ID: 900623518

View in Genome Browser
Species Human (GRCh38)
Location 1:3598056-3598078
Sequence CAGGCTGCAGGGCAGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 769
Summary {0: 1, 1: 1, 2: 8, 3: 69, 4: 690}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900623518_900623536 26 Left 900623518 1:3598056-3598078 CCCCGGGCCTGCCCTGCAGCCTG 0: 1
1: 1
2: 8
3: 69
4: 690
Right 900623536 1:3598105-3598127 CCATCTCTGCCGCTGTCTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 233
900623518_900623538 28 Left 900623518 1:3598056-3598078 CCCCGGGCCTGCCCTGCAGCCTG 0: 1
1: 1
2: 8
3: 69
4: 690
Right 900623538 1:3598107-3598129 ATCTCTGCCGCTGTCTGCAGGGG 0: 1
1: 0
2: 2
3: 28
4: 201
900623518_900623537 27 Left 900623518 1:3598056-3598078 CCCCGGGCCTGCCCTGCAGCCTG 0: 1
1: 1
2: 8
3: 69
4: 690
Right 900623537 1:3598106-3598128 CATCTCTGCCGCTGTCTGCAGGG 0: 1
1: 0
2: 4
3: 25
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900623518 Original CRISPR CAGGCTGCAGGGCAGGCCCG GGG (reversed) Intronic
900145290 1:1156581-1156603 CAGGCTGCAGATCAGGCTCCCGG + Intergenic
900150457 1:1176713-1176735 CAGGCGAGAGGGGAGGCCCGGGG - Intronic
900164656 1:1239866-1239888 CAGGCAGCAGGGTCGGCCTGCGG + Intergenic
900177004 1:1295402-1295424 CAGGTGGCAGGGCAGGGCCAAGG - Intronic
900243892 1:1629081-1629103 CGGGCGCCGGGGCAGGCCCGAGG - Intronic
900243911 1:1629140-1629162 CGCGCTGCCGGGGAGGCCCGAGG - Exonic
900251763 1:1674570-1674592 CAGGCTGCAGTGCAGTGGCGAGG - Intronic
900262171 1:1737426-1737448 CAGGCTGCAGTGCAGTGGCGAGG - Intronic
900485150 1:2919240-2919262 CCTGCAGCTGGGCAGGCCCGTGG + Intergenic
900507745 1:3038208-3038230 CAGGCTGCTGGGCAGGAAGGGGG - Intergenic
900519494 1:3098735-3098757 CAGTCTTCTGGACAGGCCCGGGG + Intronic
900531431 1:3155318-3155340 CAGGCTGCAGGGCTTGGCCGCGG + Intronic
900596917 1:3484106-3484128 CCGGCTCCAGGGCTGGCCCTGGG + Intergenic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
900766473 1:4509351-4509373 CAGCAAGCAGGGCTGGCCCGAGG + Intergenic
900796926 1:4713575-4713597 CAGGCTTCACAGCAGGCCTGCGG + Intronic
900982045 1:6051439-6051461 CAGGCTGGATGGCTGGCCCTGGG - Intronic
901063732 1:6485387-6485409 CAGCCTCCAGGCCGGGCCCGGGG - Intronic
901195586 1:7438198-7438220 CAGGCAGCTGGGCAGGGCCTGGG + Intronic
901455737 1:9361819-9361841 GAGGGTGGCGGGCAGGCCCGGGG - Intronic
901630032 1:10643506-10643528 CAGGCTGGAGAGGAGGCCCAGGG - Intronic
901632163 1:10653291-10653313 CAGGCTGCAGAGCAGAGTCGGGG - Intronic
901884026 1:12210179-12210201 CAGGCTGGAGGACAGGACCATGG - Intergenic
902342587 1:15793837-15793859 CAGGCTGGAGGGCAGTGGCGTGG - Intergenic
902401292 1:16158754-16158776 CAGGCTGGAGTGCAGTGCCGCGG - Intergenic
902611744 1:17601995-17602017 CAGGCTGCTGGGGAGACCTGAGG - Intronic
902943145 1:19814805-19814827 CAGGCTGCAGATGAGGCCCCCGG + Exonic
903445783 1:23422486-23422508 CACGTTGCAGCTCAGGCCCGGGG - Intronic
903945971 1:26962910-26962932 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
904034668 1:27552133-27552155 CAGGCCGCCGGGCGGGGCCGGGG + Exonic
904239378 1:29134267-29134289 AATCCTGCAGGGCAGGCCCCAGG + Intergenic
904244142 1:29174147-29174169 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
904314804 1:29653225-29653247 GGGGCTGCAGGGCAGGCCATGGG + Intergenic
904873360 1:33635504-33635526 CAGGCTACATGCCAGGCCAGGGG - Intronic
905034502 1:34908764-34908786 CAGGCTCCAGGGTGGGCCAGGGG - Intronic
905199614 1:36307007-36307029 CAGACCGCAGGGCGGCCCCGAGG - Intronic
905284347 1:36869616-36869638 CAGGCTGTAGGGGTGGCCCCAGG - Intronic
906010239 1:42516525-42516547 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
906027209 1:42683190-42683212 GGCGCTCCAGGGCAGGCCCGGGG - Intronic
906220879 1:44078475-44078497 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
906698890 1:47843276-47843298 CAGGGTGCAGGGCAGACGCAGGG + Intronic
907844084 1:58187951-58187973 CAGGCTGGAGTGCAGTCCCTTGG + Intronic
908301153 1:62761818-62761840 CAGGCTGCAGGGGAGCCCATGGG - Intergenic
909957920 1:81801686-81801708 CAGGCCGCAGGGTCGGCGCGAGG + Intronic
910243094 1:85109579-85109601 CAGGATGCAGTGCAGGCCCAGGG + Intronic
912314690 1:108657150-108657172 CAGGCTGTAGTGCAGGGCCCTGG - Intronic
912369394 1:109161964-109161986 CAGGCTGGTGCACAGGCCCGGGG - Exonic
912552343 1:110492353-110492375 CTGTTTGCAGGGCAGGCCCGTGG - Intergenic
913163743 1:116167613-116167635 AAGGCTGCAAGGCAGGCCAGAGG - Intergenic
913210130 1:116575532-116575554 CAGACTGCAGGGGAGGCCATGGG - Exonic
913459604 1:119070304-119070326 CAGGCTGGAGTGCAGGGGCGTGG + Intronic
913526456 1:119698048-119698070 CAGGCTACAGGGCAGGAATGAGG - Intronic
914754898 1:150557088-150557110 GAGGCTGCAGGGCTGGCTCGGGG + Intronic
914902182 1:151716694-151716716 CCGGCAGCAGCCCAGGCCCGGGG - Exonic
915311032 1:155005883-155005905 CAGGCGCCAAGGCGGGCCCGGGG + Intronic
915558908 1:156675337-156675359 CCAGCTGCAGGGCAGGCGAGAGG + Exonic
915594420 1:156888072-156888094 CAGGCTGGTGGGCAGGCCAAAGG + Intergenic
917451388 1:175150592-175150614 CAGGCTGCAAGCCAGGCACTAGG + Intergenic
917452084 1:175155759-175155781 CTGGCTTCAGGACAGGCCGGGGG - Intergenic
917929380 1:179813181-179813203 CAGGCTCCAGGTCAGTCCCCGGG + Exonic
918444526 1:184603749-184603771 CAGGCTGGAGGGCAGTGGCGTGG - Intronic
918786336 1:188769065-188769087 CAGGCTGCTGTGCTGGCCAGTGG - Intergenic
919640381 1:200039841-200039863 AAGCCTGCAGGGCGAGCCCGGGG - Intronic
919742916 1:200991374-200991396 CAGGCTGCAGGGCAGACTGCAGG - Intronic
919763039 1:201110370-201110392 CAGGCTGCTGGACAGGCTCATGG + Intronic
919883570 1:201916739-201916761 CAGGCTGCGAGGCAGGTCCTGGG - Intronic
920095466 1:203483681-203483703 CAGGTTCCGGGGCAGGGCCGAGG - Exonic
920127730 1:203706958-203706980 CAGGCTGGAGGGCAGTCCTAGGG - Intronic
920312494 1:205056819-205056841 CCTGCTGCAGGGCAGGGCAGGGG - Intronic
920437712 1:205958776-205958798 GAAGCTGCAGGGCAGACCCAGGG - Intergenic
920501858 1:206490557-206490579 CAGCCTGCAGTGCAGGGCCGGGG - Intronic
921918674 1:220642195-220642217 CAGGCTGCTGTGCTGGCCAGTGG - Intronic
922176570 1:223202263-223202285 CAGGTTGCAGGCCAGCCCTGGGG + Intergenic
922485416 1:225969864-225969886 CAGCCGGCAGGGCTGGCCCTGGG + Intergenic
922977229 1:229795268-229795290 CAGGCTGGAGTGCAGGGCAGTGG - Intergenic
923325337 1:232875483-232875505 CAGGATGCAGGGGAGCCCAGGGG - Intergenic
924162374 1:241246057-241246079 CAGGCTGGAGGGCAGTGGCGTGG - Intronic
1063130356 10:3172646-3172668 GAGGGTCCAGGGCAGGCCGGAGG - Intronic
1063130642 10:3173729-3173751 AAGGCTGCATGGCAGGTCCCAGG + Intergenic
1064145950 10:12826617-12826639 CAGGCTGCAGGGCTGCTCCATGG - Intronic
1065265107 10:23966535-23966557 CAAACTGCAGGGCAGGGCAGGGG - Intronic
1065800173 10:29344718-29344740 CAGGCTGCATGGAGGACCCGGGG + Intergenic
1065840999 10:29700984-29701006 CAGGCGGCAGGGCTGGAGCGTGG - Intronic
1067471626 10:46542168-46542190 AAGGCTGCAGGGCAGGGGCCAGG + Intergenic
