ID: 900624661

View in Genome Browser
Species Human (GRCh38)
Location 1:3602711-3602733
Sequence GTGCCGTGGAGGCCTGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 1, 2: 0, 3: 32, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900624661_900624669 10 Left 900624661 1:3602711-3602733 CCGTGGCCAGGCCTCCACGGCAC 0: 1
1: 1
2: 0
3: 32
4: 240
Right 900624669 1:3602744-3602766 CCAGTGCCCCAGGCCAGCCGTGG 0: 1
1: 0
2: 8
3: 46
4: 382
900624661_900624676 25 Left 900624661 1:3602711-3602733 CCGTGGCCAGGCCTCCACGGCAC 0: 1
1: 1
2: 0
3: 32
4: 240
Right 900624676 1:3602759-3602781 AGCCGTGGGACCCAGGCTTGAGG 0: 1
1: 0
2: 2
3: 33
4: 187
900624661_900624674 18 Left 900624661 1:3602711-3602733 CCGTGGCCAGGCCTCCACGGCAC 0: 1
1: 1
2: 0
3: 32
4: 240
Right 900624674 1:3602752-3602774 CCAGGCCAGCCGTGGGACCCAGG 0: 1
1: 0
2: 2
3: 52
4: 511
900624661_900624665 0 Left 900624661 1:3602711-3602733 CCGTGGCCAGGCCTCCACGGCAC 0: 1
1: 1
2: 0
3: 32
4: 240
Right 900624665 1:3602734-3602756 AGTGCCCATGCCAGTGCCCCAGG 0: 1
1: 0
2: 2
3: 23
4: 272
900624661_900624670 11 Left 900624661 1:3602711-3602733 CCGTGGCCAGGCCTCCACGGCAC 0: 1
1: 1
2: 0
3: 32
4: 240
Right 900624670 1:3602745-3602767 CAGTGCCCCAGGCCAGCCGTGGG 0: 1
1: 0
2: 4
3: 22
4: 194
900624661_900624677 26 Left 900624661 1:3602711-3602733 CCGTGGCCAGGCCTCCACGGCAC 0: 1
1: 1
2: 0
3: 32
4: 240
Right 900624677 1:3602760-3602782 GCCGTGGGACCCAGGCTTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900624661 Original CRISPR GTGCCGTGGAGGCCTGGCCA CGG (reversed) Intronic
900100773 1:961108-961130 GCGCAGCGGAGGCCTGGACACGG + Intronic
900605968 1:3523658-3523680 TGGCCGAGGAGGCCTGGTCAGGG - Intronic
900624661 1:3602711-3602733 GTGCCGTGGAGGCCTGGCCACGG - Intronic
900636741 1:3669660-3669682 GTGCCGGGGAGGCCGGGGCATGG - Intronic
901635479 1:10668326-10668348 CTTCCATTGAGGCCTGGCCACGG - Intronic
902516480 1:16992313-16992335 GTGTGGTGGTGGCGTGGCCAGGG - Exonic
903182415 1:21611620-21611642 GCCCCATGGAGGCCTGGCCAGGG - Intronic
905001288 1:34671766-34671788 GTGCCTTTCAGGCCTGCCCATGG + Intergenic
905029009 1:34869004-34869026 GGGCCTGGCAGGCCTGGCCACGG - Exonic
905362728 1:37431445-37431467 GCCCTGGGGAGGCCTGGCCAAGG + Intergenic
906264434 1:44417783-44417805 GCCCCGGGGAGGCCAGGCCACGG + Intronic
906514366 1:46430175-46430197 AAGCCGTGGAGGCCAAGCCAAGG + Intergenic
906675360 1:47689105-47689127 GGGAGGTGGGGGCCTGGCCAGGG - Intergenic
911637335 1:100249666-100249688 GTGCCCTGGACGCCTGGCACCGG + Intronic
915515652 1:156410959-156410981 GTGCTGTGGAGGCATGGGGAAGG - Intronic
