ID: 900622737

View in Genome Browser
Species Human (GRCh38)
Location 1:3594873-3594895
Sequence CCTCAGCTTCAGTGGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 178}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900622737_900622753 15 Left 900622737 1:3594873-3594895 CCTTACACCCACTGAAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 900622753 1:3594911-3594933 GGATTGGCCTTGGGAGAACACGG 0: 1
1: 0
2: 1
3: 21
4: 196
900622737_900622748 6 Left 900622737 1:3594873-3594895 CCTTACACCCACTGAAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 900622748 1:3594902-3594924 ACCCGGCCCGGATTGGCCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 39
900622737_900622754 21 Left 900622737 1:3594873-3594895 CCTTACACCCACTGAAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 900622754 1:3594917-3594939 GCCTTGGGAGAACACGGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 59
900622737_900622758 30 Left 900622737 1:3594873-3594895 CCTTACACCCACTGAAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 900622758 1:3594926-3594948 GAACACGGTATAGGGAAACAGGG 0: 1
1: 0
2: 2
3: 2
4: 74
900622737_900622757 29 Left 900622737 1:3594873-3594895 CCTTACACCCACTGAAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 900622757 1:3594925-3594947 AGAACACGGTATAGGGAAACAGG 0: 1
1: 0
2: 1
3: 12
4: 119
900622737_900622742 -6 Left 900622737 1:3594873-3594895 CCTTACACCCACTGAAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 900622742 1:3594890-3594912 CTGAGGCCCGCCACCCGGCCCGG 0: 1
1: 0
2: 1
3: 57
4: 1792
900622737_900622747 5 Left 900622737 1:3594873-3594895 CCTTACACCCACTGAAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 900622747 1:3594901-3594923 CACCCGGCCCGGATTGGCCTTGG 0: 1
1: 0
2: 0
3: 4
4: 75
900622737_900622743 -1 Left 900622737 1:3594873-3594895 CCTTACACCCACTGAAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 900622743 1:3594895-3594917 GCCCGCCACCCGGCCCGGATTGG 0: 1
1: 0
2: 1
3: 9
4: 136
900622737_900622756 22 Left 900622737 1:3594873-3594895 CCTTACACCCACTGAAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 178
Right 900622756 1:3594918-3594940 CCTTGGGAGAACACGGTATAGGG 0: 1
1: 0
2: 0
3: 3
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900622737 Original CRISPR CCTCAGCTTCAGTGGGTGTA AGG (reversed) Intronic
900622737 1:3594873-3594895 CCTCAGCTTCAGTGGGTGTAAGG - Intronic
903014097 1:20350686-20350708 CTTCCGCTCCAGTTGGTGTAGGG - Intronic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
906036257 1:42751879-42751901 CTGCAGCTTCAGTGGGGGTGTGG - Intronic
907142956 1:52205323-52205345 CCTCAGCTTCCCAGGGTGTTGGG + Intronic
