ID: 900625543

View in Genome Browser
Species Human (GRCh38)
Location 1:3606965-3606987
Sequence CAGGCTGCACAGCAGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 549}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900625543_900625551 25 Left 900625543 1:3606965-3606987 CCTGGGGCCTGCTGTGCAGCCTG 0: 1
1: 0
2: 4
3: 59
4: 549
Right 900625551 1:3607013-3607035 CAATTCAGCATCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 206
900625543_900625548 17 Left 900625543 1:3606965-3606987 CCTGGGGCCTGCTGTGCAGCCTG 0: 1
1: 0
2: 4
3: 59
4: 549
Right 900625548 1:3607005-3607027 TGAGCCCTCAATTCAGCATCTGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900625543 Original CRISPR CAGGCTGCACAGCAGGCCCC AGG (reversed) Intronic
900145290 1:1156581-1156603 CAGGCTGCAGATCAGGCTCCCGG + Intergenic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
900796926 1:4713575-4713597 CAGGCTTCACAGCAGGCCTGCGG + Intronic
900851873 1:5150196-5150218 CAGGCTGCACAGCAAGGACATGG - Intergenic
901035865 1:6335698-6335720 CAGGCTCCAAATCAAGCCCCAGG + Intronic
901084566 1:6602743-6602765 CAGGCCGCGCAGCAGGCTCAGGG + Exonic
901259558 1:7861607-7861629 CAGCCTCCGCAGCAGGCCCCAGG + Intergenic
901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG + Intronic
901630032 1:10643506-10643528 CAGGCTGGAGAGGAGGCCCAGGG - Intronic
901794397 1:11672112-11672134 CACTCTGCACAGCAGTGCCCTGG + Intronic
902943145 1:19814805-19814827 CAGGCTGCAGATGAGGCCCCCGG + Exonic
902963970 1:19984713-19984735 CAGCCTGCCCTGCCGGCCCCAGG - Intergenic
902981967 1:20130516-20130538 CAGGTTGCACTGCAGTCCACTGG + Intergenic
902988030 1:20167416-20167438 GAGGCTGCACCCCAGGCTCCTGG - Intronic
903366558 1:22808940-22808962 CAGGATGCCCAGCAGCCCGCAGG - Intronic
903457478 1:23497710-23497732 AAGGCTGCACAGCAGGCAGAAGG - Intergenic
903649531 1:24914378-24914400 CAGGCCGCAGAGCCGGCCTCGGG - Intronic
903701972 1:25255933-25255955 CAGGCCGCACAGCAGGAGGCAGG - Intronic
903772510 1:25772777-25772799 CAGGGTGATCAGCAGGGCCCAGG - Intronic
903952429 1:27004178-27004200 AATGCTGCAGAGGAGGCCCCAGG - Intergenic
904001073 1:27339115-27339137 CAGGGAGCACAGAAGGCCCAGGG + Intergenic
904012891 1:27399773-27399795 CAGGCTGGAAAACAGGCTCCCGG + Intergenic
904358087 1:29954395-29954417 AAGGCTACACAGCAGGTCACTGG - Intergenic
904469807 1:30729348-30729370 CCAGCTGCACTGCAGGCTCCTGG - Intergenic
904873549 1:33636390-33636412 CGGGCTTCCCATCAGGCCCCAGG + Exonic
904892464 1:33789500-33789522 CAGCCTGCACAGGGGACCCCTGG - Intronic
905140758 1:35842208-35842230 CAGGCTGCACAGCAGGTGAGTGG + Intronic
905455169 1:38083654-38083676 CAGCCTGCACAGCAGGGCGGGGG - Intergenic
907426721 1:54384381-54384403 CAGACTGCACAGAGGGGCCCTGG + Intronic
907905684 1:58782566-58782588 CAGCCTGCACAGCGAGCCGCCGG - Exonic
908879175 1:68711148-68711170 CAGGCTGTATAGGAGGCCTCAGG - Intergenic
910243094 1:85109579-85109601 CAGGATGCAGTGCAGGCCCAGGG + Intronic
911142881 1:94524760-94524782 AAGGCTGGACAGGAGGCTCCTGG + Intergenic
912314690 1:108657150-108657172 CAGGCTGTAGTGCAGGGCCCTGG - Intronic
913110588 1:115654063-115654085 CAGGCATGAGAGCAGGCCCCAGG + Intronic
914000832 1:143692753-143692775 CAGGCTACACTGCAGGGCCTGGG + Intergenic
914490783 1:148149006-148149028 CAGGCTCCACACCAGTCCCGAGG - Intronic
914510796 1:148330115-148330137 CAGGCTGGACTGCAGGGCCTGGG + Intergenic
914513641 1:148355025-148355047 CAGGCTGGACTGCAGGGCCTAGG + Intergenic
914685992 1:149980297-149980319 CAGGGTCCACAGCATGCACCTGG - Intronic
915724563 1:158008283-158008305 TGGGCTGCCCAGCAGGCCCCAGG + Intronic
918093867 1:181318603-181318625 CGGGCGGCTCAGCAGGTCCCCGG + Intergenic
918480722 1:184974265-184974287 CAGGGTGCTCCCCAGGCCCCCGG + Intronic
919817247 1:201449197-201449219 CAGGCTGCCCAGCAGGACAAGGG - Intergenic
920007678 1:202845248-202845270 CAGGCTGCCCAGAGTGCCCCAGG + Intergenic
920183928 1:204149056-204149078 CAGGCTCCACAGCATTCCCAGGG + Intronic
920632842 1:207669468-207669490 CCGGCTGCCCAACAGGCTCCCGG - Intronic
920914784 1:210251348-210251370 GAGGATGCCCTGCAGGCCCCGGG + Intergenic
921389753 1:214606212-214606234 CAGGCTCCACACCAGTCCCGAGG + Intronic
924786369 1:247203633-247203655 CAGGATGAACAGCAGGCTGCTGG + Intergenic
1062783069 10:234302-234324 CAGGCTGGTCAGCAGGGCTCAGG + Intronic
1063130642 10:3173729-3173751 AAGGCTGCATGGCAGGTCCCAGG + Intergenic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1063655148 10:7980836-7980858 CAGGTGGCAAAGCAGGCACCAGG + Intronic
1064199688 10:13274070-13274092 CAGGCTGCCCAGGAGCCTCCAGG - Intergenic
1064746117 10:18479785-18479807 CAGGCTTAACAGGAGGCCTCAGG - Intronic
1064790369 10:18951540-18951562 CAGGCAGCCCTGCTGGCCCCAGG - Intergenic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1067058687 10:43066681-43066703 GAGGCTGGTCACCAGGCCCCAGG - Intergenic
1067378861 10:45753964-45753986 CAGCCCGCACAGCAGGCACAAGG - Intronic
1067439450 10:46300406-46300428 CAGGCTGGATAGGAGGCCCAGGG - Intronic
1067886564 10:50094626-50094648 CAGCCCGCACAGCAGGCACAAGG - Intronic
1068160365 10:53254664-53254686 CAGGCTGCACTGGAGGCACATGG - Intergenic
1068779429 10:60903647-60903669 CAGGCTGAGAAACAGGCCCCTGG + Intronic
1070644994 10:78195547-78195569 TGGGCTGCACAACAGGCGCCTGG + Intergenic
1070774879 10:79103680-79103702 CATGGGGCACACCAGGCCCCAGG + Intronic
1070942569 10:80359751-80359773 CGGCCAGCACTGCAGGCCCCAGG - Intronic
1073511614 10:104046073-104046095 GAGGCTGCTCTGCAGGCTCCAGG - Intronic
