ID: 900622346

View in Genome Browser
Species Human (GRCh38)
Location 1:3593217-3593239
Sequence GTTCAGCCGCTCCCCGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900622346 Original CRISPR GTTCAGCCGCTCCCCGCTGT GGG (reversed) Intronic
900622346 1:3593217-3593239 GTTCAGCCGCTCCCCGCTGTGGG - Intronic
905704018 1:40040750-40040772 GATCAGCCGCTCTCCGCTTCCGG - Exonic
906488124 1:46247379-46247401 GCCCAACCGCTCCCCACTGTTGG + Intergenic
910722299 1:90300142-90300164 CTTCAGCCGCCCTCAGCTGTTGG - Intergenic
915298366 1:154937585-154937607 GTTCTGCCTCTTCCCGCAGTAGG + Intergenic
916002712 1:160632312-160632334 GTCCAGCCGTTCCCCTCTCTTGG - Intronic
918969559 1:191396971-191396993 TTTCAGCAGCACCCCGCTCTTGG - Intergenic
920506251 1:206517509-206517531 GTTAAGCTGGTCCCCGCTGGTGG + Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923778229 1:236998700-236998722 GCTCAGCCTCTCCTGGCTGTAGG - Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1075728417 10:124622468-124622490 GGTCAGCCTCTCCATGCTGTAGG + Exonic
1076918740 10:133440599-133440621 TGTCAGCAGCTCCCAGCTGTGGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077324900 11:1959452-1959474 GTCCAGCCGGTCCCTTCTGTGGG - Intronic
1083912820 11:65720116-65720138 CTTCAGCCGCTTCACCCTGTGGG - Exonic
1089321280 11:117628319-117628341 GATCAGCCGCTCCCCACCCTGGG - Intronic
1202807882 11_KI270721v1_random:14631-14653 GTCCAGCCGGTCCCTTCTGTGGG - Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1095956499 12:47809309-47809331 GTTCTGCCTCTCCCAGCTGCAGG + Intronic
1096096516 12:48938992-48939014 GTACAGCCCGTCCCCGCTGGTGG + Exonic
1097679002 12:62631984-62632006 TTCCAGCCGCTCCCAGCTGTTGG + Intergenic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1103160842 12:118727926-118727948 ATCCAGCCCCTCCCTGCTGTGGG - Intergenic
1103726703 12:123000787-123000809 GTTCAGCTGCTCCACACTGGAGG + Exonic
1104660935 12:130611114-130611136 GTTCAGGCTCTGCCCGCTTTGGG - Intronic
1104661920 12:130617264-130617286 GTCCAGCAGCTCCCAGCTGCAGG - Intronic
1109410711 13:61964174-61964196 TTCCAGCCTCTCCCCACTGTTGG - Intergenic
1113633630 13:111905081-111905103 GGTCAGCCGCTCGCAGCTGCTGG + Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1123056057 14:105571404-105571426 GCTCGGCCGCTCCCAGCTGCAGG - Intergenic
1123057325 14:105577539-105577561 GCTCCGCCGCTCCCAGCTGCAGG + Intergenic
1123057869 14:105580392-105580414 GCTCAGCCGCTCCCAGCTGCAGG + Intergenic
1123080489 14:105691535-105691557 GCTCCGCCGCTCCCAGCTGCAGG - Intergenic
1123082153 14:105700325-105700347 GCTCGGCCGCTCCCAGCTGCAGG + Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1131499944 15:92952631-92952653 TTTCAGCCGCTCCCCATTGCTGG - Intronic
1140034831 16:71364181-71364203 GACCAGCTGCTCCCCGCTGCCGG - Intronic
1141603893 16:85142296-85142318 CTTCAGCAGCTCCCAGCTCTGGG + Intergenic
1146456701 17:33014589-33014611 GCTCAGCCCCTCCCCGCTTAGGG - Intronic
1148912594 17:50950853-50950875 CTTCAGCCGCTCCCCACACTGGG + Intergenic
1152667973 17:81582348-81582370 GTTCAGCTGCTTCCCACTGAAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1167508048 19:49881449-49881471 CCTCAGCCGCTACCTGCTGTTGG + Exonic
1168703636 19:58455777-58455799 GTAGGGCCGCTCCCCGGTGTGGG - Exonic
1168706144 19:58471325-58471347 GTAGGGCCGCTCCCCGGTGTGGG - Exonic
936060668 2:109293763-109293785 GTGCACCCTCTCCCAGCTGTAGG + Intronic
937941848 2:127292340-127292362 CATGAGCCGCTCCCAGCTGTGGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
947712884 2:232325968-232325990 GTTGAGCCGCTCCACACTCTGGG - Intronic
947714185 2:232331612-232331634 GCCCAGCCCCTCTCCGCTGTGGG - Intronic
947733395 2:232442991-232443013 GCCCAGCCCCTCTCCGCTGTGGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
948870313 2:240794573-240794595 CTTCAGCAGCTCCCAGCTGGCGG + Intronic
948900862 2:240956272-240956294 GCTCAGCCACTCGCTGCTGTTGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171211233 20:23318564-23318586 GCTCAGCCGCTCGTCGCTCTAGG - Intergenic
1183218137 22:36494496-36494518 GTTCAGCTTCTCCCTGGTGTGGG + Intronic
950444906 3:13031351-13031373 GCTGAGCCCCTCCCTGCTGTAGG - Intronic
954742872 3:52768544-52768566 GTTCAGCAGCTCGCCGCTCTCGG + Exonic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
962528279 3:136255239-136255261 ACTCAGCCACTCCCTGCTGTGGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
983043505 4:162957795-162957817 GTTCACAACCTCCCCGCTGTGGG + Intergenic
986061146 5:4192237-4192259 GTTCGGCCGCTCCCTTCTGTGGG + Intergenic
986282635 5:6336166-6336188 GTTGAGCTGCTTCCCCCTGTGGG - Intergenic
986420809 5:7579562-7579584 TTTCAGCTGCTGCCCGCTGTGGG + Intronic
987618398 5:20305714-20305736 GTTCAGCCGGAGACCGCTGTGGG + Intronic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1007902274 6:45422981-45423003 GTTCCGCCGCTCCCGGCCGGGGG - Intronic
1018783694 6:167091891-167091913 GTCCAGCCGGTCCCTGCTCTAGG - Intergenic
1018839057 6:167506048-167506070 GTTCAGCAGCTGCCTGATGTGGG - Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1026898095 7:74022060-74022082 GTTCGGCTGCTCCCCGCCCTGGG - Intergenic
1027051522 7:75024356-75024378 CTTCAGCCTCTACCCTCTGTGGG - Intronic
1027231378 7:76274638-76274660 GTTCTGCCGCTGCACCCTGTGGG - Intronic
1042571032 8:70165431-70165453 ATTCAGCTGCTCCCAGCTCTGGG - Intronic
1046794071 8:118351457-118351479 GTTCTGCCACTCCCTACTGTAGG - Intronic
1047203487 8:122785155-122785177 GTTCAGCTGCTCCCACCTCTAGG - Intronic
1049558611 8:143296364-143296386 GTACAGCCTCTCCCCGGTGTGGG - Exonic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1058720769 9:107761478-107761500 GCTCAGCCTCTCCCCTCTCTGGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1200404005 Y:2790186-2790208 CTTCAGCCGCTTCACCCTGTAGG + Intergenic