916058493 1:161083751-161083773 GGCCCGTGGGGGCCTGGCCAGGG - Intronic
916520752 1:165561474-165561496 TTGCCCAGGAGGCCTGGGCATGG - Intronic
919781978 1:201226999-201227021 GTGCCGTGCAGGGCTCGCCCCGG + Exonic
919895606 1:202008081-202008103 GTGCCTTGGAGGCATGGGGATGG - Exonic
919919090 1:202157760-202157782 GGTCCTTGGAGGCGTGGCCAGGG + Exonic
920247698 1:204600803-204600825 GTGGCCAGGTGGCCTGGCCAGGG - Intergenic
923117469 1:230956270-230956292 GTGCACTGGAGGGATGGCCAAGG + Intronic
924563889 1:245179966-245179988 GCGCCTGGGGGGCCTGGCCAGGG + Intronic
1063455889 10:6182528-6182550 CTGGCGTGGAGACCTGGCCTGGG - Intronic
1065189247 10:23195239-23195261 GTGCGGCGCAGGCCTGGCCCAGG + Intergenic
1065625547 10:27625431-27625453 GTGGCACCGAGGCCTGGCCAAGG + Intergenic
1066463472 10:35633076-35633098 GTGCCGTGAAGGCCAGTGCAGGG - Intergenic
1067053531 10:43038603-43038625 GGGCCATGGAGGACTGGCCAGGG - Intergenic
1067188621 10:44051282-44051304 GTGCTGTGTATGCCTGGCGAGGG + Intergenic
1068157819 10:53223469-53223491 CTGCAGGGGAGGCTTGGCCAGGG - Intergenic
1069430649 10:68331660-68331682 GCGCCGTCGATGCCTAGCCAGGG + Intronic
1070845775 10:79521863-79521885 GTCCCTTGGAGGCTTGGCCAGGG + Intergenic
1070928018 10:80238455-80238477 GTCCCTTGGAGGCTTGGCCAGGG - Intergenic
1074210012 10:111322590-111322612 CAGCAGTGGAGGCATGGCCATGG + Intergenic
1075399158 10:122149282-122149304 GTGACTTGGAAACCTGGCCAAGG + Intronic
1075647395 10:124105342-124105364 GTGCCTTGGAGGCATGGGGAAGG - Intergenic
1075760806 10:124854935-124854957 GTGCAGTTGAGGGCTGGGCAAGG - Intergenic
1076160583 10:128241317-128241339 CTGACATGCAGGCCTGGCCATGG + Intergenic
1076175111 10:128362419-128362441 GTGCAGTGGAGGCACGGCCGTGG + Intergenic
1076189228 10:128470920-128470942 GGGGCGTGCAGGGCTGGCCAGGG - Intergenic
1076904298 10:133354646-133354668 GTGCCTGGGAGGCTTGCCCATGG - Intergenic
1077033098 11:479031-479053 GGGCCGTGGAGGCCTGGACCGGG + Intronic
1077502427 11:2915433-2915455 GTGCCCTGAGGCCCTGGCCAGGG + Intronic
1077515948 11:3002343-3002365 GTGCAGGGAAGGCCTGGCCAAGG - Intronic
1079014482 11:16856950-16856972 CTGCTTTGGAGGCCTGGGCAAGG + Intronic
1079237007 11:18698556-18698578 GTTCCGTGGACGCCTTGGCACGG + Intronic
1079303057 11:19296623-19296645 ATGCCCTGGAGGCATGGCCTGGG + Intergenic
1080395465 11:31886034-31886056 GTGCCCTCCAGGCCTGGCCCAGG + Intronic
1083268415 11:61557944-61557966 CTTCCCTGGAGTCCTGGCCATGG - Intronic
1084103109 11:66963137-66963159 GTGCTATGGAAGGCTGGCCAAGG + Intergenic
1084589733 11:70083800-70083822 GGACCCCGGAGGCCTGGCCAGGG - Intronic
1084617553 11:70246522-70246544 CTGCCGTGCAAGCCCGGCCAGGG + Intergenic