1067497606 10:46774139-46774161 CAAGTTGCAGGCCAGGCCTGGGG - Intergenic
1067597045 10:47566275-47566297 CAAGTTGCAGGCCAGGCCTGGGG + Intergenic
1067682346 10:48449041-48449063 CAGGCCTCAGAGCAGGCCAGAGG + Intronic
1067685475 10:48464162-48464184 CAGGGAGCAGGGGAGGCCCCAGG - Intronic
1067801250 10:49360990-49361012 CAGGGTGCAGGACAAGCCCTAGG + Intergenic
1069568444 10:69479395-69479417 CAGGCTGCAGAGGAGCCCTGTGG - Intronic
1069664605 10:70146202-70146224 GGGGCTGCAGGGGACGCCCGCGG + Exonic
1069839282 10:71329041-71329063 CAGGCTGCATGGCAGGGACTTGG - Intronic
1069840585 10:71337083-71337105 CAGGCTGAAGGGGAGGCCAGAGG - Intronic
1070129574 10:73647374-73647396 AAGGCTGCAGGGCAGGGGTGGGG - Exonic
1071292747 10:84199176-84199198 CAGGCCACAGGGCAGCCCCAGGG - Intronic
1071305422 10:84295138-84295160 AAGTCTGCAGGGCAGACCAGTGG + Intergenic
1072578971 10:96723525-96723547 CAGGCTGCAGTGCAGTGCAGTGG - Intergenic
1072617992 10:97062565-97062587 CACCCTGCAGGGCAGGGCCCAGG - Intronic
1072791408 10:98320948-98320970 CAGGCTCCAGGCTAGGCCCTGGG + Intergenic
1073099128 10:100997884-100997906 CCGGCTGCTGGGCAGGGCTGGGG + Intronic
1073124510 10:101141143-101141165 CAGGCTGCAGGGCAACCGGGAGG + Intergenic
1074399095 10:113126942-113126964 GACGCAGCAGGGCAGGCGCGCGG - Intronic
1074498140 10:113997707-113997729 AAGTCAGCAGGGCAGGCACGTGG - Intergenic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1075320145 10:121485002-121485024 CACCCTGCAGGGCGGCCCCGCGG + Intronic
1075777676 10:124998830-124998852 CAGCCTTCAGGTCAGGGCCGAGG + Intronic
1076273678 10:129178386-129178408 CAGGATGCTGGGCAGGACCATGG - Intergenic
1076323050 10:129598015-129598037 CTGACTGCAGAGCAGGCCCAGGG - Intronic
1076759503 10:132594814-132594836 CAGCCTGCAGGGCTGGCAGGGGG - Intronic
1077119849 11:901870-901892 CAGCCGGCAGAGCAGGCCCATGG - Intronic
1077143525 11:1035116-1035138 CGGGCTGCAGGCCTGGGCCGCGG - Intronic
1077177060 11:1195784-1195806 CAGGCTTCAGGGCAGTCTCCAGG - Intronic
1077190575 11:1254471-1254493 CAGGGGGCAGGGAAGGCCTGTGG + Intronic
1077216560 11:1397567-1397589 CAGCCTGCAGCCCAGGCCCCTGG - Intronic
1077221579 11:1420374-1420396 CAGAGTGCAGGGCAGGCCTCAGG - Intronic
1077251015 11:1560727-1560749 CCCGCTGCAGGACAGCCCCGGGG + Intronic
1077392622 11:2307105-2307127 CAGCCTCCAGGGCAGGCAGGAGG + Intronic
1077485106 11:2834968-2834990 CAGGTTGGAGGCCAGGCCTGGGG - Intronic
1077842991 11:5994952-5994974 CTGGCTGCAGGGATGGCCGGGGG - Intergenic
1077868935 11:6245311-6245333 CAGGCTCCAGGGCTGGCCAGAGG - Intergenic
1078934738 11:15941033-15941055 CAGGCTGCTGGGCAGGCAGAGGG - Intergenic
1079429513 11:20375524-20375546 CAGGCTGGAGGGCAGTGGCGTGG - Intronic
1083062782 11:59891887-59891909 CAGGCTGCTGTGCTGGCCAGTGG + Intergenic
1083299301 11:61732009-61732031 TAGGCTGCAGGCCAGGTCTGGGG - Intronic
1083308877 11:61774629-61774651 CAGGCTGAGGGGCAGGCACAGGG - Intronic
1083334897 11:61916824-61916846 CAGGCTGCGGGGCCGGGGCGGGG + Intronic
1083572765 11:63768981-63769003 CAGGCGGCGGTGCGGGCCCGCGG - Intergenic
1083578957 11:63813197-63813219 CAGTCTGCGGGCCAAGCCCGGGG - Intergenic
1083770465 11:64864205-64864227 CAGGCTGGAGGCCAGGACCCCGG - Intronic
1083881114 11:65548711-65548733 CAGGCTGCATGGCAGGAGTGAGG - Intronic
1083961185 11:66015877-66015899 CAGGGTGCAGTTCAGGCCGGAGG - Intergenic
1084114317 11:67033038-67033060 CAGACAGCAGGGCAGGCTAGAGG + Intronic
1084442143 11:69180642-69180664 AAGGCTGGAGGGAAGGCCGGGGG + Intergenic
1084681763 11:70670493-70670515 CTGGCTGCAGGGCAGCACAGAGG + Intronic
1084717432 11:70882898-70882920 CAAACTGCAGGGCAGGCAGGAGG + Intronic
1084961818 11:72720905-72720927 CAGACAGCAGGGCTGGCCTGTGG - Intronic
1085259396 11:75195694-75195716 CAGGCTGCAGAGGAGGCCAAAGG - Intronic
1085304310 11:75476579-75476601 AAGGCCACAGGGCAGGCCCCTGG - Intronic
1088272814 11:108052357-108052379 CAGGCTGGAGGGCAGTGGCGTGG + Intronic
1088691748 11:112334392-112334414 AAGGCTGCAGGGCAGGATCTTGG - Intergenic
1089879704 11:121762069-121762091 CAGGCTGCAGGGGAGCTCTGTGG + Intergenic
1090239970 11:125174982-125175004 CAGGCTTCAGGGAAGGCTGGAGG - Intronic
1090868969 11:130726236-130726258 CTGGCTGCAGGGCAGGATGGGGG - Intergenic
1090920678 11:131203648-131203670 CAAGCTGCAGGGCAGCTCCACGG + Intergenic
1091048717 11:132348904-132348926 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
1091565355 12:1644158-1644180 CAGGCTGCAGCTCAGACCCAGGG + Intronic
1091866214 12:3839270-3839292 CCTGCTGCAGGCCAGGCGCGAGG - Intronic
1092126840 12:6080532-6080554 TAGGCTGCAGGGCAGGAGGGAGG + Intronic
1092717289 12:11403946-11403968 CAGGCTGCAGAGCAGTGGCGCGG + Intronic
1092731640 12:11540352-11540374 AAGGCTGCAGGGTTGGCCCCGGG - Intergenic
1094100880 12:26761059-26761081 CAGGCTTCAGGCCAGGCCCATGG + Intronic
1094199172 12:27779949-27779971 CAGCCGGCAGGTCAGGCCGGCGG + Intergenic
1094273802 12:28646031-28646053 CAGGCTGCTGTGCTGGCCCGCGG + Intergenic
1096117088 12:49060894-49060916 CCGGCAGCAGGGCAGACACGTGG + Intergenic
1096149720 12:49301270-49301292 CAGGTGGCAGAGCAGGCCAGGGG - Intergenic
1096213769 12:49787140-49787162 CAGGCTGCAGTGCAGTGGCGTGG + Intergenic
1096572927 12:52534021-52534043 CAGGCTGCAGGCCAGGAGCTGGG + Intergenic
1096898479 12:54849906-54849928 CAGGGTGTAGGGGAGCCCCGTGG - Intronic
1097180998 12:57171901-57171923 CAGGCTGGAGGGCAGGGCCAGGG - Intronic
1097250277 12:57628678-57628700 CAGGCTGAACGGCAGGCCAGAGG - Intronic
1102260258 12:111439010-111439032 CAGGCTGCAGTGCAGTGCAGTGG + Intronic
1102464657 12:113121433-113121455 CAGGCAGCAGGGGAGACCCAGGG + Intronic
1102512048 12:113422423-113422445 CAGGCTGGAGGGCAGGAGCTGGG + Exonic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1103331857 12:120159787-120159809 CTGGCTGCAGGGATGGCCCAGGG - Intronic
1103809434 12:123601941-123601963 CAGGCGGCGGGGCAGGCCTGGGG - Intergenic
1104350837 12:128042615-128042637 CAGGATGCAGGGGGGGCTCGTGG - Intergenic
1104647724 12:130509049-130509071 CAGGCTGGTGGGGAGGGCCGGGG - Intronic
1104648509 12:130514141-130514163 CAGGCTGCAGGACAGATCTGGGG + Intronic
1104945772 12:132414330-132414352 CGGGCTGCAGGGAGGGCCCTTGG - Intergenic
1104965827 12:132508444-132508466 CGCGCTGCCAGGCAGGCCCGGGG - Intronic
1105540141 13:21309206-21309228 CAGGCTGAAGTGCAGCCCCTCGG - Intergenic
1105743025 13:23348630-23348652 CAGACTGCAGGGCAGGGGTGAGG + Intronic
1106120148 13:26853151-26853173 ATGGTGGCAGGGCAGGCCCGAGG + Intergenic
1106234791 13:27852689-27852711 CAGGCTCCAGCGCAGACCTGTGG - Intergenic
1106305514 13:28505674-28505696 CAGGCTGCAGTGCCTGCCCTTGG - Intergenic
1106760014 13:32858991-32859013 AAGGGTGCAGGCCAGGCCTGGGG + Intergenic
1108510076 13:51148211-51148233 CAGGCTGCTGGCAAGGCCTGGGG - Intergenic
1110450260 13:75632903-75632925 CAGGCTGGAGTGCAGTGCCGTGG + Intronic
1112771390 13:102798802-102798824 CGGCGTGCAGGGCAGGCGCGCGG + Exonic
1113478201 13:110600395-110600417 CAGTCTGCAGGGCAGGGGCCAGG + Intergenic
