ID: 900625470

View in Genome Browser
Species Human (GRCh38)
Location 1:3606573-3606595
Sequence GGCTCCCGACAGCCCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900625465_900625470 17 Left 900625465 1:3606533-3606555 CCAGGTTTGCATGAGGGTTAGAT 0: 1
1: 0
2: 3
3: 7
4: 83
Right 900625470 1:3606573-3606595 GGCTCCCGACAGCCCTCAGGAGG 0: 1
1: 0
2: 2
3: 16
4: 163
900625464_900625470 22 Left 900625464 1:3606528-3606550 CCTTGCCAGGTTTGCATGAGGGT 0: 1
1: 0
2: 1
3: 10
4: 108
Right 900625470 1:3606573-3606595 GGCTCCCGACAGCCCTCAGGAGG 0: 1
1: 0
2: 2
3: 16
4: 163
900625468_900625470 -9 Left 900625468 1:3606559-3606581 CCTGCACAGAAAAGGGCTCCCGA 0: 1
1: 0
2: 2
3: 70
4: 1163
Right 900625470 1:3606573-3606595 GGCTCCCGACAGCCCTCAGGAGG 0: 1
1: 0
2: 2
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900625470 Original CRISPR GGCTCCCGACAGCCCTCAGG AGG Intronic
900422605 1:2562088-2562110 TGCTCCCCACATCCCACAGGGGG - Intronic
900595839 1:3479773-3479795 GCCTCCCGACAGCCCTGTGATGG + Intronic
900625470 1:3606573-3606595 GGCTCCCGACAGCCCTCAGGAGG + Intronic
901483098 1:9539586-9539608 GTCTCCCCGCTGCCCTCAGGGGG - Exonic
902359066 1:15932169-15932191 GGCGACCGCCATCCCTCAGGTGG - Exonic
902839948 1:19068282-19068304 GGCACCCCACACCCCTCAGGAGG + Intergenic
903164980 1:21514031-21514053 GGCTTGGGCCAGCCCTCAGGGGG + Intronic
903383981 1:22914978-22915000 GGCTCCTGAGTGCCCTCAGATGG + Intronic
910277424 1:85464530-85464552 GGCTGCCGGCAGCCTTCTGGAGG - Intronic
912109023 1:106317224-106317246 GGCTCCCTAAAGCCTTCAGAAGG + Intergenic
915021963 1:152787582-152787604 TGCTGCAGCCAGCCCTCAGGGGG + Exonic
916692927 1:167208564-167208586 GGCTCCAGACTGTCCTCTGGTGG + Intergenic
919763869 1:201114411-201114433 GGCTCCCGCTCGGCCTCAGGTGG - Exonic
919910287 1:202106825-202106847 GGCCCCCGACTGCCTTCAAGAGG - Intergenic
920375033 1:205503756-205503778 CTCTCCTCACAGCCCTCAGGAGG + Intergenic
920571802 1:207023199-207023221 GGCACCTGCCAGCCCCCAGGAGG - Exonic
922163338 1:223094512-223094534 CTCTCCCCACAGCCCTCAGAAGG - Intergenic
922701323 1:227762790-227762812 GGCTTCTGACAGCCTTCTGGAGG + Intronic
924619953 1:245651674-245651696 GACAGCCAACAGCCCTCAGGTGG - Intronic
924815635 1:247439355-247439377 GATTCCCCACAGCCCTCAGAAGG - Intronic
1070283751 10:75069211-75069233 GCCTCCCGGAAGCCCTGAGGAGG + Intergenic
1072544019 10:96420483-96420505 GGCTCCAGCCAGCTCTCAGATGG - Intronic
1072890116 10:99316220-99316242 GGCTCCCGCCAGGCCTCGGGTGG + Intergenic
1074571335 10:114626972-114626994 TTCTCCTGACAGCCCTCAGAAGG + Intronic
1076328165 10:129644557-129644579 GGCTCTCACCAGGCCTCAGGGGG - Intronic
1076365895 10:129920951-129920973 GGCTCACAACAGCCTTCTGGTGG - Intronic
1077165131 11:1131367-1131389 GGGTTCCTAGAGCCCTCAGGAGG - Intergenic