910874340 1:91864211-91864233 CCACAGCTGCAGTGGGTCTGAGG + Intronic
911354477 1:96799072-96799094 CATCAGCTTCAGTGGAGGAAAGG + Intronic
912106178 1:106278581-106278603 CCTCAGCTTCACTGGTTTTGAGG - Intergenic
912140003 1:106713139-106713161 CCTCAGCTGCAGTGCAAGTAAGG + Intergenic
915247037 1:154563484-154563506 CATCATCTTCAGTGTGTGTCTGG - Intergenic
916488293 1:165278842-165278864 CCTCAGCAGCACTGGGTGCAGGG - Intronic
917469974 1:175318157-175318179 CCTCAAGTTAAGTGGGTGAATGG + Exonic
918825576 1:189319514-189319536 CCTCAGCTGCAGTGCAAGTAAGG + Intergenic
919538730 1:198821805-198821827 CGTTAGCTTCAGTGGAAGTAGGG + Intergenic
919918791 1:202155737-202155759 CAACAACTTCAGTGGGTGTAAGG - Intronic
920336222 1:205247140-205247162 CCTCAGCTTTGTTAGGTGTATGG + Intronic
920766910 1:208842207-208842229 TCTGAGGTTCAGTGGGTGTTTGG - Intergenic
922381177 1:225028251-225028273 CCTCAGCTTTTGTGTGTGTGTGG + Intronic
1062835251 10:631309-631331 CCGCTGCTACAGTGGGTGGAAGG - Intronic
1065306003 10:24369465-24369487 CCTCACCCTCAGTGAGGGTATGG - Intronic
1067831171 10:49611797-49611819 CCACACCTGCAGTGGCTGTACGG + Exonic
1067957544 10:50808821-50808843 CCCCAGGTGCAGTGGGTGTGAGG + Intronic
1069631182 10:69897868-69897890 GCTCAGCTTCAATGGGTAGAGGG + Intronic
1070752244 10:78971157-78971179 TCTCTGCTTCAGTGGGTTTGGGG - Intergenic
1072252881 10:93595658-93595680 CCCCAGCGTTAGAGGGTGTAAGG + Intronic
1075265731 10:120998533-120998555 CCTCAGCCTCTGTGGGTTTTAGG - Intergenic
1076001628 10:126917564-126917586 CCTCAGCTTCACAGGGTCTGTGG + Intronic
1076473928 10:130739321-130739343 CCTCAGCCTGAGTGGGGGTAAGG + Intergenic
1076766562 10:132637943-132637965 GCTCATCTTTAGTGGGAGTATGG + Intronic
1080913604 11:36631151-36631173 CCTTGGCTTCTGTGGGTGGAGGG - Intronic
1081693409 11:45093639-45093661 CCGCCGCTTCTGTGGGTGTGAGG - Intergenic
1083329288 11:61890173-61890195 CCTCAGCTTCATGGGGTGGAAGG + Intronic
1084104042 11:66969126-66969148 CCTCAGCTTCCTTGGGTTTTGGG - Intergenic
1084632431 11:70362406-70362428 CCTCAGCTTCAGCCTGTGCAGGG - Exonic
1086455228 11:86954520-86954542 CCTCAGCTCCACTGGGGTTAGGG + Intronic
1088841783 11:113633548-113633570 CCTCAACTACAGTGGCTGTGTGG + Intergenic
1090314925 11:125777782-125777804 CCTCAGCGTGAGTAGGTGAATGG - Intronic
1093588346 12:20869345-20869367 CCTCAGCTTCTGTCTCTGTATGG + Intronic
1095340158 12:41080587-41080609 CCACTGCTTCAGAGGGTGCAAGG + Intergenic
1097431594 12:59515192-59515214 CCTCAGCCTCACAGGGTGTTAGG - Intergenic
1098268434 12:68746620-68746642 CCTCAGCTTCTGTGGCTTTGTGG + Exonic
1100047448 12:90399874-90399896 CCTCAGCTGCAGTGCAAGTAAGG - Intergenic
1101305517 12:103524073-103524095 GCTCAGCTTAAGTGGGTTTAAGG + Intergenic
1101825507 12:108217380-108217402 CCTCCCCTTCAGTGGGTGAGAGG - Intronic