1113531530 13:111031033-111031055 CAGTCTGCAGGGGAAGCCCAGGG - Intergenic
1113616110 13:111681665-111681687 CAGGCTGCAGGGCAGCGTCAGGG - Intergenic
1113621578 13:111766558-111766580 CAGGCTGCAGGGCAGCGTCAGGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1114815592 14:25954366-25954388 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1116312354 14:43342563-43342585 CAGGCTGCTGTGCTGGCCAGCGG + Intergenic
1116436215 14:44897623-44897645 TAGGCTGGAGGGCCGGGCCGCGG - Intronic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1118821518 14:69349195-69349217 CCCACTGCAGGGCAGGGCCGAGG - Intronic
1118864698 14:69693767-69693789 AAGGCTGCAGAGCAGGCCCCTGG + Intronic
1119385689 14:74257130-74257152 CATCCTGCAGCACAGGCCCGCGG + Intronic
1119480272 14:74954392-74954414 CCTGCTGCAGGGCTGGCCAGAGG - Intronic
1119700864 14:76753583-76753605 CAGGCTGCAGTGCAGGCTGGGGG - Intergenic
1119777894 14:77259591-77259613 AAGCCAGCAGGGCAGCCCCGAGG + Intergenic
1120039810 14:79739602-79739624 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1120289300 14:82546372-82546394 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
1121127808 14:91418670-91418692 CTGGCTGGAAGGCAAGCCCGGGG + Intergenic
1122128070 14:99589923-99589945 CAGGCAGGAGGGCAGACCCCGGG + Intronic
1122142129 14:99668736-99668758 CAGGAGGAAGGGCAGGCACGGGG - Intronic
1122599511 14:102914385-102914407 GAGGCTGGAGGCCAGGCCTGGGG + Intergenic
1122599835 14:102915704-102915726 CAGGCTGCAGCCCTGGCCTGGGG - Intergenic
1122613209 14:102999804-102999826 CAGGCTCCAGGTCTGGCTCGTGG + Intronic
1122642596 14:103169035-103169057 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1122786817 14:104167797-104167819 CTGGCTGCAGAGCAGGCCGAGGG - Intronic
1122940951 14:104981161-104981183 CAGGCTGAGGGGCAGGACCAGGG - Intergenic
1122986273 14:105213069-105213091 CAGGCTGGAGGCCTGGCCTGAGG - Intronic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1202892082 14_KI270722v1_random:168249-168271 CAGCCAGCAGGACAGGCCAGGGG - Intergenic
1123699579 15:22904219-22904241 TATACTGCAGGGCAGGGCCGGGG - Intronic
1124241435 15:28031437-28031459 GAGGCTGCAGGCCTGGCCCAAGG + Intronic
1124375563 15:29126888-29126910 CTGGCTGCACTCCAGGCCCGGGG - Intronic
1124378398 15:29143431-29143453 CAGGCTGCAGGGCTGCCTTGGGG + Intronic
1124426958 15:29570667-29570689 CAGGCTGCGGGGCAGCGCGGCGG + Exonic
1125301531 15:38259294-38259316 CAGGCTGGAGGGCAGTACAGTGG + Intronic
1125568066 15:40693079-40693101 CAGGCTGGAGTGCAGGGACGTGG - Intergenic
1125582326 15:40795202-40795224 CAGGCTGGAGTGCAGGGGCGTGG - Intronic
1125815659 15:42581647-42581669 GAGGCTGCTGGCGAGGCCCGAGG - Intronic
1126018648 15:44377413-44377435 CAGGCTGGAGTGCAGTGCCGCGG + Intronic
1126109343 15:45166735-45166757 CAGGCCTCTGGGCGGGCCCGGGG - Intergenic
1127844076 15:62854427-62854449 CAGGCTTCAGGGCAGACTCCTGG - Intergenic
1127880878 15:63157591-63157613 CAGGGCGCAGGGAAGACCCGGGG + Exonic
1127973070 15:63977376-63977398 CAGTCTGCAGAGCAGACCCAGGG - Intronic
1128017204 15:64357619-64357641 CATGCTGCAGGGCAGTGGCGCGG - Intronic
1128730093 15:70015087-70015109 CAGGTTGCAGGCTGGGCCCGTGG + Intergenic
1128736408 15:70056321-70056343 CAGGCTTGAGGGGAGGCCTGTGG + Exonic
1128973745 15:72132698-72132720 CAGGCTGGAGGGCAGTGGCGAGG + Intronic
1129446983 15:75625574-75625596 CAGAGTGCAGGGCCGGCCAGAGG + Exonic
1129460905 15:75699698-75699720 CAGGCGGGAGGGCTGGGCCGGGG + Intronic
1129849053 15:78781357-78781379 CAGGCAGCAGGGCCCTCCCGAGG - Intronic
1129952054 15:79600644-79600666 CAGTCTGAAGGGCAGGCGTGGGG - Intergenic
1130276704 15:82481838-82481860 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
1130330581 15:82919044-82919066 CAGGGTGCAGAGCAGGGCCTGGG + Intronic
1130531209 15:84748766-84748788 CAGGCTGCAGGGCCGGGCCCCGG - Intronic
1130957710 15:88639136-88639158 CAGGCTGCGGGGCAGGCCAGAGG + Intronic
1131153027 15:90058800-90058822 AAATCTGCAGGGCAGACCCGGGG + Intronic
1131392005 15:92057261-92057283 CAGGCTGCAGGGCTGCCCTAGGG - Intronic
1131872578 15:96777274-96777296 GAGCCTGCAGGGCAGGGCTGTGG + Intergenic
1132381417 15:101369175-101369197 CAGGCTGCTGGGCAGTGCTGTGG + Intronic
1132381724 15:101370858-101370880 CAGGCTGCTGGGCAGTGCTGTGG + Intronic
1132498551 16:274963-274985 CAGGTTCCAGGTCAGGCTCGGGG - Exonic
1132597641 16:760629-760651 CAGGCAGCGGGCCAGGCCTGGGG - Intronic
1132631391 16:919347-919369 CAGGGGGCAGGGCAGCCCTGTGG + Intronic
1132646857 16:1003210-1003232 CCAGCTGCAGGGAAGGCCCCCGG - Intergenic
1132671398 16:1103514-1103536 GAGGCTGCAGGTCAGGGGCGGGG + Intergenic
1132676456 16:1123198-1123220 CAGGCTGTGGGGCAGGCTCAGGG + Intergenic
1132748754 16:1447711-1447733 CAGGCTGCAAGACAGGCCCGCGG + Exonic
1132779407 16:1614437-1614459 CGGGCTGGTGGGCAGGGCCGGGG + Intronic
1132797507 16:1732510-1732532 CAGGCTCCACGGCACGCCCCTGG - Intronic
1132897069 16:2234112-2234134 CAGGCGGCCTGGCGGGCCCGCGG + Intronic
1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG + Intronic
1132975034 16:2706831-2706853 CAGGCTGAGGTGCAGGGCCGAGG + Intronic
1133162339 16:3920421-3920443 CTGGCTGCAGGGAAGTCCAGGGG + Intergenic
1133623148 16:7545479-7545501 AAGGCTGCAGGGAAGGTCGGGGG - Intronic
1134021025 16:10921831-10921853 CAGCCTGGAGGTCAGCCCCGTGG - Intronic
1134084936 16:11349763-11349785 CAGGCAGCAGGGCTGGCACCGGG + Intronic
1136247223 16:28983053-28983075 GAGGTCGCAGGGCAGGCCGGGGG - Intronic
1136273773 16:29165891-29165913 CAGGCGGCAGGGAGGGCCTGGGG + Intergenic
1136374107 16:29854920-29854942 AGGGCTGCAGGGCAGGCACAGGG + Intergenic
1136399730 16:30010873-30010895 CAGGGGGCTGGGCAGGCCGGGGG - Intronic
1137636701 16:49993045-49993067 CAGGCCGCAGGGGAGGCCGGAGG + Intergenic
1137773443 16:51036693-51036715 CAGGTGGCAGGGCAGGACCCAGG + Intergenic
1138201402 16:55091391-55091413 GAGGCTGCAGGGCAGAGCCAGGG + Intergenic
1138415515 16:56869370-56869392 CAGGCTGGAGTGCAGTCGCGTGG + Intronic
1138586783 16:57975867-57975889 CAGGATGGTGGGCAGGCCCCAGG + Intergenic
1138591153 16:58000411-58000433 CCGCCTGCAGGGCAGGCGCGGGG + Intronic
1138651681 16:58464471-58464493 CCGGCTGCGGGGCAGGCGGGCGG - Intronic
1139447981 16:67009996-67010018 CGGGCTGCAGGAGAGGCCAGAGG - Intergenic
1139545758 16:67648802-67648824 GAGGCGGAAGGGCAGGGCCGTGG + Intronic
1139955111 16:70689482-70689504 CAGCCTGCTGGGCAGGACCAGGG + Intronic
1140818044 16:78638644-78638666 CAGGCTGGAGGGAAGGGCGGGGG + Intronic
1140866748 16:79068764-79068786 CAGGCTGCAGGGCAGTGGTGAGG - Intronic
1141143562 16:81513632-81513654 CTGGCTGCTGTGCAGACCCGTGG + Intronic
1141461097 16:84179327-84179349 GAGGCAGCAGGGCAGGACCTCGG - Exonic
1141624289 16:85253262-85253284 CAGACTCCAGGGCAGGACTGGGG - Intergenic
1141681176 16:85544861-85544883 CAGGCAGCAGAACAGGACCGCGG + Intergenic
1141702108 16:85647240-85647262 GAGGGTGCAGGGCAGGCAGGAGG - Intronic
1141897824 16:86969933-86969955 CAGGCTGGAGGCCAGGCTCAGGG - Intergenic