1084702833 11:70798659-70798681 TTGCTCTGCAGGCCTGGCCAGGG - Intronic
1088450934 11:109980450-109980472 GTGGGATGGAGGCCTGTCCAAGG + Intergenic
1089573229 11:119423368-119423390 GTGGCTGGCAGGCCTGGCCAGGG + Exonic
1090395212 11:126414254-126414276 GAGCCGTGGGAGCCCGGCCAGGG + Exonic
1097263690 12:57734044-57734066 GGGACGAGGAGGCCTGGCCTTGG - Exonic
1103397888 12:120622086-120622108 GAGAAGTGGAGGCCTGGCCTTGG + Intergenic
1106588918 13:31081496-31081518 GGGCCGTAGAGGCCTGGCTAAGG + Intergenic
1113608955 13:111629717-111629739 GTGCCAAGGAGGCCTCGGCATGG - Intronic
1113800731 13:113085195-113085217 GTGCTGGGGAGGCCGGGCCACGG - Intronic
1113808968 13:113126139-113126161 AGGCCTGGGAGGCCTGGCCATGG + Intronic
1116950212 14:50872299-50872321 GAGCCGTCGGGGCCCGGCCAGGG - Intronic
1119729507 14:76942062-76942084 ATGCTGTGCAGGCCTGTCCAAGG - Intergenic
1120134842 14:80855683-80855705 GAGTCGTGGAGGCCTTTCCAAGG - Intronic
1120882944 14:89428781-89428803 GGGGCGTGGAGGCCTGCGCAGGG - Intronic
1122367077 14:101200650-101200672 ATGTCCTGGAGGCCTGGCCCTGG - Intergenic
1122521249 14:102345373-102345395 GTGCCGTGGGTGCCTGACCAGGG - Intronic
1122972066 14:105156383-105156405 GTGCTGTCGAGGGCTGGACACGG - Intronic
1124374308 15:29120858-29120880 ATGCCGTGGAGCCGGGGCCAAGG + Exonic
1125590389 15:40851046-40851068 GCGTCCTGGAGGCCAGGCCAGGG - Intronic
1127834405 15:62778845-62778867 GTGCCCTGGATGTCAGGCCAGGG - Intronic
1128185650 15:65641681-65641703 GTGCCGGGGTGCTCTGGCCAGGG + Intronic
1130060999 15:80569846-80569868 GTGCCCCGGATGCCTGGCCAAGG - Intronic
1132556179 16:573742-573764 GTGCCGAGGAGGCCGTGCCCTGG + Intronic
1132643231 16:987527-987549 GTGCCCGGGAGACCTGGCAAAGG - Intergenic
1132697957 16:1210273-1210295 CTGAAGTGGAGGCGTGGCCAGGG + Intronic
1132810459 16:1794385-1794407 GTGTGGGGGTGGCCTGGCCATGG + Intronic
1133304682 16:4801732-4801754 GTGCCCTGGGGGCTTGGGCAGGG - Intronic
1135691365 16:24540050-24540072 GTGCGGTGGGGGCCTGGGCCTGG + Intronic
1136545136 16:30950240-30950262 GCGGGGTGGAGGCCTGTCCAGGG - Intronic
1137379192 16:47981845-47981867 GTGCAGTGGAGGCCTGGGTCAGG - Intergenic
1137480735 16:48850057-48850079 CTGCCCAGGAGGCCTGACCATGG + Intergenic
1137567031 16:49539737-49539759 GAGTCTGGGAGGCCTGGCCAAGG + Intronic
1137614370 16:49838195-49838217 GTGGGCTGGAGGCCTGGCCCCGG - Intronic
1137741428 16:50779902-50779924 GTTCCCAGGAGGCATGGCCAAGG - Exonic
1138088362 16:54154439-54154461 GTTCTGGGGAGGCCCGGCCAGGG - Intergenic
1138458879 16:57136294-57136316 CTGCCCAGAAGGCCTGGCCAGGG - Intronic
1139529328 16:67535257-67535279 GGGCAGTGAGGGCCTGGCCAAGG + Intronic