1102436620 12:112929210-112929232 CTTCAGCTTTCTTGGGTGTAAGG + Intronic
1102683757 12:114708262-114708284 CCTCAGTTTCTCTAGGTGTAAGG - Intergenic
1103740694 12:123089354-123089376 TATCAGCTTCATTGGGTGCAGGG - Intronic
1103864599 12:124041950-124041972 CCTCAGCTTCAGTGGGCTTGTGG + Intronic
1107532820 13:41300658-41300680 CCTCAGCTTCCCTGAGTGTTGGG + Intergenic
1110347376 13:74464342-74464364 CCACAGCTTGGGAGGGTGTAGGG - Intergenic
1113102156 13:106732583-106732605 CCTCAGCTGCACTGGATGGATGG + Intergenic
1114142019 14:19923208-19923230 TTTCAGCTTCAGTGTATGTATGG + Intergenic
1114205199 14:20564510-20564532 CCTCAGCAACTATGGGTGTAAGG - Intergenic
1115289250 14:31751841-31751863 CCTAAGTTTCAGAGGATGTATGG - Intronic
1117691656 14:58313681-58313703 CCTCAGCTTCCCTGGTTCTAAGG - Intronic
1117854180 14:60010231-60010253 CCTAGATTTCAGTGGGTGTATGG - Intronic
1119916412 14:78406342-78406364 CTTCAGCTTCCGGGGGGGTAGGG - Intronic
1124147237 15:27139194-27139216 CATCAGCTTCCCTGGGTCTAAGG - Intronic
1125382526 15:39102672-39102694 CCTCTGCTTCTGTGGCTGTATGG + Intergenic
1127659117 15:61083461-61083483 CCTCAGATTCAGAGGGACTAAGG - Intronic
1130140626 15:81223190-81223212 CAACAGTTTCAGTGGCTGTAGGG + Intronic
1130288479 15:82574828-82574850 CCTCAACTACAGTGGGGTTATGG + Intronic
1131535414 15:93233109-93233131 CTGCAGCTTCAGTGGGAGAAAGG - Intergenic
1131820166 15:96264537-96264559 TTTCAGTTTCAGTGGGTTTAGGG + Intergenic
1136534722 16:30892992-30893014 CCTCAGTTTCCTTAGGTGTATGG - Intronic
1139818141 16:69693945-69693967 CCTCAGATTCAGTTGGTACAAGG + Exonic
1140727078 16:77823091-77823113 CTTCAGCCTCAGTGTGTGTCTGG - Intronic
1143013679 17:3880212-3880234 AATCAGCTTCAGTGGGAGTGGGG - Intronic
1143270911 17:5673769-5673791 CCTCAGGTTCAGTGTGTGTTTGG + Intergenic
1143829922 17:9643184-9643206 CATCAGCTTCAGGAGGTATATGG - Exonic
1144523351 17:15969066-15969088 CCTCAGCTGCAGTGGAAGGAAGG - Intronic
1146717149 17:35095932-35095954 CATCAGCTTCAGTGGGTTCCAGG + Intronic
1148102253 17:45099419-45099441 AATCAGCTTCCGTGGGTTTAGGG - Exonic
1149813595 17:59702167-59702189 CCTCAGCTTAACAGGGTGTATGG - Intronic
1152087656 17:78230601-78230623 CCCCAGCTGCAGTGTGTTTAGGG + Intergenic
1152855348 17:82662499-82662521 CCCCAGCCCCAGTGGGTGTGGGG + Intronic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1157499817 18:48181708-48181730 CCAGGGCTTCAGTGGGAGTAAGG - Intronic
1160713533 19:564548-564570 CCTCAGAGTCTGTGGGTGTGTGG - Intergenic
1160996297 19:1883619-1883641 GCTCAGATCCAGTGGGTGGAAGG - Intronic
1161300162 19:3538672-3538694 CCTCACCTTCACTGGGTGTTCGG + Intronic
1163291324 19:16381233-16381255 CCTCAGTTTCCTTGTGTGTAAGG - Intronic
