ID: 900626173

View in Genome Browser
Species Human (GRCh38)
Location 1:3609713-3609735
Sequence CTGCCTCTGCACCTGGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 10, 3: 74, 4: 585}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900626173_900626179 11 Left 900626173 1:3609713-3609735 CCCGAGCCCAGGTGCAGAGGCAG 0: 1
1: 0
2: 10
3: 74
4: 585
Right 900626179 1:3609747-3609769 CAGACCCTCCACTCCTCCCCTGG 0: 1
1: 0
2: 5
3: 44
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900626173 Original CRISPR CTGCCTCTGCACCTGGGCTC GGG (reversed) Intronic
900096530 1:942241-942263 CCGCCTCCTCACCTGGGGTCTGG - Exonic
900104216 1:975448-975470 CTCCCTCTGCACCTGCACCCAGG + Exonic
900111231 1:1006430-1006452 CTGTCTCTCCACCTGGGACCAGG - Intergenic
900139208 1:1132430-1132452 CTTCCTCCACACATGGGCTCAGG - Intergenic
900205642 1:1430998-1431020 CTGCCCCGGCACTCGGGCTCTGG - Intergenic
900215307 1:1478483-1478505 CTGCATCTGCACCCAGGATCAGG - Intronic
900227935 1:1541362-1541384 CAGCCTCCACTCCTGGGCTCAGG + Intergenic
900607525 1:3530531-3530553 CTCTCTCTGCAGCTGGGATCTGG - Intronic
900626173 1:3609713-3609735 CTGCCTCTGCACCTGGGCTCGGG - Intronic
901138160 1:7010933-7010955 CAGCACCTGCACCTGGGCACAGG - Intronic
901788864 1:11642724-11642746 GAGCCACTGCACCTGGCCTCTGG - Intergenic
902631200 1:17705666-17705688 CTGTTTCTAAACCTGGGCTCAGG + Intergenic
902652471 1:17845511-17845533 CTCCCTCTGCACATGGGCTCCGG - Intergenic
903014583 1:20353757-20353779 GTGTCTCTGCAGCTGGCCTCCGG + Exonic
903027425 1:20439302-20439324 CTGCAGCTGTACCTGAGCTCAGG + Intergenic
903031464 1:20466956-20466978 CTGTCTCTGCACCTGGGGTTAGG - Intergenic
903216858 1:21848161-21848183 CTGCCGCTGCCCCTGGACTCTGG + Intronic
903325696 1:22567434-22567456 CTGCCTCTGCCCCTGGCGTGGGG + Intronic
903373542 1:22852100-22852122 CTGCATCTTCACCTTGACTCTGG - Intronic
903462541 1:23529851-23529873 CTGCCTGCTGACCTGGGCTCAGG - Intronic
903462825 1:23531082-23531104 AGGCCTCGGCACCTGGGGTCCGG + Exonic
903553027 1:24171567-24171589 CAGCCTCTACTCCTGGGCTCAGG + Intronic
905213636 1:36391474-36391496 TTCCCTCTGCACCTGCCCTCTGG + Intronic
905396391 1:37669286-37669308 CAGCCTCTCCACCTGTGCTCGGG + Intergenic
905450415 1:38052480-38052502 CTGCCTCAGCCCCTAGGCTGTGG + Intergenic
905907909 1:41631904-41631926 CTACCTCTGAGCCTTGGCTCAGG + Intronic
906445101 1:45889469-45889491 GAGCCTCTGCACCTGGCCTTTGG + Intronic
907498638 1:54862055-54862077 CAGCCTCTCCACCTGAGCTCAGG + Intronic
909962215 1:81860459-81860481 GAGCCACTGCACCTGGCCTCAGG + Intronic
910227202 1:84947936-84947958 CTGCCCCTGCCCCTGGGAACAGG + Intronic
911028128 1:93456696-93456718 CAGCCTCGACTCCTGGGCTCAGG - Intronic
911028133 1:93456733-93456755 CTGCCTCTGCACTTTAGCTTGGG + Intronic
911328213 1:96494498-96494520 CTCCCTCTTCACTTGGTCTCGGG - Intergenic
911434925 1:97844906-97844928 TTGCGACAGCACCTGGGCTCAGG - Intronic
911565958 1:99463914-99463936 CTACCTCTGCACCTTTGCTTAGG - Intergenic
911818470 1:102385286-102385308 GTGGCTATGCTCCTGGGCTCTGG - Intergenic
912414293 1:109497705-109497727 CTGCCCCTGCTCCTGGGAACTGG - Intronic
912928986 1:113939233-113939255 CAGCCTCTACCTCTGGGCTCAGG + Intronic
913254580 1:116942124-116942146 CTTTCTCTGCCCCTGGGCTGTGG + Intronic
913515551 1:119602576-119602598 GTGTGTCTACACCTGGGCTCTGG + Intergenic