1077430468 11:2513611-2513633 GGCTCCCGACAGCAGGCGGGTGG - Intronic
1079009604 11:16817218-16817240 AGCACCCGACACCCCTCGGGGGG - Exonic
1079089773 11:17472733-17472755 GGCTGCTGACAGCCAGCAGGAGG + Intronic
1079574248 11:21983606-21983628 GGCTCCCATCAGCACTCAGATGG + Intergenic
1083539272 11:63500925-63500947 GGCCCATGACAGCCCTCAGGAGG - Intergenic
1083539421 11:63502069-63502091 GGCCCATGACAGCCCTCAGGAGG - Intergenic
1084182679 11:67454590-67454612 GGCACCCGGCAGCGCTAAGGCGG + Intronic
1084220647 11:67675519-67675541 GACTCTCTACAGCCCTCAGCAGG - Intronic
1085714813 11:78863009-78863031 GTCTCCCTATACCCCTCAGGGGG - Exonic
1089111898 11:116063774-116063796 GGTTCCCCTCAGCCCTCAGAAGG - Intergenic
1091091026 11:132771540-132771562 GGCTCCTGAGAGCCCCCACGAGG + Intronic
1091686591 12:2566928-2566950 GCCTTCCTACAGCCCTGAGGTGG + Intronic
1091796452 12:3300050-3300072 GGCTCCAGGCAGCCAGCAGGGGG + Intergenic
1093845385 12:23965009-23965031 AGCTCCCAGCAGCCCCCAGGGGG + Intergenic
1102230885 12:111261413-111261435 GGCTCCTGTGAGCCCTGAGGAGG - Intronic
1102838260 12:116088381-116088403 GGCTCTCAACAGCCCTCGGAAGG + Intronic
1104304150 12:127594201-127594223 GGCCTGTGACAGCCCTCAGGAGG + Intergenic
1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG + Intronic
1119159531 14:72441561-72441583 GGCCCTCGCCAGCCCTCAGCAGG + Intronic
1119428190 14:74549673-74549695 GGCTCCTGGCAGCCCTCTGCTGG - Intronic
1120190454 14:81435872-81435894 GCCTCCCGACACCCCGAAGGCGG + Intronic
1120701808 14:87706328-87706350 GGCTCCCCACATCTCTCATGTGG + Intergenic
1121137205 14:91509890-91509912 GGCGCCCGGCAGCCCCGAGGGGG + Exonic
1122647059 14:103201878-103201900 CCCTCCCCACAGCCCCCAGGTGG - Intergenic
1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG + Intergenic
1123476953 15:20597286-20597308 GGCTCCCATCTGCCCTTAGGTGG - Intergenic
1123641058 15:22403078-22403100 GGCTCCCATCTGCCCTTAGGTGG + Intergenic
1125507010 15:40272847-40272869 GGCCCCCGCCTGCCCCCAGGTGG + Exonic
1129126228 15:73443373-73443395 AGGTGCCCACAGCCCTCAGGAGG + Intronic
1132546805 16:536965-536987 GGCCCCCGGCACCCCTCACGGGG + Intronic
1132633602 16:931823-931845 GGCTCACGAGGGCTCTCAGGCGG + Intronic
1133209948 16:4258010-4258032 GGCTCCCTCCAGCCCCCAGAAGG + Exonic
1136181268 16:28554175-28554197 GGCTCCCGACCTCCCTGAGGCGG + Intronic
1136591075 16:31218092-31218114 GGCACACAACAGACCTCAGGGGG - Intronic
1136702669 16:32157938-32157960 GGCTCCCAGCAGACCTCAGTTGG + Intergenic
1136702684 16:32157992-32158014 GGCTCCCACCAGACCTCAGTTGG + Intergenic
1137597516 16:49734581-49734603 TGCTGCAGACAGCCCCCAGGAGG - Intronic
1137877056 16:52006889-52006911 GGCTCCCCACCACCCCCAGGTGG - Intronic