1075096291 10:119473781-119473803 CAGGCAGCACAGCAGGGCTGCGG - Intergenic
1075209147 10:120476196-120476218 CAGGGGGCACAGCTGGCCCCAGG - Intronic
1076299114 10:129411386-129411408 AAGGCTGCACTGCAGGTACCAGG - Intergenic
1076323050 10:129598015-129598037 CTGACTGCAGAGCAGGCCCAGGG - Intronic
1076402693 10:130194205-130194227 CCTGCTGCCCTGCAGGCCCCTGG + Intergenic
1076528123 10:131125641-131125663 CAGGGTGGGCTGCAGGCCCCTGG + Intronic
1076644515 10:131943468-131943490 CAGGGTGCACAGCAGGGTGCTGG - Intronic
1076680535 10:132169198-132169220 CACGCTCCACACCAGCCCCCAGG - Intronic
1076706090 10:132302423-132302445 CAAGCTGCACAGCTGCCCCAAGG + Intronic
1076852917 10:133101793-133101815 CAGGAGACACAGCAGCCCCCGGG - Intronic
1076866166 10:133167448-133167470 CAGGCTGCACTCCAGGCACACGG - Exonic
1077036173 11:495565-495587 CAGGCCGGACAGCAGGGCCAAGG + Intronic
1077050467 11:564153-564175 CAGGGTGCTCAGTAGGGCCCAGG + Intergenic
1077112433 11:867765-867787 CCGCCTCGACAGCAGGCCCCAGG - Intergenic
1077119849 11:901870-901892 CAGCCGGCAGAGCAGGCCCATGG - Intronic
1077124520 11:926350-926372 CAGGATGCAGAGCGGGGCCCTGG + Intronic
1077216560 11:1397567-1397589 CAGCCTGCAGCCCAGGCCCCTGG - Intronic
1077220886 11:1415679-1415701 AAGGGGGCAGAGCAGGCCCCGGG - Intronic
1077228798 11:1449629-1449651 CAGGGTGTGCAGCAGGACCCAGG + Intronic
1077877572 11:6320677-6320699 CAGGCTTCCCAGCAGGCCCCCGG - Intergenic
1078619509 11:12893988-12894010 CAGGCTGCCCAGCCTGCCCTGGG + Intronic
1079078424 11:17397521-17397543 AAGGCTGACCAGCAGGCCCCAGG - Intronic
1079098014 11:17523322-17523344 CAGAGAGCACAGAAGGCCCCAGG + Intronic
1079129056 11:17737080-17737102 CAAGCTGCCCAGCAGGCCTCAGG - Intronic
1081802239 11:45867993-45868015 CAGGCAGAAAAGCAGGCCTCAGG + Intronic
1082773891 11:57231011-57231033 CATGCTTCAGAGCAGGCTCCAGG + Intergenic
1082834190 11:57639836-57639858 AAGGCTGCACAGCAAGCTTCAGG - Intergenic
1083322730 11:61857302-61857324 CAGCCTTCTCTGCAGGCCCCGGG + Intronic
1083632047 11:64100830-64100852 CAGGAGGCTCTGCAGGCCCCAGG + Intronic
1083714208 11:64566525-64566547 AAGGTTGCAGAGCCGGCCCCTGG - Intronic
1083815631 11:65130880-65130902 GAGCCTGCACAGCAGGGCACAGG - Intronic
1083855425 11:65390780-65390802 CAGGCTGCCCAGCAGGCTCTGGG - Intronic
1084121554 11:67071860-67071882 CAGGCTGCACAGGCGGCTCCAGG - Exonic
1084273996 11:68042718-68042740 CTGGATGCGCAGCAGGTCCCGGG - Exonic
1084357599 11:68650357-68650379 CCTGCTGCACACCAGGCCCTGGG + Intergenic
1084407044 11:68980110-68980132 CAGGCTGCCCACCAGGTCCCTGG - Exonic
1084476757 11:69393806-69393828 CAGGGTGGGCAGCTGGCCCCAGG + Intergenic
1084778883 11:71396083-71396105 CTGGCCCCACAGCAGGCCCACGG + Intergenic
1085025919 11:73236589-73236611 CAGGCTGGACAGCTGACTCCAGG + Intergenic
1085259396 11:75195694-75195716 CAGGCTGCAGAGGAGGCCAAAGG - Intronic
1086871947 11:92048596-92048618 CTGGCTGCAAAGTGGGCCCCAGG - Intergenic
1087008642 11:93493217-93493239 CAGACTGCACAGAAGCCTCCAGG + Intronic
1087503701 11:98993554-98993576 CAGGCTGGTCATTAGGCCCCTGG + Intergenic
1087899347 11:103623100-103623122 CAAGCTGGACAACAGGCCACTGG + Intergenic
1088693327 11:112345997-112346019 CAGTCTCCACAGCAGGCCAGAGG + Intergenic
1090183580 11:124721458-124721480 AAGGCTGCACAGCAGGAAACTGG - Intergenic
1091106012 11:132920567-132920589 CAGGGTGCACACATGGCCCCAGG + Intronic
1091898002 12:4120243-4120265 CCTGCTGCACAGCAGCCTCCTGG - Intergenic
1093465093 12:19440298-19440320 CAAGCTGCCCCGCCGGCCCCCGG - Exonic
1093926117 12:24910030-24910052 CAGACTGCTCAGCCGGGCCCAGG + Intronic
1093981072 12:25476385-25476407 GAGGTTGCAGAGCAGGCCTCAGG + Exonic
1094070412 12:26406732-26406754 CATGCTGCACAACAAACCCCAGG + Intronic
1094169714 12:27479285-27479307 TAGGCTGCTCCTCAGGCCCCTGG + Intronic
1095715750 12:45344416-45344438 CAGGCTGTACAGGAGGCCTCAGG + Intronic
1096434415 12:51576605-51576627 CAGGGTGCGCAGTAGGCCCTAGG + Intergenic
1096512921 12:52141726-52141748 CAGGCAGCAGAGCGGGACCCTGG + Intergenic
1096844954 12:54401381-54401403 CATGGTGGACAGCAGGTCCCAGG + Exonic
1097128953 12:56796101-56796123 CAGGCAGCCCTGCTGGCCCCGGG - Intergenic
1097250277 12:57628678-57628700 CAGGCTGAACGGCAGGCCAGAGG - Intronic
1098803123 12:74986159-74986181 CAGGCAGCACTGCACGCTCCAGG - Intergenic
1101593139 12:106139955-106139977 CGGGTTGCTCAGCAGGCCCGGGG - Exonic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1104747849 12:131221247-131221269 CTGGCTGTCCACCAGGCCCCTGG - Intergenic
1105215634 13:18283017-18283039 CTGCCTTCACAGCAGCCCCCAGG + Intergenic
1105605169 13:21920927-21920949 CCGGCTGCCCCGCCGGCCCCAGG - Intergenic
1105751399 13:23425164-23425186 CAAGGTGAACAGGAGGCCCCAGG - Intronic
1106304033 13:28494802-28494824 CAGCGCGCACAGCAGGACCCCGG + Exonic
1106449810 13:29870156-29870178 CTGGCTCCCCAGCAGGCCTCTGG - Intergenic
1106553601 13:30791679-30791701 CTGGCTCCCCAGCAGGCCCTCGG - Intergenic
1107800971 13:44107692-44107714 CATGCTGCACAGCAGGCTCAGGG + Intergenic
1108349779 13:49581427-49581449 CAGAAAGCACAGCAGGCCTCAGG + Intronic
1111396386 13:87673059-87673081 CAGGCCGCACCGGAGGCTCCGGG - Intronic
1113231645 13:108218624-108218646 CAGGCTGCGCAGTCGGCCGCGGG - Exonic
1113312133 13:109141273-109141295 CAGGCCTCTCAGCAGCCCCCTGG + Exonic
1113424698 13:110198476-110198498 CAGGCTGCCCAGGGGGCCCAGGG + Exonic