1140055406 16:71521463-71521485 GTGACGTGGAGGCCAGGGTAGGG - Intronic
1142373153 16:89694107-89694129 GTCCTGTGGAGGCCTGGGCTGGG + Intronic
1142380597 16:89729778-89729800 GGACCGTGGCTGCCTGGCCATGG - Intronic
1143096342 17:4480504-4480526 GCGCCGTGGGGGGCAGGCCAGGG - Intronic
1144703356 17:17352440-17352462 GTGCCGTGGAGGACAGGCGTGGG + Intergenic
1144727983 17:17511359-17511381 GTCCCAGAGAGGCCTGGCCATGG + Intronic
1144838672 17:18172147-18172169 GCGCTGAGGAGGCCTGGGCAGGG - Exonic
1144955373 17:19016504-19016526 GTGCCCTGGGCTCCTGGCCAGGG - Intronic
1145896494 17:28461161-28461183 GTGGGGTGGGGGCATGGCCAGGG - Intronic
1147000636 17:37359458-37359480 GGGCCGCGAAGGCCGGGCCAGGG - Intronic
1147341246 17:39754380-39754402 GAGCCCCGGAGGCCTGGCCGCGG - Intergenic
1149546630 17:57508729-57508751 GAGCCCGGCAGGCCTGGCCAAGG + Intronic
1149675082 17:58452741-58452763 GTGGCGTGGAGGCCAGGCAGAGG - Intronic
1150648316 17:66993510-66993532 GTGCCCTGGTGACCTGGCAATGG - Intronic
1150949538 17:69787009-69787031 GTTCCGTGGAGCCTTGGGCAAGG + Intergenic
1151338549 17:73455425-73455447 GTGCGGCGGAGGTGTGGCCAGGG - Intronic
1151423929 17:74017373-74017395 CTGCCTTGGAGGCCCGGCCAAGG - Intergenic
1152128572 17:78462191-78462213 GTGCCGAGCAGGGCTGGCCAGGG + Intronic
1152430883 17:80247790-80247812 GAGCCCTTGAGACCTGGCCAAGG - Intronic
1152705920 17:81843588-81843610 TCTCCGAGGAGGCCTGGCCAAGG + Exonic
1153236590 18:2994432-2994454 TGGCCATGGAGGCCGGGCCATGG + Intronic
1158837234 18:61343795-61343817 TTGCTGTGGAGGCCTGGACCAGG + Intronic
1160418482 18:78728082-78728104 GTGCCGTGGAGGCAGCGACAGGG + Intergenic
1160823734 19:1069734-1069756 CTTCCTTGGAGGCCTGGCCTGGG + Intronic
1161563958 19:4989149-4989171 CTGCCGTGGAGGGCTTGGCAGGG + Intronic
1161576257 19:5056084-5056106 GTGTTGAGGAGGGCTGGCCAGGG + Intronic
1161596564 19:5153853-5153875 GTTCTCTGGAGGCCTGGCCCTGG + Intergenic
1161707556 19:5829243-5829265 CCCCCGTGGAGGCCCGGCCAGGG - Intergenic
1162567870 19:11454111-11454133 GTGCTGGGGAGGCCTGGGCAAGG + Exonic
1163826003 19:19525408-19525430 GTGCCCTGGAGGCCTGGAGATGG + Intronic
1164160525 19:22623229-22623251 TCGCCTTGGAGCCCTGGCCACGG + Intergenic
1165145707 19:33728724-33728746 GTGCAGGGGAGCCCAGGCCAGGG + Intronic
1165734053 19:38164669-38164691 GGGCCGTGGAGCCTTGGCCAGGG - Exonic
1166198619 19:41222006-41222028 GTGACCTGGAGCCGTGGCCAGGG - Exonic
1167054063 19:47097833-47097855 CTGCCGTGGCGGCCTGTGCAGGG + Intronic
1167429853 19:49447965-49447987 CTGCGGTTGAGGCCTGGGCAGGG - Intronic
1167688070 19:50968904-50968926 CTTCCCTGGAGGCCTGGTCAGGG - Exonic