1138265386 16:55656427-55656449 GACTTCTGACAGCCCTCTGGGGG - Intronic
1138548873 16:57736214-57736236 GTCTCCCGATATCCCTCACGTGG - Intronic
1139528760 16:67531353-67531375 GGCTCACCACAGCGCTCTGGGGG - Intronic
1139901241 16:70330114-70330136 AGCTCCCCACAGGGCTCAGGAGG + Intronic
1139906091 16:70366907-70366929 AGCTCCCCACAGGGCTCAGGAGG + Intronic
1141089713 16:81121811-81121833 GGCCACAGCCAGCCCTCAGGGGG - Intergenic
1203067372 16_KI270728v1_random:1031729-1031751 GGCTCCCACCAGACCTCAGTTGG - Intergenic
1203067387 16_KI270728v1_random:1031783-1031805 GGCTCCCAGCAGACCTCAGTTGG - Intergenic
1142808556 17:2384687-2384709 TGGTCCCGACAGCACTCTGGGGG + Exonic
1143001483 17:3797937-3797959 GGCTCCCCACTGCCCTCAGCAGG + Intronic
1144810178 17:17993929-17993951 CACTCCCAACAGCCCTCAGCAGG - Intronic
1147340552 17:39751110-39751132 GGCTGCCGAGAGCCCTTAGAGGG + Intergenic
1148332760 17:46821899-46821921 GGCCCCCGCCCGCCCTCATGGGG + Intronic
1148700202 17:49582418-49582440 GGCCCCCGGCAGCCCCCAGCTGG - Intronic
1148853040 17:50563945-50563967 GACTCCCCACAGGCTTCAGGAGG + Intronic
1149540702 17:57466039-57466061 GGCTGCCCACACTCCTCAGGGGG - Intronic
1150227600 17:63532263-63532285 GGGTCCTAGCAGCCCTCAGGAGG + Intronic
1152121455 17:78421378-78421400 GACTCCTGCCAGCCCTCGGGAGG - Intronic
1152256590 17:79243573-79243595 GGCACCTGGCTGCCCTCAGGTGG + Intronic
1152484798 17:80583547-80583569 GGCTCCTGCCAGCCCTCAAGAGG - Intronic
1152653700 17:81509592-81509614 GTTTCCCCCCAGCCCTCAGGTGG - Intergenic
1152658118 17:81529380-81529402 GGGTCCCAGCACCCCTCAGGAGG - Intronic
1152863853 17:82710715-82710737 GGCTGCGGGCAGCCCTGAGGCGG + Intergenic
1153884421 18:9450757-9450779 GTCTTCCGACAGCCCTAAAGTGG + Intergenic
1156336320 18:36175673-36175695 GGCTGCCTCCAGCCCTCAGCTGG - Intronic
1157566592 18:48682797-48682819 GGGTCCCGACAGCCCTGGGCGGG + Intronic
1158210615 18:55045465-55045487 GGTTCACCACAGGCCTCAGGAGG + Intergenic
1160445231 18:78922347-78922369 GGGTGCCCACAGCCCACAGGTGG - Intergenic
1160743603 19:699485-699507 AGCTCCTGGCAGCCCTGAGGAGG + Intergenic
1160809689 19:1008016-1008038 GGCTCCCCACTGCCCCCAGGAGG - Intronic
1161066586 19:2241535-2241557 GTCTCCGGACGGCCCACAGGCGG - Intronic
1161340058 19:3736412-3736434 GGGTCTCGACAGTCCCCAGGTGG - Intronic
1162615472 19:11797627-11797649 GGCTCCAGACTGGCCTCAGCAGG - Intergenic
1163442329 19:17328371-17328393 GGCTCCCGGCAGCCCTGAACGGG - Exonic
1163483556 19:17573032-17573054 AGCTCCTGACTGTCCTCAGGGGG - Intronic
1165153491 19:33774079-33774101 GCATCCTGACAGCCCTGAGGTGG - Intergenic
1165391612 19:35542337-35542359 GGCTCCCGACAGCCCTCCAGGGG - Exonic
1165406090 19:35632265-35632287 GGCTCCCCAGTGCCCTCAGGAGG + Intronic
1166269800 19:41707009-41707031 GGCGGCCGACAAGCCTCAGGTGG - Intronic