1167783155 19:51613716-51613738 CCTCAGTTTCCCTGTGTGTAAGG - Intronic
925290588 2:2745710-2745732 CCTCAGCTTCACAGCTTGTATGG + Intergenic
926626738 2:15096717-15096739 CCTCTGCCTCAGTGGGTTTGTGG + Intergenic
927632406 2:24785902-24785924 CCTCCACTTCAGTGGGTCTGGGG + Intergenic
928683520 2:33726617-33726639 CCACAGCTGCAATGGGTGTGGGG + Intergenic
929959945 2:46488975-46488997 CATCTGCTTCAGTGGGTCTGGGG - Intergenic
930714917 2:54584505-54584527 CCACACCTTCAGTAGGTGAAAGG + Intronic
937294698 2:120802917-120802939 ACTCAGATTCAGTAGGTCTAAGG - Intronic
941035210 2:160560673-160560695 CCACAGCTACAGTGGGTGAACGG + Intergenic
942054972 2:172173521-172173543 CATCAGCATGTGTGGGTGTACGG + Intergenic
943349272 2:186778795-186778817 CAGCAGCTTGACTGGGTGTAGGG - Intergenic
945756800 2:213856673-213856695 CCTTTGCTTCAGAGGGTGCAAGG - Intronic
946289329 2:218731684-218731706 CCACAACTTCAGTCGGGGTATGG + Intronic
946580977 2:221128064-221128086 CCTAAATTTCAGAGGGTGTATGG + Intergenic
948420604 2:237858099-237858121 CCTCAGCTGCAGTGCAAGTAAGG - Intergenic
948932276 2:241139701-241139723 CTTCAGCTGCAGTGGGGGTGGGG - Intronic
1170555277 20:17509735-17509757 CATCAGCCCCAGTGGGTGAAAGG + Intronic
1171192096 20:23165995-23166017 GCTCACCATCAGTGGGTGGAGGG + Intergenic
1171399687 20:24864847-24864869 CCTATGTTTCAGAGGGTGTATGG + Intergenic
1172353611 20:34263057-34263079 CCTGGGCTTCTGTGGGTGTCTGG - Intronic
1173307483 20:41863864-41863886 CATAAGCTTCAGTGAATGTAAGG + Intergenic
1176420246 21:6508369-6508391 CCTCGTCTTCACTAGGTGTAGGG + Intergenic
1176420371 21:6509140-6509162 CCTCAGCTCCTGTGTCTGTATGG + Intergenic
1177367218 21:20153695-20153717 CCGCTGCTTCAGAGGGTGCAAGG - Intergenic
1178943422 21:36926245-36926267 CCTTTGCTTCTGTGGGTGGAAGG - Intronic
1179695738 21:43116689-43116711 CCTCGTCTTCACTAGGTGTAGGG + Intergenic
1179695862 21:43117460-43117482 CCTCAGCTCCTGTGTCTGTATGG + Intergenic
1183139467 22:35923074-35923096 CTTCAGCTTCTGTGGATGCAAGG - Intronic
1183522607 22:38304068-38304090 CCTCAGTTTCCCTGGCTGTATGG + Intronic
1183530569 22:38351246-38351268 CCCCAGATCCAGTGGCTGTAGGG + Intronic
950753846 3:15155769-15155791 CCTCAGTTCCAGTGGGAGGAGGG + Intergenic
952929266 3:38346962-38346984 CCTCCGCTTCGGTGGGGGTAGGG + Intronic
954797333 3:53168259-53168281 CCCCAGCTGCCATGGGTGTAGGG - Intronic
955568845 3:60280634-60280656 CCACAGCTTCTGTGGGAGTACGG + Intronic
956378907 3:68645125-68645147 CCTGAGCTGCAGGGGGAGTAAGG - Intergenic
958928022 3:100179907-100179929 CCTCAATTTCAGAGGATGTATGG - Intergenic
961620200 3:128217787-128217809 CCTCAGCATCATGGGGAGTAGGG + Intronic
963298775 3:143576429-143576451 CCTCAGTTTCCTCGGGTGTAAGG + Intronic
964290847 3:155178619-155178641 CCTCAGCATCTGTGGGGGTTTGG + Intronic