1113567807 13:111329210-111329232 CAGCCTGCACAGCACGCCCTCGG + Intronic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1114629709 14:24151254-24151276 CTGGCTGGACAGCAGGACCCTGG + Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1118839759 14:69501505-69501527 CAGGCTGCAAAGTGGGCCACTGG - Intronic
1118864698 14:69693767-69693789 AAGGCTGCAGAGCAGGCCCCTGG + Intronic
1120119591 14:80663121-80663143 CAGTCTTCACTACAGGCCCCGGG + Intronic
1120915436 14:89706208-89706230 CAGGCTGTACAGAAGGCCTCAGG + Intergenic
1121227003 14:92328453-92328475 CAGGCTACACAGAAGGACACCGG - Intronic
1121320166 14:92987482-92987504 ATGGCTGCACAGGTGGCCCCTGG + Intronic
1121605193 14:95235487-95235509 CAGGCTCCACCACAGACCCCAGG + Intronic
1121732394 14:96195514-96195536 CAGGCTGCAGACCAGGGCACTGG + Intergenic
1121733281 14:96201333-96201355 CAGGCTGTGCAGGAGGCCTCTGG + Intergenic
1122476712 14:102015230-102015252 CAGGCTGCGCAGCATCCCGCTGG + Exonic
1122479944 14:102040609-102040631 CTGGCTGGACAGCAGCTCCCCGG + Exonic
1122481312 14:102049285-102049307 CAGGCTGCACTTTATGCCCCTGG - Intronic
1122622885 14:103069921-103069943 CAGGCTGTACACCAGGACACAGG + Intergenic
1122719382 14:103713681-103713703 AAAGCTACACAGCAGGTCCCAGG - Intronic
1122784608 14:104157949-104157971 AAGGCTGCCCAGGAAGCCCCAGG - Intronic
1122786817 14:104167797-104167819 CTGGCTGCAGAGCAGGCCGAGGG - Intronic
1122794684 14:104200229-104200251 CAGGCTGCACAGTAGGCAGATGG - Intergenic
1122809769 14:104282138-104282160 CACGTTGCAGAGCAGGCTCCAGG - Intergenic
1123114325 14:105887068-105887090 CCTGCTCCACATCAGGCCCCAGG + Intergenic
1123116486 14:105896483-105896505 CTTGCTCCACATCAGGCCCCAGG + Intergenic
1123118535 14:105905731-105905753 CTTGCTCCACATCAGGCCCCAGG + Intergenic
1123120762 14:105915355-105915377 CCTGCTCCACATCAGGCCCCAGG + Intergenic
1202896833 14_GL000194v1_random:15236-15258 CAAGATGAACACCAGGCCCCTGG + Intergenic
1123739964 15:23226523-23226545 CAGGCTCCACAGCAGTCCCAAGG + Intergenic
1124055853 15:26240488-26240510 CAGGCCCCACACCAGGCCCACGG - Intergenic
1124126518 15:26942353-26942375 CACCATGCACAGCAGGCTCCAGG + Intronic
1124291188 15:28455491-28455513 CAGGCTCCACAGCAGTCCCAAGG + Intergenic
1124375563 15:29126888-29126910 CTGGCTGCACTCCAGGCCCGGGG - Intronic
1124880206 15:33635176-33635198 CAGGAGGCACAGTAGGCCACAGG + Intronic
1125727813 15:41877018-41877040 CAGGCTGGGCAGGAGGCCCCTGG - Intronic
1127973070 15:63977376-63977398 CAGTCTGCAGAGCAGACCCAGGG - Intronic
1128732295 15:70029464-70029486 CATCCTGCACAGCTGGGCCCAGG + Intergenic
1129034652 15:72641916-72641938 CAGGCTCCAGAGGGGGCCCCGGG - Intergenic
1129157465 15:73727794-73727816 CCGGAAGCCCAGCAGGCCCCAGG - Intergenic
1129215230 15:74095300-74095322 CAGGCTCCAGAGGGGGCCCCGGG + Intergenic
1129732379 15:77939645-77939667 CAGGCTCCAGAGGGGGCCCCGGG + Intergenic
1129740441 15:77987180-77987202 CTGGCAGCACAGCACGCCCCAGG + Intronic
1129907128 15:79196190-79196212 CAAACTGCACAGCTGGCTCCAGG + Intergenic
1130256532 15:82328443-82328465 CTGGCAGCACAGCATGCCCCAGG + Intergenic
1130330581 15:82919044-82919066 CAGGGTGCAGAGCAGGGCCTGGG + Intronic
1130531209 15:84748766-84748788 CAGGCTGCAGGGCCGGGCCCCGG - Intronic
1130598420 15:85261545-85261567 CTGGCAGCACAGCATGCCCCAGG - Intergenic
1131300195 15:91192864-91192886 GAGCCTGCACAGCAGGTGCCTGG - Intronic
1131721190 15:95170589-95170611 CAGGCAGGGCAGCAGGTCCCGGG + Intergenic
1131846071 15:96491906-96491928 CAGGCCGCACAGGAGCCCCCGGG + Intergenic
1132204295 15:99975996-99976018 CAGGAGACACAGCAGCCCCCTGG + Intronic
1132314017 15:100878150-100878172 CAGTGTGTGCAGCAGGCCCCAGG - Intronic
1132400492 15:101502045-101502067 CAGGCTGCACTGTTGCCCCCTGG + Intronic
1202955204 15_KI270727v1_random:71843-71865 CAGCCTGCGCAGCAGGCACTCGG + Intergenic
1132549164 16:547294-547316 CACGCTGCACAACACGCCCGTGG + Exonic
1132748754 16:1447711-1447733 CAGGCTGCAAGACAGGCCCGCGG + Exonic
1132797507 16:1732510-1732532 CAGGCTCCACGGCACGCCCCTGG - Intronic
1132809613 16:1791238-1791260 CAAGCTGCACAGCCTGCACCTGG - Exonic
1133023299 16:2976375-2976397 GACGCTGCACAGCTGGCGCCAGG + Intronic
1133111091 16:3548783-3548805 GAGGCTTCACAGCCGGCCCCCGG - Intronic
1133295251 16:4748800-4748822 CAGGCAGCACAGTAGGGCGCCGG + Exonic
1133337346 16:5014754-5014776 GATGCTGCAAATCAGGCCCCAGG - Intronic
1133417213 16:5616162-5616184 CAGGCTGCTCTGCCGTCCCCTGG + Intergenic
1134135241 16:11673044-11673066 CAGGCACCCCAGCAGGCCCTGGG + Intronic
1134507585 16:14820796-14820818 AACGCTGCCCAGCAGGCCTCCGG - Intronic
1134695283 16:16219558-16219580 AACGCTGCCCAGCAGGCCTCCGG - Exonic
1134976549 16:18575128-18575150 AACGCTGCCCAGCAGGCCTCCGG + Intergenic
1135091864 16:19523927-19523949 CAGGCTGCAACGCGGGCTCCTGG - Exonic
1135391747 16:22099645-22099667 CAGACAGCCCAGCAGGCCTCAGG + Intronic
1135804934 16:25534270-25534292 CAGGCTGCACAGCAGGTGAGTGG - Intergenic
1136754949 16:32674860-32674882 GAGGCTCCACAGCAGCTCCCAGG + Intronic
1136813164 16:33195509-33195531 GAGGCTCCACAGCAGCTCCCAGG - Intronic
1136819640 16:33305589-33305611 GAGGCTCCACAGCAGCTCCCAGG - Exonic
1136826203 16:33362124-33362146 GAGGCTCCACAGCAGCTCCCAGG - Intronic
1136831269 16:33460895-33460917 GAGGCTCCACAGCAGCTCCCAGG - Exonic
1137338291 16:47572782-47572804 CAGGCTGCTCAGGAGGCCTTGGG - Intronic
1138647541 16:58435976-58435998 CTGGCTGCTCACCAGCCCCCTGG - Intergenic
1139051472 16:63129733-63129755 CAGCCAGCACCGCGGGCCCCAGG + Intergenic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1139436473 16:66939504-66939526 CAGACTGGGCAGCTGGCCCCTGG + Intronic