1166269806 19:41707031-41707053 GGCAGCCGACAGGCCTCAAGTGG - Intronic
1166861297 19:45813040-45813062 GGCTCCCCATTGCCCACAGGGGG - Intronic
1167598532 19:50440108-50440130 GGCTCCCCACTGCCCTCAGGAGG - Intronic
1168249886 19:55135874-55135896 GGCTCCTGGAAGCCCTCTGGGGG - Intronic
925139823 2:1542455-1542477 GGCTGCCGAGAGCCCTCTGAGGG + Exonic
925763604 2:7209963-7209985 GGCTCCCCACCGCCCTCAGCAGG - Intergenic
928216359 2:29364637-29364659 GGCTCCAGACAGTGGTCAGGAGG + Intronic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
932355837 2:71068016-71068038 CGGTCCCGGCAGCCCTGAGGAGG - Intronic
932433739 2:71690950-71690972 GGTTCTCCACTGCCCTCAGGAGG + Intergenic
934608260 2:95714206-95714228 GGCTCCCCTCAGCTCTCAGATGG + Intergenic
935871498 2:107455669-107455691 GACTCCTTACAGCCCTCAAGTGG + Intergenic
936066595 2:109337288-109337310 GGCTCCCGGCAGCCCTGCTGTGG - Intronic
936541592 2:113356092-113356114 GGCTCCCCTCAGCTCTCAGATGG + Intergenic
938250828 2:129814318-129814340 GGCCCATCACAGCCCTCAGGGGG + Intergenic
938553204 2:132399647-132399669 GGATCCAGGCTGCCCTCAGGAGG + Intergenic
944154142 2:196593259-196593281 GGCTCCCGCCCGCGCTCGGGAGG + Intronic
945857140 2:215082403-215082425 GACTCCCACCAGCCCTCAGCTGG + Intronic
946229343 2:218282056-218282078 GGCTGCCCATAGCCCCCAGGGGG + Exonic
946622515 2:221573855-221573877 GGCTGCGGACAGCGCTCAAGAGG + Intronic
948206398 2:236164703-236164725 GCTTCCCGGCAGCCCTCAGTCGG - Intergenic
948225460 2:236306191-236306213 AGCACCCGACAGCCGTGAGGAGG - Intergenic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1172756202 20:37286516-37286538 GGCTCCTCACAGCCCTCAGAAGG - Intergenic
1173784953 20:45786131-45786153 GGCTCACGCCAGCCCTTGGGAGG + Intronic
1175731537 20:61357570-61357592 GGGACCAGACAGCCCCCAGGGGG + Intronic
1178478175 21:32956044-32956066 GGGTCCTGACAGCCCAGAGGGGG + Intergenic
1178704560 21:34862523-34862545 TCCTCCCTAGAGCCCTCAGGGGG - Intronic
1179358619 21:40684462-40684484 GCCTCCAGAAATCCCTCAGGCGG - Intronic
1179830126 21:43991503-43991525 GGCTCCTGACCGGCCTCAGCAGG + Intergenic
1180161129 21:45999200-45999222 GGGTCCCGAGGGCCCCCAGGTGG + Exonic
1181365191 22:22371099-22371121 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1181368375 22:22397464-22397486 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1182283529 22:29231449-29231471 GGCTCCTGGCAGCCCTGGGGTGG - Intronic
1184422260 22:44389136-44389158 GGCTGGCAACAGCCCCCAGGTGG + Intergenic
1185132419 22:49046714-49046736 GGCTCCCCACCGCCCTCTGGAGG - Intergenic
1185189395 22:49424802-49424824 GGCTCCACACAGCCCTGAGCGGG - Intronic
955230352 3:57093661-57093683 GGCCCAAGACAGCCCTCTGGAGG + Exonic