965374671 3:167908522-167908544 CATCAGATTCAGTGGGCGTAGGG - Intergenic
965494389 3:169379938-169379960 CCTCAGCTTTACTGGGGCTATGG + Intronic
968763810 4:2457844-2457866 CCTCAGGTGCACTGGGTGCAGGG - Intronic
970866904 4:20769761-20769783 ATTCAGCTTCTGTGGTTGTAGGG + Intronic
974038258 4:56836106-56836128 ACTCAGATTCAGTGAGTCTAGGG + Intergenic
975710742 4:77157833-77157855 CCCCGGCATCAGTGGGTGGACGG + Intronic
977290720 4:95161844-95161866 CCTCAGCCTCCGTGGCTGAAGGG - Intergenic
979146169 4:117251457-117251479 CCTAAATTTCAGAGGGTGTATGG + Intergenic
982904295 4:161048681-161048703 CCACTGCTTCAGAGGGTGCAAGG - Intergenic
983338069 4:166421280-166421302 TCTCAGCTGCAGTGGCTATAGGG - Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
986332984 5:6731511-6731533 CCTCATATTCAGTGGGTTTAAGG + Intronic
987597532 5:20020688-20020710 CCTCAATTTCAGAGGGTGTATGG + Intronic
988085533 5:26470550-26470572 TGTCAGTTTCAGTGGGTGTCAGG + Intergenic
989746838 5:44839430-44839452 CCTCAATTTCAGAGGATGTATGG + Intergenic
993084592 5:83348347-83348369 CCTAGGTTTCAGTGGATGTATGG - Intronic
999716875 5:154368114-154368136 CATCTGCTTCAGTAGGTTTAAGG + Intronic
1002174361 5:177393217-177393239 CCTTATCCTCAGGGGGTGTAAGG - Intronic
1002602101 5:180359884-180359906 CCTTACCTTATGTGGGTGTATGG - Intergenic
1002779989 6:358541-358563 CCTCAGCCTCAGGGGTTGGAGGG - Intergenic
1003045922 6:2732654-2732676 TCTCAGCTCCAGTGGGTCTCGGG - Intronic
1004554597 6:16683388-16683410 TCTCAGCTTCAGTGCCTTTAAGG + Intronic
1004565159 6:16789260-16789282 CCTAAGATTCAGAGGATGTATGG - Intergenic
1008041768 6:46809085-46809107 TCTCTGCTTCAGTGGGGGAAAGG + Intronic
1008477700 6:51949860-51949882 CCTCTGCTTCTGTGTGTGTGTGG - Intronic
1008848194 6:55993654-55993676 CCTCAATTTCAGAGGATGTATGG - Intergenic
1009554752 6:65148776-65148798 CCTAGGTTTCAGAGGGTGTATGG - Intronic
1011382730 6:86760090-86760112 CCTAGATTTCAGTGGGTGTATGG + Intergenic
1012194175 6:96318202-96318224 CCTAAGTTTCAGAGGATGTATGG - Intergenic
1018075337 6:160207399-160207421 CCTCGATTTCAGAGGGTGTATGG - Intronic
1019081628 6:169435189-169435211 CCTCAATTTCAGAGGATGTATGG + Intergenic
1019504507 7:1384017-1384039 CCCCAGCTTCCGTGGGTGGGAGG + Intergenic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1020936597 7:14473290-14473312 CCATAGCTTCAGAGGGTGCAAGG + Intronic
1020999940 7:15316290-15316312 CATCAGCTGCAGTGGATGTGGGG - Intronic
1021219211 7:17955647-17955669 AGTCAGCTTTTGTGGGTGTATGG - Intergenic
1024383526 7:48725451-48725473 CCTCAATTTCAGAGGATGTATGG - Intergenic
1027137979 7:75638491-75638513 CCCCAGCTTCAGTGGGCCTGAGG - Intronic
1028295527 7:89125127-89125149 CTTCAGCTTAAGGGGGTGTCTGG + Intronic