1168198789 19:54797571-54797593 GAGCTGTGGAGGCATGGCCCCGG - Intronic
925339331 2:3125375-3125397 GAGCCCTGGAGTCCTCGCCAAGG - Intergenic
925981247 2:9179138-9179160 GTGCCGGGGAGGCGGGTCCAAGG - Intergenic
928679096 2:33680744-33680766 CTGCAGTGGAGGCCTGGGTATGG - Intergenic
933786908 2:85850496-85850518 CTGCTGGGCAGGCCTGGCCAGGG - Intronic
934520125 2:95014831-95014853 GTGTGGTGGAGGCCTGTCCTAGG + Intergenic
934661407 2:96145473-96145495 GTGCCCCGGAGGCCGGCCCACGG - Intergenic
934883824 2:98007365-98007387 GTGCCGTGGAGACCTGAGAAGGG + Intergenic
935963223 2:108447684-108447706 GTGCAATGGAGGGCTGGCGAGGG + Intergenic
937295127 2:120805430-120805452 GTGCCGGCCAGGCATGGCCAAGG - Intronic
937350008 2:121154747-121154769 GTGAGGTGGCGCCCTGGCCATGG - Intergenic
938164018 2:129010421-129010443 TAGCCGTGGAAGCCTGGCCAGGG + Intergenic
941130922 2:161650404-161650426 CAGCGGCGGAGGCCTGGCCAGGG + Intronic
941997225 2:171612030-171612052 CTGCCGTTGCTGCCTGGCCAAGG + Intergenic
946394492 2:219436275-219436297 CTACCATGGAGGCCAGGCCAGGG + Intronic
947534134 2:230930146-230930168 GTGACCTGGTGGCCTGGACAGGG - Intronic
947926061 2:233923556-233923578 GTGCAGTGGATGCCGGCCCATGG - Intronic
948268814 2:236658076-236658098 TTGCTGCGGAGGCCTGGACAGGG + Intergenic
948463289 2:238140423-238140445 CTGCCCTGAATGCCTGGCCATGG + Intronic
948844966 2:240678710-240678732 GTGTCGGTGAGGCCTGGGCAGGG - Intronic
948848894 2:240696169-240696191 GTGTCGGTGAGGCCTGGGCAGGG + Intronic
1168908388 20:1425279-1425301 ATGCTGAGCAGGCCTGGCCAGGG - Intergenic
1172732459 20:37099409-37099431 GTGCCTTGTAGGCCAGGACAAGG - Intergenic
1174407719 20:50312943-50312965 CTCCCGTGGGGGCCTTGCCAAGG - Intergenic
1175222839 20:57427107-57427129 ATGCCGTGGAGGCCTTGCTGTGG - Intergenic
1175756779 20:61535304-61535326 GTGCAGAGGTGCCCTGGCCAAGG + Intronic
1175989189 20:62779060-62779082 GTGCCGAGAAGGTGTGGCCAGGG - Intergenic
1178114745 21:29405602-29405624 GAGCAGTGGAGCCCTGGACAGGG - Intronic
1179610524 21:42547400-42547422 CTCCTGAGGAGGCCTGGCCAGGG - Intronic
1180866908 22:19124884-19124906 GTGCCAGGGAGCCCTGCCCAAGG + Intergenic
1181030055 22:20145321-20145343 GTGCCGTGTAGGGCTGGCAGAGG - Intronic
1181286053 22:21753463-21753485 CGGCAGTGGAGGCCTGGCCAGGG + Intergenic
1181306381 22:21919609-21919631 GTGCAGTGCAGGCCTTGCGAAGG - Exonic
1182070403 22:27459428-27459450 ATGCCAGGGAGACCTGGCCAAGG - Intergenic
1182260875 22:29072748-29072770 GTGACTTGGAGGCCGGGCCGAGG + Intergenic
1182549096 22:31091427-31091449 GGCCTGTGGAGGCCTGGCCACGG - Exonic
