCTGGCCATGG - Intergenic
1036311395 8:7686624-7686646 GCTGCTGGAAGGGCTGGCCATGG + Intergenic
1036358116 8:8059457-8059479 GCTGCTGGAAGGGCTGGCCATGG - Intergenic
1036892833 8:12607489-12607511 GCTGCTGGAAGGGCTGGCCATGG + Intergenic
1038446029 8:27604945-27604967 GGTGCTGGAAGGCCGGGCTATGG + Exonic
1039469020 8:37802295-37802317 GCTGGTGGAGGGGCGGGCCCAGG + Intronic
1042367286 8:67952152-67952174 ACTCCTGGGAGTGGGGGCTCCGG - Exonic
1045017841 8:98014169-98014191 GCTCCAGGAAGGAAGGGCTTAGG + Intronic
1047499355 8:125430070-125430092 GCTCCGGGCAGCGCGCGCTCGGG - Intergenic
1049215595 8:141406433-141406455 TCTCCGGAAAGGGCGGGCTCTGG - Intronic
1049290683 8:141800053-141800075 CTTCCTGGAAGGCCTGGCTCTGG + Intergenic
1049555352 8:143278756-143278778 GCTCCTGGAGGGGCGGGGAGGGG + Intergenic
1049672138 8:143874689-143874711 GCTCCTGGGTGGGTGGGCACAGG - Intronic
1053152342 9:35751000-35751022 GCTCCTGGAGGGAAGGGCTGGGG + Intronic
1055497710 9:76872098-76872120 GCACCTGGAAGGGTAGGCCCTGG + Intronic
1056243067 9:84668720-84668742 GCTCCGGGCAGCGCGGGCGCAGG + Intronic
1057311047 9:93943442-93943464 GCTGCTGCAAGGGCAGGCTTTGG + Intergenic
1058438805 9:104988862-104988884 CCACCTGGAAGGCTGGGCTCAGG - Intergenic
1059060624 9:111032292-111032314 GCTCCTGGAAGGTTAGGATCTGG - Intronic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1061328801 9:129879705-129879727 GCTCCTGGAAGGACGGGACTGGG - Intronic
1062044967 9:134420777-134420799 GCTCCTGGCAGGTGGGGCTTGGG - Intronic
1062290834 9:135793659-135793681 GCTGCTGGAGGGGCCGGCCCTGG + Intergenic
1062292881 9:135805137-135805159 GCGCCTGGAAGGCAGGGTTCAGG + Intergenic
1062606064 9:137349384-137349406 GCTCCTCGCAGAGCGGCCTCCGG + Exonic
1062617995 9:137406834-137406856 ACTCCTGGAAGGGAGGGGTGGGG - Intronic
1189909592 X:45796659-45796681 GCTCCTGGAGGGCCTGGGTCAGG - Intergenic
1190733046 X:53236976-53236998 GCTCCTGGAAGGGCAGGAGCAGG + Intronic
1192865767 X:75130588-75130610 GCTCCCTGAAGGACTGGCTCAGG + Intronic
1192950570 X:76011900-76011922 TCTCATGGAAGGACGGACTCTGG + Intergenic