956011715 3:64838756-64838778 GGGGCCAGACAGCTCTCAGGAGG + Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
960992619 3:123321843-123321865 GGCTCCCTGGAGCCCTCAGCTGG - Intronic
961202542 3:125056039-125056061 GGCCCCCGGCAGCCCTCCCGCGG - Intergenic
961562498 3:127740474-127740496 GGGTCCCGGCAGTCCTCAGAGGG - Intronic
968452654 4:682507-682529 AGCTCTTGACAGCCCTGAGGGGG + Intronic
968576350 4:1367998-1368020 GGCTCTTGGCCGCCCTCAGGTGG + Intronic
969870028 4:10098832-10098854 GGCTGCAGCCAGCCCTCACGGGG + Intronic
975816514 4:78222671-78222693 GGCTGCAGACAACCCACAGGTGG - Intronic
985633914 5:1026834-1026856 GCCTCCCGAGTGCCCTGAGGTGG + Intronic
988927516 5:36004399-36004421 GGCCCATGACAGCCCTCAGGAGG - Intergenic
992944165 5:81793552-81793574 GGCCCTCGACAGCCATGAGGAGG + Intergenic
1001587654 5:172844449-172844471 GGCTATCGTCAGCCCTCAGAAGG - Intronic
1001812330 5:174638455-174638477 TGTTCCTGACAGCCCACAGGTGG + Intergenic
1002341043 5:178516728-178516750 GGCACCCGCCAGGCCTGAGGAGG - Intronic
1003429337 6:6024687-6024709 TGCTCCTCACAGCCCTCAGAAGG - Intergenic
1007324296 6:41048489-41048511 GGCACCAGACACCCCTCTGGAGG - Intronic
1007337056 6:41161600-41161622 GGCTCCGGACAGCTCTGGGGAGG + Exonic
1007740385 6:44006198-44006220 GGGTGCCGACAGCTCTAAGGAGG + Intergenic
1019412018 7:910889-910911 GGCTCCTGCCCTCCCTCAGGAGG + Intronic
1019459982 7:1152752-1152774 TGCTCCCCGCAGCCCTCAGAAGG + Intronic
1019558205 7:1642816-1642838 GACTCCCGGCAGACATCAGGAGG + Intergenic
1024250976 7:47505476-47505498 CGCTCCACACAGCCCCCAGGAGG + Intronic
1024465429 7:49707148-49707170 GGCTCCCAGCTGCACTCAGGAGG - Intergenic
1024473873 7:49790683-49790705 GGCACCTCCCAGCCCTCAGGGGG + Intronic
1026583110 7:71634206-71634228 GGCTCCACACGGCCCTTAGGAGG - Intronic
1028056569 7:86252602-86252624 GGCTCCAGAAAGCCCTTAGCAGG + Intergenic
1029281553 7:99438936-99438958 CGCTCCCGGCATCCCTCGGGCGG + Intronic
1039735307 8:40324994-40325016 GGCTTCCTACTGCCCTCAGAAGG + Intergenic
1041724230 8:61003377-61003399 GGCTCCTGACAGGCCAAAGGTGG - Intergenic
1049574552 8:143384287-143384309 GGGTCTCGACAGGCCACAGGAGG - Intergenic
1052040515 9:23733619-23733641 TGCCCCAGACAGACCTCAGGAGG - Intronic
1056377593 9:86029381-86029403 AGCTGCAGACAGCTCTCAGGAGG - Intronic
1056532263 9:87498059-87498081 GGCCTCCGACAGCGCTCCGGAGG + Exonic
1056795475 9:89655934-89655956 GGCCCCCGACACCCCTCAGAGGG + Intergenic
1060775584 9:126371422-126371444 GGCTCCCTTCGGCCATCAGGAGG + Intronic
1061678621 9:132231771-132231793 AGCACCCCACAGCCCACAGGTGG + Intronic
1062138053 9:134940070-134940092 AGCTCCCATCAGCCCACAGGGGG + Intergenic
1192325503 X:70128528-70128550 GGCTCCCCACAACCTGCAGGCGG + Intergenic
1195328100 X:103774410-103774432 GGCTCCCTACAGACCTCATAGGG - Intronic