1141980128 16:87545037-87545059 CATGCTGCAGGGCAGGGTCCCGG + Intergenic
1142005773 16:87689022-87689044 CTGGCTGCAGAGCTGGCCCCTGG + Intronic
1142120118 16:88383017-88383039 CTGGCTGCAGGGCTGGCCCGCGG + Intergenic
1142151481 16:88514447-88514469 CGGGCCCCAGGACAGGCCCGTGG - Exonic
1142175515 16:88643325-88643347 CTGGCGGGAGGGCAGGTCCGGGG + Exonic
1142198169 16:88748375-88748397 CAGGCTGCAGGCTTGGCACGTGG + Intronic
1142395200 16:89828202-89828224 CGGGGTGCTGGGCAGGACCGGGG - Intronic
1142812245 17:2400776-2400798 CAGGCTGGCGGGCAGGCAGGAGG + Exonic
1143020711 17:3916027-3916049 GAGTCTGGAGGACAGGCCCGGGG + Intronic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1143657489 17:8304299-8304321 CAGGCTGGAGTGCAGGGGCGTGG + Intergenic
1144769961 17:17754108-17754130 CAGGCTGCACAGCTGGCCAGTGG - Intronic
1144968074 17:19090188-19090210 CATGCTGCAGGGCCCACCCGGGG + Intergenic
1144979843 17:19161875-19161897 CATGCTGCAGGGCCCACCCGGGG - Intergenic
1144988379 17:19216357-19216379 CATGCTGCAGGGCCCACCCGGGG + Intronic
1146013862 17:29217105-29217127 CGGGGTGCAGGGCAGGGCCCTGG + Intergenic
1146016924 17:29241299-29241321 AAGGCAGCAGGGCAGGCACTGGG - Intergenic
1146330399 17:31922235-31922257 CAGGCTGCAGTGCAGTGGCGTGG + Intergenic
1146579563 17:34024706-34024728 AGGGGTGCAGGGCAGGCCTGAGG + Intronic
1147791827 17:43018520-43018542 CAGGCTGCAGGGAAGGGGCCTGG + Intronic
1147819702 17:43234414-43234436 GAGGCTCCAGGGCAGGAGCGCGG + Intergenic
1147951305 17:44109461-44109483 CAGCCTACAGGGCTGGCCCCAGG + Intronic
1148087472 17:45003011-45003033 CAGGCTGGAGGGCAGTGGCGTGG - Intergenic
1148236201 17:45970832-45970854 AAGACTCCAGGGCAGGCCCATGG - Intronic
1150003481 17:61456019-61456041 CAGGCTGGAGGGCAGGGCCCAGG - Intronic
1150082019 17:62248942-62248964 CAGGCTGCAGTGCAGTGGCGTGG + Intergenic
1150388611 17:64778649-64778671 CAGGCTGCTGCGCTGGCTCGCGG + Intergenic
1150765398 17:67997953-67997975 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1150976007 17:70087975-70087997 CAGGCTGCAGTGCAGTGGCGTGG - Intronic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151351482 17:73534589-73534611 AAGGCAGCAGGGAAGGCCGGTGG + Intronic
1151386678 17:73759342-73759364 CAGGCTGAAGGGCAGGAGAGTGG - Intergenic
1151399889 17:73849116-73849138 CAGGCTGCAGGACATGCTCAGGG - Intergenic
1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG + Intronic
1152032440 17:77852826-77852848 GAGGCGGCAGGGCAGAGCCGCGG + Intergenic
1152148818 17:78586220-78586242 CAGACTCCAGGGCAGCCACGTGG - Intergenic
1152228912 17:79105078-79105100 CAGGCTTCAGGACAGGCCCTGGG - Intronic
1152261544 17:79269926-79269948 GATGCTGCAGGGCAGGCACAGGG - Intronic
1152355972 17:79807490-79807512 CAGGGGGCAGGGCAGGGCAGAGG + Intergenic
1152457969 17:80426943-80426965 CAGGCTGCAGGGCAAGCGGTGGG - Intronic
1152476228 17:80520200-80520222 GAGGCTGCAGCGCAGGCTTGGGG + Intergenic
1152545553 17:80998518-80998540 CAGGCAGCAGGGCTTGCCCACGG - Intronic
1152546094 17:81000744-81000766 CAGGCTGCCTGGCAGTCCTGGGG - Intronic
1152566554 17:81102989-81103011 CAGGCCGCAGAGTACGCCCGAGG + Intronic
1152654615 17:81513979-81514001 CAGGCTGGGGGGCGGGGCCGGGG + Intronic
1152762055 17:82113966-82113988 CAAGCTGCAGGGCAGGCAAGGGG - Intronic
1152818189 17:82421237-82421259 GAGGGTGCAGGGGAGGCCCAAGG + Intronic
1152836839 17:82538753-82538775 CTGGCCCCAGGGCAGGCCTGGGG + Intronic
1153979129 18:10294405-10294427 CAGACTTCAGGGTAGGCCCCTGG - Intergenic
1154048184 18:10927390-10927412 CAGGTTGCAGCGCAGGCCGTGGG + Intronic
1154212864 18:12395013-12395035 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1155300732 18:24426729-24426751 GCGGCTGCAGGGCAGGTCCAGGG + Exonic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1155871723 18:31037851-31037873 CAGGCTGGAGTGCAGGCTGGAGG - Intronic
1156459672 18:37314706-37314728 CAAGCTGCAGGGGAGGCTGGAGG - Intronic
1156830487 18:41485405-41485427 CAGGCTGGAGTGCAGTGCCGCGG + Intergenic
1156970450 18:43147860-43147882 CAGGCTGGAGTGCAGGGCAGTGG - Intergenic
1156972419 18:43172481-43172503 CAGGCTGGAGGGCAGTGGCGTGG + Intergenic
1157239083 18:45992760-45992782 CAGGCTGCAGTGCAGTGCAGTGG + Intronic
1157474414 18:48012159-48012181 CAGGCAGGAGGGGAGGCCAGGGG + Intergenic
1157591495 18:48838901-48838923 GGGGCTGGTGGGCAGGCCCGGGG - Intronic
1157591985 18:48841664-48841686 CAGGCTGGTGGGCAGGCAGGCGG + Intronic
1157744260 18:50120961-50120983 CGGGCTGGAGGGCAGGCTGGAGG - Intronic
1157761667 18:50269799-50269821 AAGTCTGCAGGGCAGGCACTCGG - Exonic
1158283287 18:55851073-55851095 CAGGCTGCTGGGCTGGGCCCTGG - Intergenic
1159725605 18:71953805-71953827 CAGGCTGCAGTGCAGCGCAGTGG + Intergenic
1160038563 18:75322596-75322618 GTGGGTGCAGGGCAGGCCCCAGG - Intergenic
1160135033 18:76264550-76264572 CAGGGTGGAGGGCAGGGCAGAGG + Intergenic
1160342342 18:78100459-78100481 CATTCTGCAGGGCTGGCCCGAGG - Intergenic
1160462296 18:79048335-79048357 TAGGCTGCAGAGAAGGCCAGGGG + Intergenic
1160590903 18:79944185-79944207 GAGGCTGCAGGGAGGGCCTGGGG - Intronic
1160731807 19:644624-644646 CTGGGTGCAGGGCAGGCCTGGGG + Intergenic
1160822535 19:1065205-1065227 CAGGCTGGGGGCCAGGCCCGTGG + Intronic
1160861735 19:1240112-1240134 CAGGGAGCAGGGGAGGCCCTGGG - Intergenic
1160930209 19:1566836-1566858 CAGCCTGCTGGGCAGGCCGGCGG - Intronic
1160991074 19:1860572-1860594 GTGGCTGCAGGGCTGTCCCGGGG - Intronic
1161035139 19:2080205-2080227 CAGGGTGCTGGGCAGGGCGGGGG + Intronic
1161421012 19:4175871-4175893 CACGGTGCAGAGCCGGCCCGTGG + Exonic
1161700101 19:5789760-5789782 CTGGCTGCTGGGCTGCCCCGGGG - Intronic
1162412309 19:10513956-10513978 CAGGCAGCGGCGCAGGCCCCCGG + Exonic
1162490222 19:10987143-10987165 CTGGCTACAGGGGAGACCCGGGG - Intronic
1162926610 19:13933377-13933399 CAGGGTCCGGGGCAGGCCGGCGG + Exonic
1163105594 19:15121369-15121391 CAGGTTCCAGGACAGGCACGGGG - Intronic
1163292776 19:16391530-16391552 TAGGCTGCAACCCAGGCCCGGGG - Intronic
1163706294 19:18815546-18815568 CAGGCTGGAGTGCAGGCTGGTGG - Intergenic
1163715079 19:18868702-18868724 CACGCAGCAGGGCAGGTCGGCGG + Exonic
1164462281 19:28459200-28459222 AAGGATCCAGGGCAGGCCCATGG + Intergenic
1164822021 19:31257727-31257749 CAGGCAGGAGGTCAGGCCCAGGG - Intergenic
1164833881 19:31344586-31344608 CAGGCAGGCAGGCAGGCCCGCGG - Intronic
1165421573 19:35724674-35724696 CAGGCTGCAGGGTAGGTTTGCGG - Exonic
1165461020 19:35944529-35944551 CATCCTGCAGGGCAGGCAGGTGG - Exonic
1165528685 19:36378677-36378699 CCGGCTCCAGGAAAGGCCCGCGG - Intronic
1165569931 19:36767190-36767212 CAGGCTGCAGTGCAGTGCCACGG - Intronic
1166130035 19:40740535-40740557 CAGGCTGCAGGCCAGGGTCCTGG - Exonic
1166210776 19:41305474-41305496 CAGGATGAAGGGCAAGCCCCAGG - Intronic
1166318822 19:42003792-42003814 GAGGCTGCAGGGAAGACCCTGGG - Intronic
1166356834 19:42232374-42232396 CAGGGTACAAGGCAGGCCTGGGG - Intronic
1166500495 19:43337607-43337629 AAGTCTGCAGGGCAGGCCCTGGG + Intergenic
