ID: 900620812

View in Genome Browser
Species Human (GRCh38)
Location 1:3586836-3586858
Sequence CGGCCTGATGGTCCAACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900620801_900620812 9 Left 900620801 1:3586804-3586826 CCCAGGAGGGGAGGGAGACCTGC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 68
900620792_900620812 26 Left 900620792 1:3586787-3586809 CCACAGGGCCCAGATGACCCAGG 0: 1
1: 0
2: 11
3: 59
4: 380
Right 900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 68
900620797_900620812 18 Left 900620797 1:3586795-3586817 CCCAGATGACCCAGGAGGGGAGG 0: 1
1: 0
2: 4
3: 34
4: 285
Right 900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 68
900620802_900620812 8 Left 900620802 1:3586805-3586827 CCAGGAGGGGAGGGAGACCTGCC 0: 1
1: 0
2: 2
3: 36
4: 351
Right 900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 68
900620799_900620812 17 Left 900620799 1:3586796-3586818 CCAGATGACCCAGGAGGGGAGGG 0: 1
1: 0
2: 3
3: 36
4: 285
Right 900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 68
900620806_900620812 -9 Left 900620806 1:3586822-3586844 CCTGCCGGGCCCGCCGGCCTGAT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900620812 Original CRISPR CGGCCTGATGGTCCAACAGC TGG Intronic
900229776 1:1550791-1550813 AGGCCTGGTGGTTCATCAGCAGG + Intronic
900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG + Intronic
900950425 1:5855479-5855501 CAGGCTGATGGCCCAACAGAGGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
1067038304 10:42934667-42934689 AGGCCTGATGGGACAACAGCAGG - Intergenic
1067142153 10:43667113-43667135 CGTCCTAAATGTCCAACAGCAGG - Intergenic
1069991581 10:72319749-72319771 CGGCCTGATGGGGCAATCGCTGG + Intergenic
1070784743 10:79156379-79156401 CGTCCTGAGGGCCCAGCAGCAGG + Intronic
1077094936 11:795288-795310 CGTCCTGAGGGTGCAGCAGCGGG + Intronic
1078448111 11:11420232-11420254 GGGTCTGAGGGTCCCACAGCAGG - Intronic
1079731102 11:23938416-23938438 CAGCCAGATGATCCAACAACAGG - Intergenic
1083826411 11:65206459-65206481 CGGCCGGCTGGCCCACCAGCTGG - Exonic
1085454856 11:76660068-76660090 CGGGCTGATGGTCCTGCAGGTGG - Exonic
1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG + Intronic
1093022897 12:14219523-14219545 TAACCTGATGGTCCAACAACAGG + Intergenic
1095985006 12:47993652-47993674 CATCCTGATGGGCCAACAGCAGG - Intronic
1096561912 12:52441712-52441734 CGGCCAGATGGGAGAACAGCCGG - Intergenic
1104943966 12:132407420-132407442 GTGGCTGATGATCCAACAGCGGG + Intergenic
1106804038 13:33287729-33287751 CGGCTTGATGGTCCAACACTGGG + Intronic
1107690486 13:42948209-42948231 CTGCCTGATGGTCAAAGAGGTGG + Intronic
1110620390 13:77587802-77587824 GGGCCTGAAGGTCCAACCCCTGG + Intronic
1112339371 13:98539956-98539978 CGGCCTAAATGTCCACCAGCTGG + Intronic
1116763095 14:49038933-49038955 GGGCCTGATGGTACAACTCCAGG - Intergenic
1128753503 15:70165514-70165536 TGGCCTCATGGTCACACAGCAGG + Intergenic
1132548172 16:543237-543259 CGGCCTGGTGCTCAAAAAGCAGG - Intronic
1136171302 16:28491510-28491532 CGCCCTGATGGTCCAACAGAGGG + Exonic
1140474345 16:75231731-75231753 CAGCCTAAGTGTCCAACAGCAGG + Intronic
1140878292 16:79173676-79173698 CAACCTGAAGGTTCAACAGCAGG + Intronic
1141266520 16:82502727-82502749 GGGCCTGGTGGGCCAAGAGCAGG + Intergenic