1140412212 16:74748068-74748090 CAGGCCACACAGATGGCCCCGGG + Intronic
1140964938 16:79956616-79956638 CAGTCTGCATAGCTGGCCTCAGG + Intergenic
1142005773 16:87689022-87689044 CTGGCTGCAGAGCTGGCCCCTGG + Intronic
1142125859 16:88409967-88409989 CAGGGTGCGCAGCAGAGCCCAGG + Intergenic
1142141016 16:88472897-88472919 CAGGCGGGGCAGCAGGCCCAGGG + Intronic
1142359559 16:89619738-89619760 CAGGGGGCACAGCAGGCTGCAGG - Intronic
1202991740 16_KI270728v1_random:18479-18501 GAGGCTCCACAGCAGCTCCCAGG - Intergenic
1142482255 17:226269-226291 CAGGTGACACAGCAGGCGCCAGG + Intronic
1142747481 17:1967113-1967135 CAGGCCCCTCTGCAGGCCCCAGG + Intronic
1142968436 17:3595422-3595444 CAGACTCCACAGCAGGGCCTGGG + Intronic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1143670533 17:8393033-8393055 CAGGCTGGGCAGCAGGTCCAGGG + Exonic
1144302847 17:13939048-13939070 CTGGCTGCTCAGCAGCCCCCAGG + Intergenic
1144661942 17:17076581-17076603 GAGGCTGCACATAAGGCCCTTGG + Intronic
1144769961 17:17754108-17754130 CAGGCTGCACAGCTGGCCAGTGG - Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1145191364 17:20843602-20843624 CAGGCTCCACACCAGTCCCGAGG - Intronic
1145250912 17:21296592-21296614 CAGGCTGCACAGCAAGTCAGGGG - Intronic
1145815702 17:27793638-27793660 CAGCCTGCACAGCCGGGGCCCGG + Intronic
1147323480 17:39659406-39659428 CATGGTGGACTGCAGGCCCCAGG + Intronic
1147323669 17:39660305-39660327 CAGACAGCACAGGAGGCTCCAGG + Intronic
1147791300 17:43015771-43015793 AAAGCAGCACAGCAGGCCCGGGG + Exonic
1148384336 17:47223316-47223338 GAGCCTGTACAGGAGGCCCCAGG - Intronic
1148820527 17:50357065-50357087 CACGCTGGACGGCAAGCCCCTGG - Exonic
1148866334 17:50630695-50630717 CGGGCTGCTCAGCTGGCCCAAGG - Intergenic
1150003481 17:61456019-61456041 CAGGCTGGAGGGCAGGGCCCAGG - Intronic
1150212978 17:63451517-63451539 CAGGCTGCACATCAGCACGCAGG + Intergenic
1151344410 17:73492837-73492859 CAGGCGCCACGGCAGCCCCCAGG + Intronic
1151359909 17:73582621-73582643 CAGGCTGCCCAGCAGGGTCAAGG - Intronic
1151473120 17:74330236-74330258 CAGGCTGCACAGCTGGCAAATGG - Intronic
1151479536 17:74362028-74362050 CAGGCAGCACAATAGCCCCCGGG - Intergenic
1151542686 17:74772752-74772774 CAGGCTGCCCAGCCAGGCCCTGG + Intronic
1151787446 17:76281982-76282004 CAGGCTGGACAGGTGGCCTCAGG + Exonic
1151967620 17:77439659-77439681 CAGGCTGCCCACCAGCCTCCAGG - Intronic
1152243101 17:79170375-79170397 CAGGCTGGGCTGCAGGCCCCTGG - Intronic
1152252732 17:79220208-79220230 GCGGCTCCACAGCAGGCTCCCGG + Intronic
1152594950 17:81233465-81233487 CAGGCCGCACAGCACCCTCCAGG - Exonic
1152599195 17:81253009-81253031 CAGCCTGCAAAGGAGGACCCGGG + Intronic
1152611062 17:81315221-81315243 TGGGCTGCCCAGCTGGCCCCAGG + Intronic
1152619005 17:81352106-81352128 CGGGCTGCACAGGAGCCCACGGG + Intergenic
1152745574 17:82037205-82037227 ATGGCTGCGAAGCAGGCCCCGGG - Intronic
1152870852 17:82752300-82752322 CAGGCGGCCCAGCAGCGCCCGGG - Exonic
1154173186 18:12065612-12065634 CCTGCTGCACATCTGGCCCCAGG + Intergenic
1157328550 18:46686508-46686530 AAAGCTGCCCAGCAGGCCCTGGG - Intronic
1157523516 18:48361698-48361720 CAGGCTGCACACCAGCCCATGGG + Intronic
1157777019 18:50403666-50403688 CAGGTTACTCACCAGGCCCCTGG - Intergenic
1158388899 18:57027075-57027097 CGGGCTGCACAGGGGGCACCTGG - Exonic
1159735230 18:72088684-72088706 CAGTGTGCACAGCAAGCGCCAGG - Intergenic
1160378052 18:78429198-78429220 AGGGCCGCACAGCAGGCCTCGGG + Intergenic
1160571222 18:79818825-79818847 CAGGCAGCAAAGGGGGCCCCTGG + Intergenic
1160691304 19:461616-461638 CAGGCCGCAGAGCAGGGGCCCGG - Intergenic
1160740538 19:683465-683487 CATGCGGCACCCCAGGCCCCAGG - Intergenic
1160740830 19:685152-685174 CGGGGTGCACAGCAAGTCCCAGG - Intergenic
1160874779 19:1291877-1291899 CAGGCAGCCCTCCAGGCCCCAGG - Intronic
1160994836 19:1877820-1877842 CAGGCTCCACACCAGTCCCGAGG + Intronic
1161284589 19:3462818-3462840 GGGGCAGCACAGCCGGCCCCCGG + Exonic
1161406542 19:4094393-4094415 CAGGCTGCCACCCAGGCCCCAGG - Intronic
1162412309 19:10513956-10513978 CAGGCAGCGGCGCAGGCCCCCGG + Exonic
1162787253 19:13043509-13043531 CAGACTGCGCAGCTGGCCTCAGG - Intronic
1163775492 19:19215003-19215025 CAGGCTGCACAGCAGGGTAGAGG - Intronic
1164445298 19:28312470-28312492 CAGGGTGCACAGCCCTCCCCTGG - Intergenic
1165309465 19:35021745-35021767 CAGGCCGGATAGCAAGCCCCGGG - Exonic
1165395694 19:35562510-35562532 CATGAGGCACTGCAGGCCCCCGG + Exonic
1165415494 19:35691168-35691190 CAGGCCGCACAGGAGCCCACGGG + Intergenic
1166209429 19:41296659-41296681 GAGGGTTCAGAGCAGGCCCCTGG + Intronic
1167078635 19:47264516-47264538 CGGGCTGCCCAGCAGGCCTGAGG - Intronic
1167289716 19:48617681-48617703 GAGACTGCTCTGCAGGCCCCTGG + Intronic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167749753 19:51372476-51372498 CAGGCAGAACATCAGGCCCAGGG + Exonic
1168138060 19:54364808-54364830 CAGGCTGCACTGCTGGGACCTGG - Exonic
925007269 2:453442-453464 CAGCCTGCACCGAAGGCCCATGG - Intergenic
925123730 2:1438964-1438986 CAGGCTCTACTGCAGGACCCAGG - Intronic
925153585 2:1634235-1634257 CAGACTGGACAGCAGGCCCCTGG + Exonic
925203929 2:1990905-1990927 GAGGCTGCACAGCAGATTCCTGG - Intronic
925284588 2:2707392-2707414 CAGGCGGCTCAGCAGGACACAGG + Intergenic
925737822 2:6979648-6979670 CAGGCTCCACAGAAGCCTCCAGG + Intronic
925743061 2:7021752-7021774 CAGGCTGCTCAGAAAGGCCCAGG - Intronic
925924315 2:8659455-8659477 CTGGCTGCTGAGCAGGCCTCTGG + Intergenic