1166509629 19:43396092-43396114 AAGTCTGCAGGGCAGGCCCTGGG - Intergenic
1166859294 19:45800517-45800539 GAGGCTGCAGGACAGGCGGGTGG + Exonic
1166859316 19:45800610-45800632 CAGGGTGCAGTGCAGGGCCTGGG - Intronic
1167341848 19:48921135-48921157 CTGTCTGCAGGGCAGGCACAGGG - Exonic
1167348733 19:48962456-48962478 GAGGCTGGAGGGCAGGGCAGAGG + Intergenic
1167430410 19:49451072-49451094 CAGGCTGGAGTGCAGTGCCGAGG + Intronic
1167499724 19:49838363-49838385 CAGGCAGAAGGGCGGGCCCAGGG - Intronic
1167795236 19:51704382-51704404 CGAGCTGCTGGCCAGGCCCGAGG + Intergenic
1168182349 19:54670958-54670980 AAGGCTTCAGGGCAGGACCATGG + Intronic
925386736 2:3467181-3467203 CAGGCTGCAAGGGAAGCCCTCGG + Intronic
925812495 2:7714071-7714093 AAGGCTGCTGGGCAGGACAGAGG - Intergenic
926163029 2:10501606-10501628 CGGGGTGGAGGGCAGGCCTGGGG - Intergenic
926277810 2:11418203-11418225 CAGGCTGCGGGTCAAGCCTGTGG - Intergenic
927143819 2:20147427-20147449 CAGTCTGCAGGGCTGTCCAGGGG - Intergenic
927387006 2:22546239-22546261 CAGGCTCCAATGCAGGCCCAAGG + Intergenic
927683432 2:25154959-25154981 CAGGATGCAGGGCTGGCAGGAGG + Exonic
927940505 2:27100309-27100331 CAGGCTGGTGGGCAGGGCAGAGG - Exonic
928100823 2:28436597-28436619 CAGGCTGCAGGGGAGAGCCCTGG - Intergenic
928225440 2:29444299-29444321 CAAGATGCAGGGCAGGCAGGTGG + Intronic
929441452 2:41968405-41968427 CAGGTTGCAGGGCAGGACTCAGG - Intergenic
929468705 2:42169703-42169725 CAGGCGGGAGGGCAGGGCCTGGG - Intronic
929568822 2:43006946-43006968 CAGGCAGAAGGACAGGCCCAGGG + Intergenic
932422660 2:71610821-71610843 CAGGCTGGCGGGCAGGCACATGG + Intronic
932433767 2:71691070-71691092 CAGGCACCAGGGCAGGACAGGGG - Intergenic
932810642 2:74822860-74822882 CAGGCTCCAGGCCAGGCTCCAGG - Intergenic
932967017 2:76488487-76488509 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
933719354 2:85387620-85387642 CAGGCTGGAGTGCAGGGCAGTGG - Intronic
934559733 2:95306953-95306975 CAGGCTGCTGGGGAGGCGGGAGG - Intronic
934716509 2:96547635-96547657 CTGGCTGCTGGGCAGGGCCAGGG - Intronic
934855015 2:97724308-97724330 CAGGTTGCAGGGCAGCCCGTCGG - Exonic
935225246 2:101047155-101047177 CAGGGCGCAGGGGAGGCCCTGGG - Intronic
935498283 2:103807826-103807848 CAATCTGCAGGGCAGGCTGGTGG + Intergenic
935675977 2:105595311-105595333 GAGGATGGAGGGCAGGCCAGTGG - Intergenic
936073063 2:109384189-109384211 CCGGCTGCGGGCCAGGCCCCGGG + Intronic
936260939 2:110959236-110959258 CATGGTGCAGGGCAGGGCTGTGG - Intronic
937258354 2:120570155-120570177 CAGGCTGCTGAGAAGGCCCTGGG + Intergenic
937294827 2:120803769-120803791 CAGGGTCCAGGGCAGCCCCTGGG + Intronic
937894633 2:126969450-126969472 CAGGATGCAGGTCATGCCCTTGG + Intergenic
937899401 2:127006358-127006380 CAGGCTGGAGGGCAGTGGCGCGG + Intergenic
938085275 2:128395838-128395860 CAGGCTGCTGGACAGGCCTTGGG + Intergenic
942110245 2:172674806-172674828 CAGGCTGCCGGGCCGGGCCCTGG + Intergenic
942463854 2:176188539-176188561 TTGGCTGCGGGGCAGGCGCGAGG + Intergenic
943293127 2:186101392-186101414 CAGGCTGGAGGGCAGTGCAGTGG - Intergenic
943383008 2:187173670-187173692 CAGGCTGCTGGGCTGGACCCTGG + Intergenic
944228664 2:197372117-197372139 CAGGCTGCAGGGCAATGCCTGGG + Intergenic
944415066 2:199471662-199471684 CTGGCAGCAGGGCCGCCCCGAGG - Intergenic
946145219 2:217725515-217725537 CAGGCAGCAGGGCAGGCTGATGG - Intronic
946410968 2:219514974-219514996 CAGGCGGCTGGCCTGGCCCGGGG + Exonic
946966573 2:225042757-225042779 CAGGCTGCGGGGGAGGGCGGGGG + Intergenic
946989095 2:225307957-225307979 CAGGCTGGAGTGCAGGGCGGTGG - Intergenic
947766434 2:232640867-232640889 GAGGCAGCAGGGAAGGCCCTTGG + Intronic
948212749 2:236207158-236207180 CAGGATGCAGAGCAGGACCCAGG + Intronic
948528161 2:238586257-238586279 CAGGCGGCAGGGCCAGCGCGGGG + Intergenic
948825932 2:240573462-240573484 CAGTTTGCAGGGCAGGCACTGGG - Intronic
948903029 2:240965669-240965691 GAGGCCGCAGGGGAGGCCCATGG + Intronic
949028086 2:241775590-241775612 GAGGATGCAGGGCACGCCGGTGG + Intergenic
949051751 2:241901301-241901323 CCGGCAGCAGGGCCGGCCCAGGG + Intronic
1168771738 20:420485-420507 CAGGTAGCAGGGCAGGGCCCGGG - Intronic
1168799594 20:635591-635613 CAGGCAGGAGGGCAGGCCTGGGG - Intergenic
1170573516 20:17646222-17646244 CAGGCTCTTGGGCAGGCCTGTGG - Intronic
1170830861 20:19839319-19839341 CAGGTTCCAGGGCATGCCCAAGG - Intergenic
1171344136 20:24452836-24452858 CAGGGAGCAGGGCAGGACCTAGG - Intergenic
1171349336 20:24490803-24490825 CAGGCTCCAGGGCAGCACAGAGG + Intronic
1171413241 20:24960387-24960409 CAGGCAGCAGGGCAAGTCCCTGG - Intergenic
1171413988 20:24965267-24965289 GAGGCGGCAGGGCAGGGCCCAGG - Intronic
1172160952 20:32867650-32867672 CAGGCTGGAGGTCAGGCACCTGG - Exonic
1172810503 20:37644264-37644286 CAGACTGCAGGGCAGGAGGGAGG - Intergenic
1172841760 20:37906172-37906194 CAAGCTCCAGGGCAGGCAGGTGG - Intronic
1172890490 20:38260612-38260634 CAGGGGATAGGGCAGGCCCGGGG + Exonic
1173546756 20:43903719-43903741 CAGGCTGCAGCCAAGGCCTGGGG + Intergenic
1173665790 20:44762230-44762252 CAGGCTGCAGAGCAGGTGAGCGG - Intronic
1173793295 20:45841680-45841702 AAGGCTGCAGGTCTGGCCCAGGG + Exonic
1173952909 20:47007396-47007418 CAGGCAGAGGGGCAGGCCCTGGG + Intronic
1174287813 20:49484376-49484398 CAGCCTGCCGGGGAGGCCGGGGG + Intergenic
1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG + Exonic
1174354134 20:49987225-49987247 CAGGCTGCTGGCCGGGCCCCAGG + Intronic
1175215281 20:57389293-57389315 CAGGCGGCAGGGCAGCCCCGGGG - Intergenic
1175399555 20:58692787-58692809 CGGGCTGCCGGGCAGGGCCGGGG + Exonic
1175605425 20:60308616-60308638 CTGGCAGCAGGGCAGGACCCTGG - Intergenic
1175889642 20:62310515-62310537 GAGGCTGCACGGGAGGCCCCTGG - Exonic
1175895154 20:62332802-62332824 TCGGCTGAAGGGCAGGCCCTGGG - Intronic
1175963175 20:62647315-62647337 CTGGGTGCAGGGCAGGCATGTGG + Intronic
1175978094 20:62723645-62723667 AAGGGTGCAGGGCAGGGCAGTGG - Intronic
1175994510 20:62806027-62806049 CAGGCAGCTGGGGAGGCCTGAGG - Intronic
1176082831 20:63282506-63282528 CAGACTTCAGGACAGGGCCGGGG - Intronic
1176137285 20:63529807-63529829 GAGGCTGCGGGGAAGGCCCCAGG - Intronic
1176382005 21:6118348-6118370 GCGGCTGCCTGGCAGGCCCGGGG - Exonic
1176388498 21:6151511-6151533 CTGGCTGCTGGGCGGGCCCCAGG - Intergenic
1179531177 21:42020622-42020644 CAGCATCCAGGGCAGGCCTGTGG + Intergenic
1179546967 21:42119002-42119024 CCAGCAGCAGGGCTGGCCCGTGG - Intronic
1179734974 21:43386737-43386759 CTGGCTGCTGGGCGGGCCCCAGG + Intergenic
1179741467 21:43419891-43419913 GCGGCTGCCTGGCAGGCCCGGGG + Exonic
1179787195 21:43736675-43736697 CAGGCTGGAGTGCAGTCCTGCGG + Intronic
1179797557 21:43794232-43794254 GAGGCTCCAGGGCAGGCCAGGGG + Intronic
1179876617 21:44272123-44272145 CCTGCTCCAGGGCAGGCCCTGGG + Intergenic
1180091543 21:45536082-45536104 CTGGCTGCAGGAGAGGCCCGGGG - Intronic
1180117829 21:45723731-45723753 CAGGTTGGATGCCAGGCCCGGGG + Intronic
1180159125 21:45991247-45991269 CGGGCTGCAGGGAAGGCTCTGGG - Intronic