1142227687 16:88885507-88885529 GGGCCTGGTGGTCAAAGAGCCGG + Intronic
1142912109 17:3103005-3103027 AGGCCTCATGGTGCAACTGCAGG + Intergenic
1155476000 18:26236471-26236493 CGACCAGATGATCCAACAACAGG - Intronic
1156216752 18:35006994-35007016 CTGCATGATGTTCCAACAGCTGG + Intronic
1161394751 19:4038979-4039001 TGGCCTCAGGGTCCAACAACTGG + Exonic
926523050 2:13941851-13941873 AGGCCTGATGGTCCACCAGATGG - Intergenic
928121042 2:28583706-28583728 AGGCCGGATGCTCCAACAACAGG + Intronic
932637992 2:73409941-73409963 CTGCCTGATGGTCTTCCAGCTGG - Intronic
947484974 2:230539717-230539739 CTGTGTGATGGTCCCACAGCAGG - Intronic
1171974811 20:31587767-31587789 CGGCCAGATGTTCCAGGAGCGGG - Intergenic
1174773692 20:53324274-53324296 AGCACTCATGGTCCAACAGCAGG + Intronic
1178523390 21:33304408-33304430 CGGCCTGCTGAGCCATCAGCAGG + Intergenic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1182236983 22:28883753-28883775 CGGCCTCATGGTCCTGCGGCGGG - Exonic
1184716960 22:46287964-46287986 TGGTCAGATGGGCCAACAGCAGG + Intronic
1185324690 22:50219922-50219944 CAGCCTGGGGGTCCCACAGCAGG - Intronic
950087445 3:10270330-10270352 GGGGCTGCTGGTCCAATAGCTGG - Exonic
952174107 3:30843150-30843172 CGGTCTGAAGCTCCATCAGCAGG + Intronic
954205268 3:49054239-49054261 GGGCCTGATGGTCCAATTGCAGG - Intronic
955874265 3:63473761-63473783 CAGCATGAAGGTCCTACAGCTGG + Intronic
959159591 3:102707238-102707260 AGGCCAGATGCACCAACAGCAGG - Intergenic
962281750 3:134057415-134057437 CTGGCTGATTGGCCAACAGCAGG - Intergenic
969073231 4:4556760-4556782 AGGCCTGTGGGTCCAACAGGAGG - Intergenic
970451252 4:16168490-16168512 AGGCCTGATGGAGGAACAGCAGG - Intronic
971506286 4:27369807-27369829 AGGCATGATGGTCCAAGAGAAGG + Intergenic
971578571 4:28306170-28306192 CAGCCAGATGATCCAACAACAGG + Intergenic
978792548 4:112677877-112677899 AGGCCTGATGGTCCACTAGAAGG - Intergenic
984939705 4:184920247-184920269 CGACCAGATGATCCAACAACAGG - Intergenic
1002789394 6:426478-426500 CGGCCTGATGCTCCGAGTGCGGG + Intergenic
1002907041 6:1457248-1457270 CGGCCTGATGCTCCGAGTGCGGG + Intergenic
1012450340 6:99348356-99348378 CGGCTGGATGTACCAACAGCAGG + Intronic
1013907767 6:115237985-115238007 CAACCTGATGATCCAACAACAGG - Intergenic
1018430722 6:163719588-163719610 CAGGCTGACTGTCCAACAGCGGG + Intergenic
1022198586 7:28094329-28094351 CAGCCTGAAGGTCCCACGGCTGG + Intronic
1023492981 7:40763967-40763989 AGGCCTGCTGTTGCAACAGCTGG - Intronic
1024152809 7:46590012-46590034 GGGCCTGATGGTCCAGCCCCTGG + Intergenic
1028910225 7:96199563-96199585 AGGCCAGAAGGTCCAAGAGCAGG + Intronic
1029170707 7:98627486-98627508 AGGTCTGAGGGGCCAACAGCTGG - Intronic
1030420592 7:109302361-109302383 CGACCAGATGATCCAACAACAGG + Intergenic
1045003777 8:97900292-97900314 TGGCCAGATGGACCAAGAGCTGG + Intronic
1061639790 9:131943841-131943863 TGGCTTGATGGTCCAAGAACTGG + Intronic
1062000743 9:134214543-134214565 CTGCGTGATAGCCCAACAGCAGG + Intergenic
1196803632 X:119565232-119565254 CGGCCAGATGGTCCTAGTGCTGG - Exonic
1197726371 X:129779634-129779656 CAGCCAGATGGTCCAACTTCTGG + Intergenic
1199832336 X:151559053-151559075 CAGCCAGATGATCCAACAACAGG - Intergenic
1202074640 Y:21025946-21025968 CAACCAGATGGTCCAACAACAGG - Intergenic