925969668 2:9097336-9097358 CAGCCTGTCCAGCAGCCCCCGGG + Intergenic
926060624 2:9802575-9802597 AACGCTGCACAGCCAGCCCCAGG - Intergenic
926123343 2:10256519-10256541 CAGCCAGCACAGCAGGTGCCAGG + Intergenic
926560234 2:14408740-14408762 CAGACTGCTCTGCAGGACCCGGG + Intergenic
926689543 2:15724013-15724035 AAGGCTGCACAGCAAGCCAGTGG + Intronic
927387006 2:22546239-22546261 CAGGCTCCAATGCAGGCCCAAGG + Intergenic
927511959 2:23649555-23649577 CAGCCTGCTCAGCAGGGCACAGG + Intronic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
932418212 2:71586395-71586417 GAGGGTGGGCAGCAGGCCCCTGG + Intronic
933051903 2:77611252-77611274 CAGGCTGCACACCATGGCACTGG - Intergenic
934298697 2:91763708-91763730 CTGCCTTCACAGCAGCCCCCAGG - Intergenic
934741016 2:96722599-96722621 CAGGCTGCACAGCAGGTGAATGG - Intronic
935788884 2:106572718-106572740 CAGGCAGCACTGCTGCCCCCAGG + Intergenic
936106648 2:109630563-109630585 CAGGCCACACAGCAGACACCAGG - Intergenic
937258354 2:120570155-120570177 CAGGCTGCTGAGAAGGCCCTGGG + Intergenic
937930536 2:127201624-127201646 AAGGCTGCAGAGGAGGACCCTGG + Intronic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
938071847 2:128312546-128312568 GAGGGTGCACCCCAGGCCCCTGG + Intronic
938126036 2:128672195-128672217 CGGGCTGCACAGGAGCCCACGGG + Intergenic
938207609 2:129437546-129437568 CAGGCAGCTCAGCAGGACACAGG + Intergenic
938324819 2:130391350-130391372 CAGGCAGCCCTGCGGGCCCCTGG + Intergenic
938491495 2:131763550-131763572 CAAGATGAACACCAGGCCCCTGG - Intronic
938496070 2:131798791-131798813 CAAGATGAACACCAGGCCCCAGG + Intronic
941705886 2:168657700-168657722 CAGCCTGCCCTGCTGGCCCCGGG - Intronic
942147938 2:173044410-173044432 CACTCTGCAACGCAGGCCCCAGG + Intronic
943236829 2:185332434-185332456 CAGGCTGGACCTCAGGCCTCTGG + Intergenic
943954990 2:194176652-194176674 CAGGCCGCACAGGAGCCCACGGG - Intergenic
944055211 2:195515915-195515937 CGGGCTGCACAGGAGCCCACAGG - Intergenic
944307569 2:198195423-198195445 CAGGCTGTACAGGAGGCCTCAGG + Intronic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
946145778 2:217729816-217729838 CAGGCTGCAGAGCTGTGCCCTGG - Intronic
946277510 2:218642563-218642585 GAGCCTGCACAGCCTGCCCCTGG - Exonic
946855418 2:223945242-223945264 CAGGCCGCAGAGCAGCCGCCCGG - Exonic
948047172 2:234952928-234952950 CCGTCTACACCGCAGGCCCCGGG - Intronic
948212749 2:236207158-236207180 CAGGATGCAGAGCAGGACCCAGG + Intronic
948384646 2:237573990-237574012 CAGGCTGCACAGGATGCACAGGG - Intergenic
948516956 2:238510099-238510121 CAAGCTGCAAAGCGGGCACCAGG - Intergenic
948585455 2:239016148-239016170 CAGCCTGCAAAGGAGGACCCTGG + Intergenic
948766938 2:240227233-240227255 CAGCCTGCACTGGAGGCCTCAGG - Intergenic
948829294 2:240590192-240590214 CAGGCTGGGCACCAGGCACCTGG - Intronic
948854034 2:240721763-240721785 CAGGCTGCCCCGCAGGGCTCGGG - Intronic
1168790899 20:574971-574993 CAGGCTGCACGTCAGGCAGCTGG + Intergenic
1168962344 20:1877902-1877924 CCAGCTTCACAGGAGGCCCCGGG + Intergenic
1169066957 20:2699146-2699168 GGGGCTGCCCAGCAGGTCCCGGG - Intronic
1171121081 20:22569021-22569043 AAGGCTGCTCTGCAGGTCCCCGG + Intergenic
1171420034 20:25011889-25011911 CAGTCTGCCCAGCAGTGCCCTGG + Intronic
1172379498 20:34476352-34476374 CCGGCTCCTCAGCAGGCCGCTGG + Intronic
1172702348 20:36861436-36861458 CAGGCTGGAGAGCAGATCCCGGG + Intronic
1172841662 20:37905662-37905684 CAGGCTGCTCTGCAGGGGCCAGG + Intronic
1173016061 20:39226752-39226774 TGGCCTGCACAGCAGGACCCAGG - Intergenic
1173165284 20:40683352-40683374 CACGGGGCACAGCAGGCCCCCGG - Intergenic
1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG + Intronic
1174062067 20:47839836-47839858 CAGGGTACACACCAGGCCTCAGG + Intergenic
1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG + Exonic
1174378389 20:50141065-50141087 CAGCCTGCACAGCACACACCTGG + Intronic
1175230022 20:57467941-57467963 CAGGCTGCCCAGCATGCTTCTGG + Intergenic
1175238552 20:57529223-57529245 CAAGCTCCACAGCAGGCACTGGG - Intergenic
1175666829 20:60868481-60868503 CAGGCTGGACTGCAAGCCTCGGG + Intergenic
1175889642 20:62310515-62310537 GAGGCTGCACGGGAGGCCCCTGG - Exonic
1176084771 20:63290914-63290936 GAGGCTGCACAGGAGGCCACTGG + Intergenic
1176086565 20:63297920-63297942 CAGGCAGCACAGCCAGCCTCAGG - Exonic
1176134327 20:63514579-63514601 CAGGCTGTACAGGAGGCCTCAGG + Intergenic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1176616521 21:9031232-9031254 CAAGATGAACACCAGGCCCCTGG + Intergenic
1176654021 21:9573921-9573943 CAGGCTGCACACCTGGGCACAGG - Intergenic
1176708608 21:10132400-10132422 CAAGATGAACACCAGGCCCCTGG - Intergenic
1177505676 21:22014963-22014985 AAGGCTGCATAGCAGGTACCAGG + Intergenic
1178599107 21:33980673-33980695 CAAGATGCACAGCTGGCCCCAGG - Intergenic
1178805862 21:35838466-35838488 AAGGCTGCACAGCATGTACCTGG - Intronic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1179839652 21:44063147-44063169 CAGGCTGCACTCCAGCCCACAGG + Intronic
1179925596 21:44532424-44532446 CAGCCTGCACAGCACGTCCCTGG + Intronic
1179960801 21:44766176-44766198 GAGGCTGCCCAGCAGGCCCCTGG + Intergenic
1180080088 21:45482679-45482701 CAGGCAGCAAAGCAGGGACCCGG + Intronic
1180940483 22:19657289-19657311 CAAGGTGAACAGGAGGCCCCAGG + Intergenic
1180972842 22:19824630-19824652 GAGGCAGCTCGGCAGGCCCCAGG + Intronic
1180979998 22:19873910-19873932 CTGGCTGCAGACCAGGCCCAGGG - Intergenic
1181037630 22:20177575-20177597 CAGGGTGCACAGCAGGGCTGGGG - Intergenic