1183098913 22:35571286-35571308 GTGCCTCGGAGGCCTGGGGAAGG - Intergenic
1183540719 22:38427857-38427879 GTGACCTGGAGGCCAGCCCAGGG - Exonic
1183590267 22:38775813-38775835 GTGCAGGGGAGGCCTGGCGATGG + Intronic
1183716285 22:39535358-39535380 GTGCCGTGTGGGCCGGGCCTGGG + Intergenic
1184508401 22:44917809-44917831 GTGCCTTGGTGACCTGCCCAAGG - Intronic
1184654707 22:45935300-45935322 GGGCCTTGGGGGCCAGGCCAAGG - Intronic
1184848437 22:47103295-47103317 GTGCCGCGGAGACATGGCCAGGG + Intronic
1185003024 22:48257620-48257642 GTGCCGGGGAGGCCAGGAGAAGG - Intergenic
1185329546 22:50245992-50246014 GTGGCGCTGGGGCCTGGCCATGG - Exonic
950368651 3:12508104-12508126 GTGGGCTGGAGGCCTGGCCTGGG + Intronic
952827473 3:37536319-37536341 GTGCCTGGAAGGCCTGCCCAGGG - Intronic
953881445 3:46693383-46693405 GAGCCGTGGTGGCAGGGCCACGG - Intronic
953918418 3:46935439-46935461 GTGCCATGGAGGCATGTCTAGGG - Intronic
953939219 3:47076317-47076339 GTGGCTTGCATGCCTGGCCATGG - Intronic
955006399 3:54972773-54972795 GTGACTTGAGGGCCTGGCCATGG + Intronic
955108749 3:55926744-55926766 GTGCTGTGGAGGACTCTCCAGGG - Intronic
961368287 3:126414983-126415005 CTGATGTGGAGGCCTGGGCAGGG - Intronic
961450745 3:127001280-127001302 ATGCCTTGCAGGCCGGGCCAGGG + Intronic
966602419 3:181788604-181788626 GTGTCGAGGAGGGGTGGCCAGGG + Intergenic
967204594 3:187108008-187108030 ATGCCTTGGATGTCTGGCCATGG - Intergenic
968576601 4:1369162-1369184 GTGCCCTGTGGGCCTGGCCTGGG + Intronic
968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG + Intronic
968658381 4:1788403-1788425 GGGCAGTGGAGGGCTGGCCAGGG - Intergenic
968817597 4:2829822-2829844 GAGCCCTGGACCCCTGGCCACGG + Exonic
968856444 4:3127672-3127694 GTGCAGTGGAGGCCGGGCACAGG + Intronic
969377566 4:6772871-6772893 ATGCCGCGGAGGCCTTGCCTTGG - Intergenic
969598466 4:8161941-8161963 GTCCCAGGGAGGCCAGGCCAGGG - Intergenic
978663550 4:111155166-111155188 CAGCAGGGGAGGCCTGGCCAGGG - Intergenic
979492048 4:121339506-121339528 GTGCTGGGGATGCCTGGCAAAGG - Intronic
984972615 4:185204138-185204160 GCGGAGTGGAGGCCGGGCCAGGG + Intronic
985537074 5:471523-471545 GTGCCGGGAAGGCCAGGCCCCGG + Exonic
985711425 5:1431770-1431792 GTGCAGGTCAGGCCTGGCCAGGG + Intronic
985826120 5:2192783-2192805 GTGTGGTGGACCCCTGGCCAAGG + Intergenic
985874283 5:2583559-2583581 GTGCAGAGGAGGCCAGACCAGGG - Intergenic
985886955 5:2687320-2687342 GTGCCATGGAAGCCTGGCAGGGG - Intergenic
985998113 5:3608548-3608570 GGGCCGTGCAGGCGTAGCCAGGG - Intergenic
986211964 5:5682455-5682477 GGGCTGAGGAGGCCTGGACAGGG + Intergenic
986631699 5:9780310-9780332 GTGCAGTGGAGGGCTGGTGATGG - Intergenic