1180339656 22:11607508-11607530 CAGGCTGGAGGGCAGTGGCGTGG - Intergenic
1180766968 22:18351082-18351104 CAGGCGGCAGGGTGTGCCCGTGG + Intergenic
1180779345 22:18511297-18511319 CAGGCGGCAGGGTGTGCCCGTGG - Intergenic
1180812062 22:18768617-18768639 CAGGCGGCAGGGTGTGCCCGTGG - Intergenic
1180854995 22:19040101-19040123 CAGGCTGCAGAGCAGGGTGGGGG - Intronic
1180868879 22:19134940-19134962 CAGAGTCCAGGGCAGGTCCGCGG - Intronic
1180967581 22:19798614-19798636 CAGGCTGCTGGGCAGGAGCTGGG - Intronic
1180979998 22:19873910-19873932 CTGGCTGCAGACCAGGCCCAGGG - Intergenic
1181000387 22:19985341-19985363 CAGGCTGCTGCCCAGGCCTGGGG + Intronic
1181081255 22:20417310-20417332 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1181198217 22:21202861-21202883 CAGGCGGCAGGGTGTGCCCGTGG - Intergenic
1181510773 22:23387905-23387927 CGGGCTGCAGCGCAGGGCAGGGG - Intergenic
1181559661 22:23692742-23692764 CTGGCTCCAGAGCAGGCCCCAGG - Exonic
1181703488 22:24634040-24634062 CAGGCGGCAGGGTGTGCCCGTGG + Intergenic
1182913105 22:34004128-34004150 CAGCCTGCAGGGCACGCCCGAGG + Intergenic
1183190099 22:36316666-36316688 CAGCCTGCGGGGCACACCCGGGG + Exonic
1183349251 22:37325429-37325451 CAGTGTGCCGGGCAGGCCAGGGG - Intergenic
1183394153 22:37561781-37561803 CAGGCCGCAGTGCTGGCCAGGGG - Intronic
1183451006 22:37895074-37895096 CAGTCTGCAGGGCAGGCTGGGGG - Intergenic
1183546309 22:38456098-38456120 CAGGATCCAGGGCAGGAGCGGGG - Intergenic
1183951272 22:41354448-41354470 CCTGCTCCAGGGCAGGCCCTGGG + Intronic
1184190714 22:42892618-42892640 CAGGCTGTGGAGCAGGCACGTGG - Intronic
1184257307 22:43294610-43294632 CAGGCTACAGGGCAAGACAGGGG - Intronic
1184468323 22:44681871-44681893 CAGCCTGGAGGGCAGGCAGGAGG + Intronic
1184720448 22:46309521-46309543 CGGGCTGCAGGGTGGGCCCCGGG - Intronic
1184755894 22:46515553-46515575 CAAGCTGCAGGGCACCCCGGGGG + Intronic
1184785192 22:46668256-46668278 CAGGCAGCAGCGGAGGCCGGCGG - Intronic
1185065672 22:48630708-48630730 CAGGCTGCAGGGCTGGCTACCGG + Intronic
1185199862 22:49494670-49494692 CAGGCTGCAGGCCTGGGGCGCGG + Intronic
1185266714 22:49907885-49907907 CAGGCTGCAGCCCAGGCCGCGGG + Exonic
1203228590 22_KI270731v1_random:91976-91998 CAGGCGGCAGGGTGTGCCCGTGG + Intergenic
949581584 3:5393815-5393837 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
950688337 3:14635387-14635409 CAGGCAGCAGCGCAGCCCCTGGG + Intergenic
951576444 3:24119629-24119651 CAGTGTGCAGTGCAGGCCTGGGG - Exonic
951878699 3:27458948-27458970 CAGGCTGGAGTGCAGTGCCGTGG - Intronic
952383470 3:32821810-32821832 CGGGCGGCGGCGCAGGCCCGCGG - Intronic
952864622 3:37845121-37845143 CAGGCTGGAGGGCAGTGGCGTGG - Intergenic
953596416 3:44318595-44318617 CAGGCCCCAGGGCAGGTCTGAGG + Intronic
953608074 3:44424729-44424751 AAGGCTGCTGGGCAAGCCCCTGG - Intergenic
954370096 3:50165789-50165811 CAGCCTGCTGGGCAGCCCCAGGG + Intronic
954713838 3:52517450-52517472 CTCCCTTCAGGGCAGGCCCGGGG + Intronic
954735793 3:52705788-52705810 CCGGCGGCAGGGCTGCCCCGCGG - Exonic
954793965 3:53152072-53152094 CAGGCAGCAGAGCTGGCCCCAGG + Intergenic
954816606 3:53286946-53286968 CCTGCTGCAGGGCAGGACTGGGG + Exonic
955137960 3:56238562-56238584 TAGTCTGCAGGGCTGGCCCAGGG + Intronic
957043138 3:75352351-75352373 CAGGCTGGAGTGCAGGGGCGTGG + Intergenic
957858342 3:85908767-85908789 CAGGCTGGAGTGCAGGGGCGTGG + Intronic
958179767 3:90045396-90045418 AAATCTGCAGGGCAGGCCAGTGG + Intergenic
959655522 3:108800295-108800317 CAGGCTGAAGTGCATGCCCTCGG - Intergenic
959849904 3:111072762-111072784 CAAGCTGGAGGGCAGGGACGAGG - Intronic
960923459 3:122772901-122772923 CAGGCTGGAGGGCAGTGGCGTGG + Intronic
960939900 3:122926698-122926720 CAAGGGGCAGGGCAGGCCAGCGG + Intronic
961220192 3:125193585-125193607 CAGGCTGAGGGGCAGGACCACGG + Intronic
961521138 3:127467930-127467952 CAAGCTGCAGGCCAGGTCCCTGG + Intergenic
961652964 3:128426469-128426491 CTGGCGGCAGCGCAGTCCCGCGG - Intergenic
962133086 3:132703622-132703644 CAGGCTGGAGGGCAGGGGTGTGG + Intronic
962807580 3:138938266-138938288 TGGGCTGCAGCGCTGGCCCGGGG + Intergenic
963167438 3:142219922-142219944 CAGGCTGCAGTGCAGTGGCGTGG - Intronic
963289430 3:143472908-143472930 CAGCCTGTGGGGCAGGCCTGAGG - Intronic
963642876 3:147880372-147880394 CAGGCTGCTGGGCTGGACCTTGG + Intergenic
964627916 3:158776766-158776788 AAGGCTGCAGGGCAGGCCTGGGG + Intronic
965319788 3:167239092-167239114 CAGCCTGCAGGCCAGCCCTGTGG - Intergenic
965671958 3:171156766-171156788 CAGGCTGGAGGACAGGCCCTGGG + Intronic
965709512 3:171543215-171543237 CAGGCTGCAGGGCAGGAAAAAGG - Intergenic
966902417 3:184496327-184496349 AAATCTGCAGGGCAGGCCAGCGG - Intronic
966949250 3:184801308-184801330 CTGGCTGCAGGGCAGGCAAGGGG - Intergenic
967118631 3:186363269-186363291 TTGGCTGCAGTGCTGGCCCGGGG - Intergenic
967844902 3:194035596-194035618 CAGCCTGCAAGGCAGGCCTGTGG - Intergenic
968074202 3:195807421-195807443 CAGGCTGCAGTGCAGTGGCGTGG - Intronic
968232465 3:197011869-197011891 CAGGCCCCAGGGCAGCCCCGTGG + Intronic
968383657 4:116979-117001 GAGGCTGCAGGCCCGGCCAGAGG + Intergenic
968490955 4:890254-890276 GAGGCTCCAGGGCAGGGCCCAGG - Intronic
968576041 4:1366656-1366678 CAGGCTGCAGGGAGGGCCCCAGG - Intronic
968645823 4:1740059-1740081 CAGGGTGCAGGGCAGGGCCAGGG - Intronic
968872837 4:3250304-3250326 CAACCTGCAGGGAAGGCCGGAGG + Intronic
969246868 4:5940395-5940417 CAGGCTGCAGATCAGGGCCTGGG - Intronic
969516042 4:7648753-7648775 CAGGCACCAGGGCGGCCCCGGGG + Intronic
969673386 4:8601842-8601864 CAGAGTGCAGGGCTGGCCCTGGG + Intronic
969732135 4:8963755-8963777 CGGGATGCAGGGCTGGCGCGGGG - Intergenic
969791728 4:9497840-9497862 CGGGATGCAGGGCTGGCGCGGGG - Intergenic
969869041 4:10093469-10093491 CGGGCTGCAGGGCTGCCCCAGGG - Intronic
971386074 4:26141413-26141435 CAGGCTGCAGCACAGGCCCCAGG + Intergenic
972802330 4:42490118-42490140 CAGGCTGCAGGTCAGGGAAGGGG - Intronic
975758444 4:77594593-77594615 CAGGCAGCTGGGCAGGTCCAGGG + Intronic
976392003 4:84515534-84515556 GTGGCTGCAAGGCAGGCCCCAGG - Intergenic
977567775 4:98598507-98598529 CAGGCTGCAGTGCAGTGGCGCGG + Intronic
978764732 4:112392564-112392586 CAGGCTGCAGTGCAGTACAGTGG + Intronic
981691732 4:147516208-147516230 AGAGCTGCAGGGCAGGCCCTTGG - Intronic
982257586 4:153466078-153466100 CGCGCTGCGGGGCGGGCCCGCGG + Intergenic
983162864 4:164438532-164438554 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
984557217 4:181228798-181228820 CAAGCTGCATGGCAGGCTAGCGG + Intergenic
984996356 4:185434177-185434199 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
985270319 4:188188223-188188245 CAGGCTGAAGTGCAGGACCTTGG + Intergenic
985399444 4:189579974-189579996 CAGGTTGGAGAGCAGGCCCAGGG - Intergenic
985520788 5:373243-373265 CCGGGTGCAGGGCAGGGCCAGGG - Intronic
985631758 5:1017674-1017696 GGGGCTGCAGGGCGGCCCCGTGG - Intronic
985682010 5:1260710-1260732 CGGGCTGCAGCGCATGCCCCAGG - Intronic