1181120894 22:20668353-20668375 CAGGCTCCACACCAGTCCCGAGG + Intergenic
1181287679 22:21766140-21766162 CAGGCAGCACCGCAGGCACAAGG - Intronic
1181333856 22:22115378-22115400 CAGGCTCCACACCAGTCCCGAGG + Intergenic
1181522926 22:23459797-23459819 CAGACAGCGCTGCAGGCCCCAGG - Intergenic
1181559661 22:23692742-23692764 CTGGCTCCAGAGCAGGCCCCAGG - Exonic
1182623427 22:31630176-31630198 CAGGCAGCCCAGGAGGCCCTGGG + Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1183324488 22:37184005-37184027 CAGGCTGCTGAGCTGGGCCCAGG + Intronic
1183546693 22:38457935-38457957 CAGGATGAACAGCAGCCCCAGGG - Intergenic
1183628146 22:39017306-39017328 CTGGCTACATAGTAGGCCCCAGG - Intronic
1183630752 22:39031236-39031258 CTGGGTGCATAGTAGGCCCCAGG - Intronic
1183728075 22:39600461-39600483 GAGGTTGCAGAGCAGGGCCCAGG - Intronic
1183782381 22:40007197-40007219 GAGGCTGCACAGCTGCCCGCAGG - Intronic
1183928629 22:41223622-41223644 CAGGCTGCACACCAGCTTCCAGG + Intronic
1183928913 22:41225077-41225099 GAGGCTGGAGAGCCGGCCCCTGG - Intronic
1183945962 22:41325863-41325885 CAGCTTGCACAGCAGCTCCCGGG - Exonic
1184247465 22:43242871-43242893 CAGGCCTCACAGCAGCCCCGGGG + Intronic
1184373535 22:44097712-44097734 GAGGGTGGACAGCAGGCCCCAGG - Intronic
1184477048 22:44727612-44727634 CAGGGTGCCAAGCAGGCCACCGG + Intronic
1184704364 22:46200362-46200384 CAGGCTGCACCGCAGAGCCTCGG - Intronic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
1185081965 22:48714444-48714466 CAGGCTGCATAAGAGACCCCTGG + Intronic
1185266714 22:49907885-49907907 CAGGCTGCAGCCCAGGCCGCGGG + Exonic
1185385887 22:50531190-50531212 CAGGCGGAACAGCAGAGCCCAGG - Exonic
950185174 3:10940287-10940309 CTGTCTTCCCAGCAGGCCCCAGG + Exonic
950256924 3:11513318-11513340 CGGGCTGCACAGGAGCCCACGGG + Intronic
950534319 3:13570506-13570528 CACGTGGCACAGCAGGCACCCGG - Exonic
950693482 3:14679508-14679530 CAAGCTGCGCAGCAGAGCCCGGG - Intronic
954230576 3:49213702-49213724 CAGCCTGCGCCGCTGGCCCCAGG - Intronic
954443189 3:50532932-50532954 CAGACCGCACACCTGGCCCCTGG - Intergenic
954793965 3:53152072-53152094 CAGGCAGCAGAGCTGGCCCCAGG + Intergenic
958176924 3:90007800-90007822 AAGGCTGCACAGGAGGCTCTGGG + Intergenic
958996736 3:100914370-100914392 CAGTCTGCGGAACAGGCCCCTGG + Intronic
960974716 3:123162871-123162893 CAGGGTGCACAGCAAGCAGCTGG - Intronic
960989813 3:123303184-123303206 CAAGCAGCCCAGCAGGTCCCTGG + Exonic
961052348 3:123757577-123757599 CAGACTGCCCAGCAGGACACTGG + Intronic
961797749 3:129421884-129421906 CAGGCTGGGCAACAGGGCCCTGG + Intronic
961809208 3:129512358-129512380 CAGGCTGTGCAGCAGGAACCTGG - Exonic
962774783 3:138649358-138649380 CAGGCTGGCCCTCAGGCCCCTGG + Intergenic
963397251 3:144750096-144750118 CAGGCGGCACAGGAGCCCCCGGG - Intergenic
966563737 3:181352434-181352456 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
967954026 3:194863352-194863374 CAGGCAGCTCAGCAAGCCTCAGG + Intergenic
968178206 3:196569088-196569110 CCGGCTGGGCAGCCGGCCCCCGG - Exonic
968189852 3:196659901-196659923 CAGCCTGCACAGCTGCCACCTGG + Exonic
968222249 3:196947799-196947821 GGGGCTGGACAGCAGGCTCCGGG + Exonic
968576041 4:1366656-1366678 CAGGCTGCAGGGAGGGCCCCAGG - Intronic
968725301 4:2245117-2245139 CAGGCTAGTCATCAGGCCCCAGG - Intergenic
968881038 4:3300346-3300368 CAGGCTGGACTCCAGGCCCCTGG - Intronic
969233743 4:5850693-5850715 CTGGCTGCAGAGCAAGCACCTGG + Intronic
969241567 4:5902033-5902055 CAGGCACCACAGTAGGCCCTGGG - Intronic
969246868 4:5940395-5940417 CAGGCTGCAGATCAGGGCCTGGG - Intronic
969443905 4:7233405-7233427 CAGCCTCCACAGCAGCCCGCAGG + Intronic
971386074 4:26141413-26141435 CAGGCTGCAGCACAGGCCCCAGG + Intergenic
973142125 4:46781948-46781970 CGGGCTGCACAGGAGCCCTCCGG - Intronic
975389879 4:73803255-73803277 CAGGCTGCACACCACAACCCTGG - Intergenic
975974499 4:80079489-80079511 AAAGCTGCAAAGCAGGCCCAGGG - Intronic
976125747 4:81832348-81832370 CAGGGTGCACAGCAAACTCCCGG + Intronic
976392003 4:84515534-84515556 GTGGCTGCAAGGCAGGCCCCAGG - Intergenic
976620266 4:87120198-87120220 CTGTCTGCACAGCAAGTCCCTGG + Intronic
979665255 4:123304211-123304233 AAGGGAGCACAGCAGGCTCCTGG - Intronic
979828432 4:125269324-125269346 CAGGCTGTACAGGAGACCTCAGG - Intergenic
980167936 4:129251385-129251407 CAGGCTGTACAGGAAGCCCATGG - Intergenic
981937815 4:150253698-150253720 CAGCCAGCCAAGCAGGCCCCTGG + Intronic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
983999806 4:174226196-174226218 TATGCTGCACAGCAGAGCCCTGG - Intergenic
984241803 4:177227637-177227659 CGGGCTGCACAGGAGCCCACTGG + Intergenic
984665394 4:182421933-182421955 CAAGTTGCAAAGCTGGCCCCGGG - Intronic
985399444 4:189579974-189579996 CAGGTTGGAGAGCAGGCCCAGGG - Intergenic
985555371 5:555460-555482 CAGTGGGCACATCAGGCCCCTGG + Intergenic
985589533 5:757399-757421 CAGGAGGGACAGCAGCCCCCTGG - Intronic
985604270 5:850122-850144 CAGGAGGGACAGCAGCCCCCTGG - Intronic
985682010 5:1260710-1260732 CGGGCTGCAGCGCATGCCCCAGG - Intronic
985966237 5:3340623-3340645 CAGCCTGGACAGGAGGGCCCTGG + Intergenic
986061868 5:4199268-4199290 CACGCTGCCCAGCAGACCCAGGG - Intergenic
986506845 5:8460324-8460346 CAGGGTGTAAAGAAGGCCCCAGG - Intergenic
987750990 5:22038443-22038465 CATCCTGCACATCAGGGCCCAGG + Intronic
990112017 5:52338133-52338155 CAGGATGCATAACAGGCCCAGGG - Intergenic
992022588 5:72639003-72639025 CAGGCCGCACAGCAGGCGGTGGG - Intergenic
992501414 5:77347866-77347888 CAGCCTGCAGAGGTGGCCCCGGG + Intronic