991959876 5:72033992-72034014 GAGCCATGGAGGCCTGGAGATGG - Intergenic
997309285 5:132866480-132866502 GTGCCTTGGAGGCCCTGCCCGGG - Intronic
997471717 5:134120913-134120935 GTGCCAGTGCGGCCTGGCCAGGG + Intronic
998137154 5:139680051-139680073 GGGCTGTGGAGGCCTGGACTAGG + Intronic
998204077 5:140146598-140146620 GTGTCGTGGAGGCCCGGCTCGGG - Intergenic
999243711 5:150142038-150142060 GGGAGGAGGAGGCCTGGCCATGG + Intronic
1001054387 5:168436977-168436999 GGGCCTTGGAGGCCAGGCAAAGG - Intronic
1002462001 5:179378535-179378557 GTGTCCAGGAAGCCTGGCCAGGG - Intergenic
1002480563 5:179498161-179498183 CTGCCGTGGAGCCCTGGGCCAGG - Intergenic
1002921311 6:1575289-1575311 CTACAGAGGAGGCCTGGCCAGGG - Intergenic
1006523106 6:34583493-34583515 TTGCAGGGGAGGCCAGGCCAGGG + Intergenic
1007524056 6:42475667-42475689 GAGCCATGGAGCCCTGCCCATGG - Intergenic
1016891819 6:149014827-149014849 ATGCCCTGGAAGTCTGGCCAGGG + Intronic
1017461298 6:154653472-154653494 GTGTTGTGCTGGCCTGGCCAGGG - Intergenic
1019379079 7:712112-712134 GTGCCGGCCTGGCCTGGCCATGG - Intronic
1019426347 7:978947-978969 GTCATGTGGAAGCCTGGCCACGG + Intergenic
1019438156 7:1032320-1032342 GTGCCGTGGAGGCCTCGGCGAGG + Intronic
1020046742 7:5046157-5046179 GTGTCCTGGCGGCCTGGCCCAGG + Exonic
1020292115 7:6730084-6730106 GTGTCCTGGGGGCCTGGCCCAGG + Intergenic
1021141687 7:17033548-17033570 CTGGGGTGGAGGCCTGGCCCTGG - Intergenic
1021777533 7:24068294-24068316 GTACAGTGGAGGAATGGCCAAGG + Intergenic
1022497877 7:30864643-30864665 GTGCAGCCCAGGCCTGGCCACGG - Intronic
1023064795 7:36366889-36366911 GTGCCGGGAAGGGCTGGCCGCGG - Intronic
1023848252 7:44135468-44135490 GGGCCCTGCAGGCCTGGCCAGGG + Intergenic
1023992069 7:45134384-45134406 GAGCCATGGGGGCCAGGCCAGGG + Intergenic
1025611389 7:63078037-63078059 GTTCCCAGGAGGACTGGCCATGG + Intergenic
1025789846 7:64679486-64679508 GTGCAGTGGATGAGTGGCCAAGG - Intronic
1026217815 7:68365126-68365148 GTGCCTGGCAGGCATGGCCATGG + Intergenic
1026734547 7:72941388-72941410 GTGCCGTGAAGGCCTGGGCCGGG - Intronic
1026784881 7:73296296-73296318 GTGCCGTGAAGGCCTGGGCCGGG - Intergenic
1027109196 7:75423634-75423656 GTGCCGTGAAGGCCTGGGCCGGG + Intronic
1028892314 7:96002099-96002121 CTGCTGTGAGGGCCTGGCCATGG - Intronic
1029491960 7:100875458-100875480 GGGCCGCGGAGGGCTGGCCTTGG + Intronic
1029605605 7:101597893-101597915 GTGGCCTGGAGCTCTGGCCAGGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1034536710 7:151729849-151729871 ATGCCGTGGAGGCAGGGCGAGGG - Intronic
1034876930 7:154732977-154732999 GTGCCATGGAGTCCAGGCGAGGG - Intronic
1035333942 7:158113818-158113840 GTGCCTCGAAGTCCTGGCCAAGG - Intronic