1028550287 7:92053832-92053854 CCTCAGTTTCAGTAGGTCTGGGG - Intronic
1030967070 7:116006039-116006061 CCTCAATTTCAGAGGATGTATGG + Intronic
1031020842 7:116625974-116625996 GCTCAGGTTGAGAGGGTGTATGG - Intergenic
1033227739 7:139574627-139574649 CCTGAGTTTCTGTGGGTGCAGGG - Intronic
1033483402 7:141763802-141763824 ACTCAGTTTCAAAGGGTGTAGGG - Intronic
1034021704 7:147651229-147651251 CATCAGCTTCAGTTTGTGTCTGG - Intronic
1039838668 8:41278112-41278134 CCTGAGCTCCAGTGGGTTTGGGG - Intronic
1041053278 8:53957692-53957714 CCCCAGACTCAGTAGGTGTAGGG - Intronic
1041321447 8:56618283-56618305 CCTCTGCTTCTGTGGGTGGATGG + Intergenic
1041502816 8:58557608-58557630 CCTGAGATACATTGGGTGTAGGG + Intronic
1043714697 8:83467270-83467292 CCTCAATTTCAGAGGGTGTATGG + Intergenic
1044656515 8:94553831-94553853 CATCCCCTTCGGTGGGTGTACGG - Intergenic
1045004542 8:97906545-97906567 CCTCAGCTTCAGTAGCTGGTTGG - Intronic
1045615244 8:103901283-103901305 CCTCAGATTCAGAGGGTTCAGGG + Intronic
1047104932 8:121721563-121721585 CCTATGCTTCACTGGGTGTTGGG + Intergenic
1048985072 8:139730806-139730828 CCTCTGCTTCAGCCTGTGTATGG + Exonic
1049449133 8:142649696-142649718 CCTAGGTTTCAGAGGGTGTATGG + Intergenic
1051955731 9:22691141-22691163 CCACAGCTGCCCTGGGTGTAGGG + Intergenic
1053174956 9:35915985-35916007 CCTCAGTTTCCCTGGCTGTACGG + Intergenic
1057364920 9:94410690-94410712 GCTCAGCTTCATTGGGAGTAAGG + Intronic
1057658410 9:96977401-96977423 GCTCAGCTTCATTGGGAGTAAGG - Intronic
1057910327 9:99015351-99015373 CCCCTGGTTCAGTGGGTGTGAGG - Intronic
1059705471 9:116819320-116819342 CCTCAGCTTAAGTGACTGCAGGG - Intronic
1060556833 9:124512350-124512372 CCTCAGCTGCAGTGTGGGGAGGG + Intergenic
1061554399 9:131358036-131358058 CCTCATCTTCTGTGGGGGAAGGG - Intergenic
1187293597 X:17978077-17978099 TCTCAGCTTCTCTGGGTATAAGG - Intergenic
1187502408 X:19850860-19850882 CCTCAGATTCAGTAGGTCTCGGG - Intronic
1188162340 X:26819398-26819420 CCATTGCTTCAGAGGGTGTAAGG + Intergenic
1188559799 X:31454647-31454669 CTTTTGATTCAGTGGGTGTAAGG + Intronic
1189011357 X:37048772-37048794 CCTAAACTTCAGAGGATGTATGG + Intergenic
1189213372 X:39303205-39303227 CCTCAATTTCAGAGGATGTATGG + Intergenic
1191033948 X:56005569-56005591 CATCAGCATCAGTGGCTGCATGG + Intergenic
1191696593 X:63996662-63996684 CCTAGGCTTCAGAGGATGTATGG + Intergenic
1194558932 X:95396674-95396696 CCACTGCTTCAGAGGGTGCAAGG + Intergenic
1196309318 X:114143531-114143553 CATCAGCCTCAGTTGATGTAGGG + Intergenic
1196924093 X:120614907-120614929 CCACTGTTACAGTGGGTGTAAGG + Intronic
1201773594 Y:17641934-17641956 CCTCAGCTTCTCTGAGTGTCTGG + Intergenic
1201827962 Y:18264051-18264073 CCTCAGCTTCTCTGAGTGTCTGG - Intergenic