985685683 5:1280456-1280478 CACGCTGAAGGCCATGCCCGGGG + Intronic
987276600 5:16369844-16369866 ATGGCTGCAGTGCAGGCCAGTGG - Intergenic
987739081 5:21882555-21882577 GCGGCTGCAGGGCATGCGCGCGG - Intronic
987784251 5:22478371-22478393 CAGGCTGGAGGGCAGTGGCGCGG - Intronic
988270031 5:29002256-29002278 CACGCTGGTGGGCAGGCCCCAGG + Intergenic
990678292 5:58213258-58213280 CAGTATGCATGGCAGGCCAGAGG + Intergenic
990954575 5:61330527-61330549 CAGGCTGCAAGGCAGGCGGGTGG + Intergenic
991472752 5:66986220-66986242 CAGAGTGCAGGGCAGGTCCCTGG + Intronic
991568791 5:68033183-68033205 AAGAATGCAGAGCAGGCCCGTGG + Intergenic
992004315 5:72462588-72462610 CAGGCTGAAGTGCAGTCCAGTGG + Intronic
992528057 5:77630474-77630496 CAGGCTGTTGGACAGGCCCATGG + Exonic
992865297 5:80951784-80951806 CAGTCTGAAGGGCAGGACTGTGG + Intergenic
993365560 5:87030366-87030388 CAGGCTGCTGTGCTGGCCAGTGG + Intergenic
994704285 5:103181525-103181547 CAGGCTGCAGTGCAGTCAGGGGG - Intronic
996117246 5:119632761-119632783 CAGGCTGCAGGGCATCCTCTTGG - Exonic
996714502 5:126576216-126576238 CAGGCTGGAGTGCAGGGGCGCGG - Intronic
997264347 5:132486439-132486461 CAGGCTGCAGGGTTGGTCGGAGG - Intronic
997340840 5:133143470-133143492 CAGGCTATAGGGCAGGGCCAGGG - Intergenic
997376928 5:133403958-133403980 CAGCCTGCAGGGAAGGCCATGGG - Intronic
998040222 5:138946848-138946870 CAGGCTCCAGGGCAGGAACCTGG - Exonic
999209577 5:149876393-149876415 CAGGCTGGAGGGCAGTGCAGTGG + Intronic
1000759462 5:165204297-165204319 CAGGCTGGAGGGCAGTGGCGCGG - Intergenic
1001250271 5:170141736-170141758 CTGGCTGCGGGGCTGGCCGGGGG - Intergenic
1001581928 5:172804834-172804856 GATGCTGCAGGGCAGGCCTGTGG + Intergenic
1001939613 5:175731228-175731250 CATGCTGCAGGGCGGGGCCCAGG - Intergenic
1002098947 5:176847961-176847983 CAGGATGGAGGTCAGGCCCAGGG + Intronic
1002427263 5:179183691-179183713 CAGGCTTCAGGGCAAGCCCAGGG + Intronic
1002527631 5:179823744-179823766 CATGCTGGAGAGCAGGGCCGGGG + Intronic
1002568281 5:180126360-180126382 CAGGCTGGAGTGCAGGGGCGCGG - Intronic
1003348333 6:5292321-5292343 CAGCCTGGAGAGCAGGCCAGAGG + Intronic
1003644050 6:7899983-7900005 TAGCTTGCAGGGAAGGCCCGAGG - Intronic
1003854518 6:10259382-10259404 GAGGCTGCAGGGAAGGGCAGAGG + Intergenic
1004308433 6:14522091-14522113 CAGGCTGCAGTGCAGTCACGCGG - Intergenic
1004510121 6:16278216-16278238 CGTGCTGCAGGCCAGGCCCTGGG + Intronic
1005374151 6:25164982-25165004 CAGGCTGGAGGGCAGTGGCGTGG + Intergenic
1005596307 6:27381691-27381713 CAGGCTGCAGGGCAGTGGCACGG - Intronic
1006177049 6:32128753-32128775 CAGGATGCAGGGCTGGCTCAGGG - Exonic
1006387434 6:33739166-33739188 CAGGCTGCACTGAAGGCCCAGGG - Exonic
1006472984 6:34238328-34238350 CAGGCTCCAGACCCGGCCCGAGG - Intronic
1006906563 6:37537082-37537104 CAGGCTCCAGAGCAGGCCTGCGG - Intergenic
1007018679 6:38496607-38496629 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1007462889 6:42030870-42030892 AAGGCTGGAGGGGAGGCCCCTGG + Intronic
1007756028 6:44100250-44100272 GAGGCTGCAGGACAGGCCCTGGG + Intergenic
1007784093 6:44270536-44270558 CAGGCTGGGGGGCCGGGCCGGGG - Exonic
1007816787 6:44530608-44530630 CAAGCTGCAGGGCAGGCCAGTGG + Intergenic
1008673571 6:53796129-53796151 GCGGCTGCAAGGCTGGCCCGCGG - Intronic
1008958810 6:57245006-57245028 CAGGCTGCAGGGATGGCTCCCGG + Intergenic
1009940504 6:70283074-70283096 CAGGCTGCAGAGCCGGGCCAAGG - Intronic
1011075326 6:83431688-83431710 CAGGATGCCGGCCATGCCCGGGG + Intergenic
1011256410 6:85426343-85426365 CAGGCTGCAGTGCAGTGCCTCGG + Intergenic
1012949517 6:105503253-105503275 CAGGCTGCAGAGGAGGCTGGAGG - Intergenic
1013256948 6:108397071-108397093 CAGGCTGGAGGGCAGTGGCGTGG + Intronic
1013314942 6:108932571-108932593 CAGGCTGGAGGGCAGTGGCGCGG + Intronic
1013604310 6:111733716-111733738 CAGGCTGCTGAGTAGCCCCGTGG + Intronic
1014009300 6:116458397-116458419 CTGGCTGCAGGGATGGCCAGGGG - Intergenic
1014508079 6:122283777-122283799 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
1015509562 6:134024311-134024333 TTGGCAGCAGGGCAGGCCGGAGG - Intronic
1016481271 6:144484485-144484507 CAGGCTGGAGGGCAGTGGCGTGG + Intronic
1017136903 6:151155395-151155417 CAGGCTGGAGTGCAGGCTGGAGG + Intergenic
1017426706 6:154329544-154329566 CAGGCTGGAGGGCAGTGGCGCGG - Intronic
1018877375 6:167834940-167834962 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1019043097 6:169122259-169122281 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1019445186 7:1067352-1067374 CAGGCTGCAGTGCACCCCAGAGG + Intronic
1019445229 7:1067547-1067569 CAGGCTGCAGTGCACCCCAGAGG + Intronic
1019445408 7:1068374-1068396 CAGGGAGCAGGACAGCCCCGGGG + Intronic
1019449924 7:1092207-1092229 CAGGCTGCAGCGCATGGCCCTGG - Exonic
1019490556 7:1311295-1311317 CAGGTGGCAGGGGTGGCCCGGGG + Intergenic
1019499038 7:1355296-1355318 CAGGCGGGAGGGAAGGCCTGCGG + Intergenic
1019519161 7:1452899-1452921 GAGGCTGGAGGGCCGGCCCTGGG - Intronic
1019597354 7:1864312-1864334 CTCCCTGCAGGGCAGACCCGGGG + Intronic
1019648715 7:2144694-2144716 GAGGCTACAGGGCAGCCCCGGGG + Intronic
1019650773 7:2156774-2156796 CAGGCTGGAGGGCAATACCGTGG - Intronic
1019679224 7:2335756-2335778 CAGGCTGGAGTGCAGTGCCGCGG - Intronic
1020095950 7:5369454-5369476 AAGGCTGCTGAGCAGGCCCAGGG + Intronic
1020151127 7:5682450-5682472 CAGGCTGCAGTGCAGTGGCGCGG + Intronic
1023703031 7:42911704-42911726 CAGGTGGCCGGGCAGGGCCGAGG - Intronic
1023773600 7:43583019-43583041 CAGGGTGCAGGGCAGGCGCGGGG + Intronic
1023902175 7:44490350-44490372 CAGGAGTCAGGGCAGGCCGGGGG + Intronic
1024456409 7:49613451-49613473 CAGGCTGGAGTGCAGGGCAGTGG + Intergenic
1024539814 7:50467059-50467081 CATGGGGCAGGGCAGGCCGGTGG + Intronic
1024863088 7:53868757-53868779 CAGGCTGCAGTGCAGTGCCGCGG - Intergenic
1025086325 7:56026442-56026464 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1025730132 7:64101126-64101148 CAGGCTGGAGTGCAGTCCAGTGG - Intronic
1025832201 7:65062169-65062191 CAGGCTGCAGAGCAGGGATGGGG + Intergenic
1025919879 7:65901598-65901620 CAGGCTGCAGAGCAGGGATGGGG + Intronic
1026602164 7:71785837-71785859 CAGGCAGCAGGGCAGGTAAGGGG + Exonic
1027267086 7:76500379-76500401 CAGGCTGGAGAGGAGGCCAGAGG - Intronic
1027318899 7:77000247-77000269 CAGGCTGGAGAGGAGGCCAGAGG - Intergenic
1029000357 7:97147957-97147979 CAGGCTGCAGTGCAGGCTCACGG + Intronic
1029225831 7:99027969-99027991 GAGGCTGCCTGGGAGGCCCGGGG - Exonic
1029600154 7:101558623-101558645 CAGGCTCCATGGCAGGCACCAGG + Exonic
1029957917 7:104659147-104659169 CAGGCTTCAGGGCCAGCCCCAGG + Intronic
1030154037 7:106434685-106434707 CAGGCTGGAGTGCAGTCCAGTGG + Intergenic
1030494969 7:110287644-110287666 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1031604046 7:123748364-123748386 CAGGCTGGAGGACAGGCCTGCGG + Intronic
1032153589 7:129450753-129450775 TAGGCTGCAGAGAAGGCCCTTGG - Intronic
1032192156 7:129771505-129771527 CAGGCTGCAGGGGAGGCATGGGG - Intergenic