1038182580 8:25242899-25242921 GTGCCATGGAAGCCAGGACATGG + Intronic
1038893558 8:31755101-31755123 GAGCAGTGCAGGCCTGTCCAGGG - Intronic
1039398377 8:37247026-37247048 GTACCACGGAGGGCTGGCCAGGG + Intergenic
1039449640 8:37661686-37661708 GTGTTGTGGAGGCCTGCCTATGG - Intergenic
1039885869 8:41653739-41653761 GCGCCCTGGAGGCCGGGCCGGGG + Intronic
1048238408 8:132715994-132716016 CAGCAGGGGAGGCCTGGCCAGGG + Intronic
1049288375 8:141788778-141788800 GTGCAGGGCAGGCATGGCCAGGG + Intergenic
1049374419 8:142282175-142282197 GGAACGTGCAGGCCTGGCCAGGG - Intronic
1049429331 8:142551899-142551921 GTGAGGTGGAGGCCAGGCCATGG + Intergenic
1049431376 8:142566859-142566881 CTGCCCTGGCAGCCTGGCCAAGG + Intergenic
1049563597 8:143325739-143325761 GGGCCGGGGAGTCCAGGCCATGG - Intronic
1053169353 9:35867803-35867825 GTACCATGGAGGCCAGGGCAAGG + Intergenic
1056630567 9:88289699-88289721 CTGCCGTGCAGGCCTGGGGAGGG - Intergenic
1057819223 9:98318490-98318512 GTCCTGTGCAGGGCTGGCCAGGG + Intronic
1060414647 9:123421778-123421800 GGCTCGTGGTGGCCTGGCCAAGG - Intronic
1060829143 9:126702895-126702917 CTGGCGTGGTGGCCAGGCCATGG - Intergenic
1060972243 9:127744920-127744942 GTGACGGGGAGGCCTTGCCAAGG + Exonic
1061393406 9:130330255-130330277 CTGCCGTGGAGCCCTGTCCTTGG - Intronic
1061988233 9:134142902-134142924 GTGCAGTGGAGGGATGGCGAGGG + Intronic
1062041523 9:134406593-134406615 GAGCCCTGGAGGGCTGGGCAGGG + Intronic
1062052970 9:134456962-134456984 GAGCCCTGAGGGCCTGGCCATGG - Intergenic
1062120243 9:134830188-134830210 GTGCCGAGGTGGCCGGGCCGAGG - Intronic
1062264975 9:135682899-135682921 GGGCTGTGGACGCCTGGGCAGGG - Intergenic
1062310225 9:135931429-135931451 GTGCCGCCGAGGCCTTCCCAGGG - Intergenic
1062346562 9:136117994-136118016 CTGCCGTGGGGACCTGGCCAGGG + Intronic
1062488493 9:136792692-136792714 GGGCAGTGGAGGCCAGGCCTGGG - Intronic
1062718177 9:138021600-138021622 GTGCAGTTGGGGTCTGGCCAAGG + Intronic
1186792993 X:13017079-13017101 GTTCCAAGGAGGCCTGGCAATGG - Intergenic
1190053777 X:47170460-47170482 GTGTGGTGGAGGACTGGCCAAGG + Intronic
1191184244 X:57592605-57592627 GTGTGGTGGGGGCGTGGCCAGGG - Exonic
1191213149 X:57909854-57909876 GTGTGGTGGGGGCGTGGCCAGGG + Exonic
1198560934 X:137849339-137849361 GTGGAGTGGAGGGCTGGTCAGGG - Intergenic
1199606645 X:149584229-149584251 GTGTCGGGGAGGGCTGGCCTTGG - Intronic
1199632478 X:149785139-149785161 GTGTCGGGGAGGGCTGGCCTTGG + Intronic
1199932768 X:152541089-152541111 GTGGGGTAGAGGCCAGGCCAAGG + Intergenic
1199975702 X:152893801-152893823 GTGCTCAGGAGGCCTGGCCTGGG + Intergenic