992610672 5:78505565-78505587 CAGGGTGCACAGCAGTCCTGTGG - Intronic
992944209 5:81793893-81793915 CAGGCAGCACAGCCTGACCCAGG - Intergenic
995283688 5:110363062-110363084 CAGGCTTCTGAGGAGGCCCCAGG + Intronic
996422885 5:123281365-123281387 CAGGCTCCTGAGCATGCCCCAGG + Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
997589909 5:135066235-135066257 CAGGCTGCCCAGCAAGGGCCAGG - Intronic
997625412 5:135327608-135327630 CAGGCCACACAGCAGGAACCTGG - Intronic
997965361 5:138352505-138352527 CAGGGGGCACTGCAGGCCCCGGG + Intergenic
998177551 5:139911219-139911241 AAGGGCACACAGCAGGCCCCGGG - Intronic
999251411 5:150184362-150184384 CAGGCTGCCCATCAGGGCCCAGG + Exonic
1000204782 5:159048438-159048460 CAGCCTGCACACCAGCACCCTGG + Intronic
1001147753 5:169199725-169199747 CAGGCTTAGCAGCAGGCACCTGG - Intronic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1002448008 5:179301949-179301971 CAGCCTGCACACCTCGCCCCTGG + Intronic
1002460492 5:179370899-179370921 AAGGCAGCACAGCAGGCACTGGG - Intergenic
1002495708 5:179610127-179610149 CAGGCTGCCCTGCAGGCTCTGGG - Intergenic
1002760442 6:197637-197659 AAGGCTGCTCACTAGGCCCCTGG - Intergenic
1002841707 6:912070-912092 CAGGATGCAAAGCAGGAGCCCGG - Intergenic
1003213777 6:4090379-4090401 CCGGCTGCACAGGAGCCCACGGG - Intronic
1003254237 6:4460207-4460229 CATCCTGCACAGCTGGGCCCGGG + Intergenic
1003422050 6:5967516-5967538 CAGGCTGACCAGGAGGCCCCAGG + Intergenic
1003531415 6:6940378-6940400 CGGGCTGCACAGGAGCCCACGGG - Intergenic
1003643668 6:7896805-7896827 CAGACTCCAGAGCAGTCCCCCGG + Intronic
1004650163 6:17600539-17600561 CAGGCCGAACCCCAGGCCCCGGG + Exonic
1005416059 6:25601335-25601357 CAACATGCACAGGAGGCCCCTGG - Intronic
1006387434 6:33739166-33739188 CAGGCTGCACTGAAGGCCCAGGG - Exonic
1006906563 6:37537082-37537104 CAGGCTCCAGAGCAGGCCTGCGG - Intergenic
1007293911 6:40806694-40806716 CAGGCTGCACAGAGGGCCTGGGG + Intergenic
1007335975 6:41155490-41155512 CTGCCTGCACAGGAGGCACCTGG + Intergenic
1009940504 6:70283074-70283096 CAGGCTGCAGAGCCGGGCCAAGG - Intronic
1010945827 6:81971859-81971881 CCGACTCCACAACAGGCCCCAGG + Intergenic
1013590163 6:111613067-111613089 GAGGCTGCCCTGCAGGGCCCTGG + Intergenic
1014071765 6:117189876-117189898 CAGGCTGTTCAGGAGGCCTCAGG - Intergenic
1016396277 6:143626762-143626784 CACGCTTCACATCATGCCCCTGG - Intronic
1018853300 6:167657135-167657157 GAGGCTCCACAGGTGGCCCCTGG - Intergenic
1019290920 7:249820-249842 CAGGCTGTGCAGCAGGGGCCTGG - Intronic
1019311468 7:363663-363685 GCGACTGCCCAGCAGGCCCCTGG + Intergenic
1019351313 7:555280-555302 CAGTCGGCACAGCAGCCCCGTGG - Intronic
1019409752 7:901327-901349 TAGGCTGAACAGGAGGCCCAGGG - Intronic
1019444616 7:1064857-1064879 CAGGGCGCACAGAAGGCCCCAGG + Intronic
1019445029 7:1066693-1066715 CGGCCTCCCCAGCAGGCCCCTGG - Intronic
1019449924 7:1092207-1092229 CAGGCTGCAGCGCATGGCCCTGG - Exonic
1019464094 7:1176979-1177001 CACGTTGCACAGGAGGGCCCAGG - Intergenic
1019588402 7:1816754-1816776 CAGACAGCGCTGCAGGCCCCAGG + Intronic
1020095950 7:5369454-5369476 AAGGCTGCTGAGCAGGCCCAGGG + Intronic
1021452960 7:20798587-20798609 CAGGCTGCCCAGCAGGTGTCAGG - Intergenic
1022033772 7:26515708-26515730 CAGGCTGCACAGCCTGCTCCTGG + Intergenic
1023769032 7:43537915-43537937 CAGTCTGCGCTGCAGTCCCCTGG + Intronic
1024219546 7:47277154-47277176 TAGGATGCACCGCAGGCCCCTGG - Exonic
1024230995 7:47363439-47363461 CAGGATGCACAGAAGTCCCCCGG + Intronic
1025280367 7:57622585-57622607 CAGGCTGCACACCTGGGCACAGG - Intergenic
1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG + Intergenic
1028100908 7:86819574-86819596 CATGCTGCCCAGCAGGCCTAGGG + Intronic
1029000357 7:97147957-97147979 CAGGCTGCAGTGCAGGCTCACGG + Intronic
1029321326 7:99763129-99763151 CAGCCTGCACAGCACACCCAGGG + Intronic
1029600154 7:101558623-101558645 CAGGCTCCATGGCAGGCACCAGG + Exonic
1031513322 7:122674089-122674111 CAGCCAGCACCGCTGGCCCCGGG - Intronic
1032153589 7:129450753-129450775 TAGGCTGCAGAGAAGGCCCTTGG - Intronic
1032240341 7:130154588-130154610 CAGGCTGCGCAGCTGGCACTTGG - Intergenic
1032550420 7:132779461-132779483 CAGGCTGCAGAGCAGGGGCTGGG - Intergenic
1032580142 7:133096545-133096567 AAGGCTGCAGAGAAGGTCCCAGG + Intergenic
1032683495 7:134209122-134209144 AAGGGTGCACAGGAGGCACCAGG - Intronic
1032715639 7:134506926-134506948 CTGACTGCACAGCAGCCTCCTGG + Intergenic
1034094781 7:148397227-148397249 CTGGCTGCACATCAGTCACCTGG + Intronic
1035127500 7:156619078-156619100 CAGGCTGTTCACCAGGTCCCAGG - Intergenic
1035221243 7:157407660-157407682 CAGGGTGCACAGGTGTCCCCGGG + Intronic
1035428139 7:158795911-158795933 AAGGCTGCACAGGAGGCACGGGG + Intronic
1035568078 8:654950-654972 CAGGCTGGACGCCAGCCCCCTGG + Intronic
1035617128 8:1010902-1010924 CAGTCTACACAGTGGGCCCCAGG + Intergenic
1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG + Intergenic
1036453762 8:8891634-8891656 CACGATGAACCGCAGGCCCCGGG + Exonic
1036776537 8:11616844-11616866 CAGCCTTCACTGCAAGCCCCTGG + Intergenic
1036966287 8:13301711-13301733 CAGGCTGCACAGCAGGAGATGGG + Intronic
1037494261 8:19423879-19423901 CAGGCTGCACAGAAAGCCCTGGG + Intronic
1037727501 8:21495291-21495313 CAGTCTCCAGAGCAGGTCCCTGG - Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1038182210 8:25239995-25240017 CAGGGTGCACTGCAGGCCCAGGG + Intronic
1038368331 8:26960929-26960951 CAGGCTGCACAGCAGGTGAGTGG + Intergenic
1038870742 8:31490156-31490178 CAGGCTGCACAGGAGCCCGTGGG - Intergenic