1032222330 7:130004014-130004036 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
1032265604 7:130368040-130368062 CTGGCTGCAGGGCAGTGCCAAGG + Intronic
1032464275 7:132134083-132134105 CAGTCTGCAGGGCAGGGACTAGG + Intronic
1032466624 7:132150012-132150034 CAGGCAGCAGGGAAGCCCCAGGG - Intronic
1032506042 7:132435444-132435466 CAGGCTGCTTGGGAGCCCCGTGG - Intronic
1032522088 7:132553192-132553214 CAGGTTGCAGGCCATGCCTGGGG - Intronic
1032550420 7:132779461-132779483 CAGGCTGCAGAGCAGGGGCTGGG - Intergenic
1033276608 7:139976323-139976345 CAGGATGCAGGGCTGTCCCCCGG - Intronic
1033580768 7:142733224-142733246 CAGGCTGCAGGGGACTCCTGAGG - Intergenic
1034500618 7:151448401-151448423 CAGGCTGCAGCGCCGGCCGAGGG + Intergenic
1035161577 7:156954222-156954244 CAGTCTGCTGGGCATGGCCGAGG - Exonic
1035316095 7:157998179-157998201 CAGGCTGCAGCCCGGGCCCTGGG - Intronic
1035362388 7:158322180-158322202 CAGGATGCAGGGCAGAGCTGTGG - Intronic
1035569284 8:661307-661329 CAGGCTCCAGGGCAGAACTGTGG - Intronic
1035673656 8:1439373-1439395 CAGGGTACACGGCAGGACCGTGG - Intergenic
1036200890 8:6770983-6771005 CAGGCTGCAGTGCAGTGGCGTGG - Intergenic
1036645756 8:10610879-10610901 CAGGCTGCAGGGTGAGCCTGCGG - Exonic
1036701554 8:11016594-11016616 CTGGCTGCAGCGCGGGCCCTCGG + Intronic
1037023207 8:13999733-13999755 CAGGCTGGAGGGCAGTGGCGCGG + Intergenic
1037703643 8:21297049-21297071 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1038018919 8:23536689-23536711 GAGGCAGAAGGGCAGGCCCGAGG - Intronic
1038182210 8:25239995-25240017 CAGGGTGCACTGCAGGCCCAGGG + Intronic
1038888649 8:31693880-31693902 CAGGCTGGAGGGCAGTGGCGAGG + Intronic
1039162562 8:34639207-34639229 GATGGTGCAGGGCAGGGCCGTGG - Intergenic
1039780169 8:40777471-40777493 GAGGCTGCCTGGGAGGCCCGGGG - Intronic
1039864701 8:41490668-41490690 CAGGCGGCAGCTAAGGCCCGCGG + Exonic
1042284416 8:67092480-67092502 CAGGCTGGAGGGCAGTGGCGGGG + Intronic
1042563680 8:70092452-70092474 GAGGCTGCAGGGGTGTCCCGCGG + Intergenic
1043769743 8:84183416-84183438 CAGGCAGCGGGGAAGGACCGAGG - Intronic
1045850283 8:106687667-106687689 CAGGCTGAAGGGCAGTGGCGTGG - Intronic
1047499604 8:125431087-125431109 CGGGCTGCAGGGCGAGCCGGGGG - Exonic
1048269573 8:133017836-133017858 CCGGCTGCTGGGCAGGTCCCAGG + Exonic
1048273448 8:133047666-133047688 CACGCTGCTGGGGAGGCCAGTGG - Intronic
1048977457 8:139680884-139680906 CAGGCTGCTGGGCAGGACCATGG - Intronic
1049020920 8:139957253-139957275 AAGGCTGCAGGGCAGGTACGCGG - Intronic
1049173248 8:141175020-141175042 TGGGCTGCAGGGAAGGCCCTGGG + Intronic
1049428789 8:142549736-142549758 CAGGCTGCAGAGCAGGGCTGTGG - Intergenic
1049435917 8:142586183-142586205 CAGGTTGCGGGGCAGGCATGAGG + Intergenic
1049591875 8:143466384-143466406 CTGGCTGCAGGCCAGCACCGTGG + Intronic
1049685334 8:143937140-143937162 AAGGCTGCCCGGCAGGCCCTGGG - Intronic
1051345064 9:16144012-16144034 AAATCTGCAGGGCAGGCCAGGGG + Intergenic
1052899402 9:33778723-33778745 CAGGCTGCAGGGGACTCCTGAGG - Intronic
1053352779 9:37424522-37424544 CCAACTGCAGGGAAGGCCCGTGG - Intronic
1053513164 9:38706714-38706736 CAGGCTGGAGGACAGTCCCAGGG - Intergenic
1054452641 9:65411524-65411546 GACGGTGCAGGGCAGGCCCAAGG + Intergenic
1055207191 9:73746599-73746621 AAGGCTGCAGGGCAGTGGCGTGG + Intergenic
1056986246 9:91365879-91365901 CAGGCTGGAGGGCAGTGGCGTGG + Intergenic
1057142392 9:92735325-92735347 CAGGCTGCAGGACAGACGCTGGG + Intronic
1057290226 9:93801664-93801686 GAGTCTGGAGGGCAGGCCTGGGG - Intergenic
1057314091 9:93958095-93958117 CATGCTGCAGGGCTGGCCTGGGG - Intergenic
1057484443 9:95471664-95471686 CAGGCTGCAGAGCAGCTCAGTGG + Intronic
1058004898 9:99904461-99904483 CAGGCTGGAGTGCAGGCTGGTGG + Intergenic
1059015692 9:110513079-110513101 GAGGCTTCAGGGCAGGGCAGTGG + Exonic
1059197326 9:112382218-112382240 CAGGGTGGAGGGCAGGGCAGTGG - Intronic
1060524430 9:124312452-124312474 CAGGCTGCAGCAGAGGCCTGGGG - Intronic
1060831963 9:126722756-126722778 CCGGGTGCGGGTCAGGCCCGGGG - Intergenic
1060967887 9:127721645-127721667 GAGGCTGCAGCCCAGCCCCGGGG - Intronic
1061001332 9:127904627-127904649 CAGGCTGCAAGCCAGGCCTGGGG + Intronic
1061486640 9:130923702-130923724 CGGGCGGCAGGGCAGGCACCGGG - Intronic
1061491333 9:130946268-130946290 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1061548645 9:131319673-131319695 CTGGCCGCAGCGCAGCCCCGGGG + Intergenic
1061675798 9:132214914-132214936 CAGGCTGAAGGGCAGTGCAGTGG + Intronic
1061765392 9:132878331-132878353 GAGCCTGCAGGGCGGGGCCGCGG - Exonic
1061801627 9:133116159-133116181 GGAGCTGGAGGGCAGGCCCGAGG - Intronic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1061890611 9:133617213-133617235 CAGGCAGCATGGCAGGCACGGGG + Intergenic
1061976568 9:134070982-134071004 GAGGCTGGAGGGCAGGACAGAGG - Intergenic
1062034782 9:134378134-134378156 CAGGGTTCTGGGCAGGGCCGGGG + Intronic
1062181292 9:135192555-135192577 CAGACTACAGGGGAGGCCTGGGG + Intergenic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1062291450 9:135797064-135797086 CAGGCTGCAGGGGAGCCACAGGG + Intergenic
1062312777 9:135948228-135948250 CAGGCTGCAGCTGAGCCCCGAGG + Intronic
1062351949 9:136143684-136143706 GAGGCTGCAGGCCTGGCCTGGGG - Intergenic
1062426110 9:136507014-136507036 CACGCGGCACGGCAGGGCCGGGG - Intronic
1062465035 9:136677208-136677230 CAGGGTGCCAGGCAGGCCTGTGG - Intronic
1062522390 9:136963761-136963783 ATGGCTCCAGGGCAGGCCTGGGG - Intergenic
1062581058 9:137229447-137229469 CAGCCTGCAGCCCAGGCCCCCGG - Exonic
1062601622 9:137320966-137320988 AAGGCTGCAGGAGAGGCCCCTGG + Intronic
1062726333 9:138076119-138076141 CAGGCTGAAGGGAAGCCCTGAGG + Intronic
1203489229 Un_GL000224v1:87610-87632 CAGTCAGCAGGACAGGCCAGGGG - Intergenic
1203501850 Un_KI270741v1:29505-29527 CAGTCAGCAGGACAGGCCAGGGG - Intergenic
1185555532 X:1018332-1018354 CAGGCTGGAGGGCAGTGGCGCGG + Intergenic
1185583853 X:1230683-1230705 CAGGCTGGAGTGCAGTGCCGCGG - Intergenic
1190233339 X:48598685-48598707 CAGGATGCAGGGCAGGCAGCAGG - Intronic
1190879900 X:54484637-54484659 AAGGCTGCAGGGCATAGCCGGGG - Intronic
1191113026 X:56822362-56822384 CAGGCTTCAGGCCAGCCCAGTGG + Intergenic
1192125817 X:68499680-68499702 CAGGCTGGAGGGCAGTGGCGCGG + Intronic
1192222522 X:69207109-69207131 CAGGCTTCAGGGCATGCATGTGG + Intergenic
1194593245 X:95826973-95826995 CAGGCTGCAGTGCAGTGGCGCGG + Intergenic
1195135797 X:101906505-101906527 CAGCCTGGAGGGCAGGGCTGTGG - Intronic
1195721671 X:107874494-107874516 CAGGCTGCTGGGCTGGACCAGGG + Intronic
1197122992 X:122913949-122913971 CAGGCTTTAGGCCAGGCCCTGGG - Intergenic
1198033123 X:132774723-132774745 CAGGCTGGAGTGCAGTCCCGTGG + Intronic
1200124306 X:153806037-153806059 CAGGCTGCAGGCCTGGCCCAAGG - Intronic
1200143371 X:153913139-153913161 CAGGCGGGAGGGGAGGACCGTGG + Intronic
1200155471 X:153972520-153972542 CAGGCTGCGGGGCCCGCCCTCGG + Exonic
1200773181 Y:7146121-7146143 CAGCCTGCAGGGAAGCCCTGGGG - Intergenic