1040481002 8:47826720-47826742 CAGGCAGCTCAGCAGGCAGCAGG + Exonic
1040723160 8:50350206-50350228 CGGGCTGCACAGGAGCCCACGGG - Intronic
1042787743 8:72567896-72567918 CAGGCTGCCCAGGACGCGCCTGG + Exonic
1042960109 8:74294182-74294204 CAGGCTACAGAGAAGTCCCCAGG - Intronic
1044261871 8:90134495-90134517 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
1045379391 8:101608227-101608249 GAGGTTGCACAGCTGGCGCCTGG + Intronic
1046981891 8:120345442-120345464 CAGGCTCCCCAGGAGGCCCTTGG - Exonic
1047595123 8:126370551-126370573 CAGGCTGCAATGCAGAACCCTGG + Intergenic
1048205984 8:132415563-132415585 CAGGCTGCTCTGCAGACCACAGG + Intronic
1048343223 8:133556443-133556465 CAGGCTGTACAGCTGTCCTCTGG + Intronic
1048462610 8:134635089-134635111 CAGGCTGCACAGCAGGTGAGTGG - Intronic
1049017942 8:139934659-139934681 CAGGCTGCACATGTGGCCACAGG + Intronic
1049219286 8:141421547-141421569 CAGGCGGTAGAGCTGGCCCCAGG - Exonic
1049225804 8:141449947-141449969 GGGGCTGGACAGGAGGCCCCTGG + Intergenic
1049247504 8:141570611-141570633 CAGGGTGCACAGGAGGGCACAGG + Intergenic
1049428789 8:142549736-142549758 CAGGCTGCAGAGCAGGGCTGTGG - Intergenic
1049496413 8:142936366-142936388 CTGGCTGCACCACAGGGCCCAGG + Intergenic
1049531631 8:143158280-143158302 CAGGCTGAGCAGGAGCCCCCCGG + Exonic
1049579612 8:143405341-143405363 CAGGCTGCACACCTGGCATCAGG - Intergenic
1049685334 8:143937140-143937162 AAGGCTGCCCGGCAGGCCCTGGG - Intronic
1049716424 8:144095173-144095195 CGCGCTGCACAGCAGACCCCGGG - Exonic
1049748372 8:144272516-144272538 CAGGCTGCTCTGCCAGCCCCAGG + Intronic
1049867227 8:144946885-144946907 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867281 8:144947102-144947124 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867316 8:144947249-144947271 CAGGCCCCACAGCAGGACACAGG - Intronic
1051314206 9:15810664-15810686 CAGCCGGCACTGCCGGCCCCAGG - Intronic
1051658809 9:19407821-19407843 CTGACTGCCCAGCAGGACCCTGG - Intergenic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1052430146 9:28355668-28355690 CATGCTGATCAGCAGGCTCCAGG + Intronic
1052603793 9:30672283-30672305 CAAGGTGGACACCAGGCCCCAGG - Intergenic
1053312877 9:37030379-37030401 GAGGCTGCACAGCAAGTCCATGG + Intronic
1053508785 9:38669312-38669334 CAGGGTCCACAGCAGAGCCCCGG + Intergenic
1053645576 9:40117895-40117917 CAAGATGAACACCAGGCCCCAGG - Intergenic
1053645865 9:40119318-40119340 CCAGCTGAACATCAGGCCCCAGG + Intergenic
1053759853 9:41344218-41344240 CCAGCTGAACATCAGGCCCCAGG - Intergenic
1053760133 9:41345614-41345636 CAAGTTGAACACCAGGCCCCTGG + Intergenic
1054326874 9:63717219-63717241 CCAGCTGAACATCAGGCCCCAGG + Intergenic
1054538997 9:66258077-66258099 CAAGATGAACACCAGGCCCCAGG + Intergenic
1056319055 9:85419527-85419549 CATGCTGATCAGCAGGCCCCAGG + Intergenic
1056502480 9:87223519-87223541 CACGTTGCCCAGCAGGGCCCTGG + Intergenic
1056523732 9:87423574-87423596 CAGCCTGGCCATCAGGCCCCTGG - Intergenic
1056568512 9:87796077-87796099 CAGACTGCTCAGAAGACCCCAGG + Intergenic
1058365171 9:104200694-104200716 CAGCCAGCACCGCTGGCCCCAGG + Intergenic
1059153816 9:111972422-111972444 TAGGCTGCCTAGCAGGGCCCAGG + Intergenic
1059335490 9:113566117-113566139 CTGGCCGCACACCAGGCACCAGG + Intronic
1060537221 9:124399995-124400017 AAGGCTGGAAAGCAGGCCTCGGG - Intronic
1061274536 9:129561872-129561894 CAGGATCCACAGCCGGCCACTGG + Intergenic
1061363698 9:130159290-130159312 CAAGGTCCACAGCAGGCACCCGG + Intergenic
1061365523 9:130171003-130171025 CAGGCTGAGCCCCAGGCCCCAGG - Intergenic
1061377670 9:130235771-130235793 CGGGCTGCTCAGGAGGCACCTGG - Exonic
1061544900 9:131298890-131298912 CAGGAAGCACAGCTGTCCCCGGG - Intronic
1061549276 9:131323966-131323988 GATGCTGCACAGAAGGTCCCTGG + Intergenic
1061582261 9:131545500-131545522 CCGGCCGCACGGCAGGCACCAGG + Intergenic
1061619282 9:131800930-131800952 CAGGGTGCACAGCAGGCAGTGGG - Intergenic
1061762036 9:132857783-132857805 CAGCCTGCACAGCAGGGGACAGG + Intronic
1061941561 9:133886908-133886930 CAAGATGCACAGGAGGCCCAGGG + Intronic
1062044770 9:134419915-134419937 CAGTGTGCACAGCCGGCCACAGG - Intronic
1062096851 9:134708027-134708049 GAGGCTGAGCAGCAGGGCCCAGG - Intronic
1062120156 9:134829815-134829837 CAGGCTGCACTGAAGGCGCTCGG + Intronic
1062379204 9:136278741-136278763 CATGTTGGACAGCAGGGCCCTGG - Intergenic
1062581058 9:137229447-137229469 CAGCCTGCAGCCCAGGCCCCCGG - Exonic
1062587640 9:137256517-137256539 CAGGCAGCACAGGAAGCTCCCGG - Intronic
1202793369 9_KI270719v1_random:101369-101391 CAAGATGAACACCAGGCCCCTGG - Intergenic
1203631741 Un_KI270750v1:77373-77395 CAGGCTGCACACCTGGGCACAGG - Intergenic
1189074968 X:37905629-37905651 CAGGATGCACAGCCAGCCCCAGG - Intronic
1189494591 X:41497780-41497802 CAGGCTGTGCAGGAGGCCTCAGG + Intergenic
1192673358 X:73169201-73169223 ATGGCTGCATAGCAGGCACCAGG + Intergenic
1193067720 X:77276783-77276805 CAGGCTGCACATCAGAGCCCTGG - Intergenic
1195694258 X:107655197-107655219 CTGGCTGCACAGCTGCCTCCTGG + Intergenic
1198214740 X:134545729-134545751 CATGCTTCTCAGCAGGCCTCGGG + Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199742077 X:150745234-150745256 CAGGTTGCGCAGCAGGCACTGGG - Intronic
1199964426 X:152807731-152807753 GACGCTGCACTGCAGGCCCTGGG - Intergenic
1200072153 X:153534523-153534545 CAGGGAGAACAGCAGGCCCGAGG - Intronic
1201149897 Y:11089955-11089977 CAAGATGAACACCAGGCCCCTGG + Intergenic
1201278652 Y:12321751-12321773 CAGGCTGAACCCCAGGCCCTGGG + Intergenic