915162027 1:153927397-153927419 GAGCCACTGCACCTGGCCTCAGG + Intergenic
915514008 1:156402214-156402236 CTGCCTCCTCTCCTGGCCTCTGG - Intergenic
915597283 1:156902817-156902839 CTGCCTCAGCTCCTGAGCTCAGG - Intronic
915600252 1:156918411-156918433 CTGCCTGTGTCCCTGTGCTCTGG + Intergenic
915608336 1:156969568-156969590 CTGTCTATGCACCTGGGCACAGG + Intronic
916120295 1:161523531-161523553 GTGCCTCTCCACCGGGCCTCTGG + Intronic
916130059 1:161605184-161605206 GTGCCTCTCCACCGGGCCTCTGG + Intronic
916166580 1:161971473-161971495 GCCCCTCAGCACCTGGGCTCAGG + Intergenic
916996784 1:170309779-170309801 CGGCGTGTGCAACTGGGCTCAGG + Intergenic
917309009 1:173657745-173657767 GAGCCTCTGCACCTGGCCTCTGG + Intronic
918181536 1:182088964-182088986 CTGCTGCTTCACCTGGGCTCAGG + Intergenic
918181625 1:182089531-182089553 CTGCCACTTCAGCTGGGCTCAGG - Intergenic
919797909 1:201332316-201332338 CTGCCTCAGCCCCTGAGGTCTGG - Exonic
920038767 1:203082750-203082772 CTAGCTCTGCACCTTGGCTGTGG + Intergenic
920217727 1:204373365-204373387 GAGCCACTGCACCTGGTCTCTGG + Intronic
920343758 1:205292634-205292656 CTAACTCTGCCCCTGGGCCCAGG + Intergenic
920670285 1:207998888-207998910 CTGCCTCTGAACCTCGGCACTGG + Intergenic
921287329 1:213621052-213621074 GATCCTCTGCACCTGGGCTAGGG - Intergenic
921366973 1:214383506-214383528 ATGCCTCAGCACCCTGGCTCTGG + Exonic
922661680 1:227435765-227435787 GAGCCACTGCACCTGGCCTCAGG + Intergenic
922717711 1:227885932-227885954 CTGCCTCCTCAGCTGGCCTCGGG - Intergenic
924487627 1:244501851-244501873 CTGCCTCTGCCCCTCTTCTCTGG + Intronic
1064028250 10:11866653-11866675 CTGCCTCTGCTCCCCGTCTCTGG + Exonic
1065020200 10:21496516-21496538 CTGCCTCTGCAGCGGGTCCCAGG - Intronic
1065130367 10:22613783-22613805 CTGTCTCTGCACCTGCACCCTGG - Intronic
1065771479 10:29082431-29082453 CTGCCTCTCAACATGGGCACTGG - Intergenic
1067069964 10:43124145-43124167 CTGGCTCTGCACCTCCACTCAGG - Intronic
1067183914 10:44011140-44011162 CTTCCTGTGCACCTGGTTTCAGG - Intergenic
1067242157 10:44506274-44506296 CTGACACTGGACCTGGGCTTGGG + Intergenic
1067348424 10:45455084-45455106 CTGCCTCTGCACCCCTGCTGTGG - Exonic
1067712044 10:48657198-48657220 CTGCCACAGCACCAGAGCTCAGG + Intergenic
1069668759 10:70183819-70183841 CTGCCTCTGTACCTGTGAACAGG + Intergenic
1069829295 10:71272615-71272637 CTGAATCAGCAACTGGGCTCTGG + Intronic
1069997492 10:72351657-72351679 CTGCCTTTGCCTGTGGGCTCAGG + Intronic
1070733267 10:78846279-78846301 GTGCCTATGCTCCGGGGCTCTGG + Intergenic
1070805453 10:79268080-79268102 CTCCTTCTGCTCCTGGGCCCAGG - Intronic
1071483505 10:86082378-86082400 CTGCCGCTGCCCCTGGGCAATGG - Intronic
1071705489 10:87993667-87993689 CTTCCTCTGCACCTTTTCTCAGG - Intergenic
1072125336 10:92440916-92440938 CAGCCTCTACCCCTGGGTTCAGG + Intergenic
1072578174 10:96719144-96719166 CTGGCTCTCCAGCTGGGCTCTGG - Intronic
1072805802 10:98423531-98423553 CTGCCTCTACACCTGCTCCCTGG - Intronic
1074188907 10:111118887-111118909 CTGCCTGTGCCGCTGGTCTCTGG - Intergenic
1074497316 10:113991441-113991463 CTGCCTCTGCCCCTGGCCAGGGG - Intergenic
1074504819 10:114060223-114060245 CAGGCTCTGCAACTGGGCTTTGG + Intergenic
1074615819 10:115067286-115067308 CAACCTCTGCTCCTGGGTTCAGG + Intergenic
1074720116 10:116256983-116257005 CTGCCTTTTGTCCTGGGCTCAGG - Intronic
1074996036 10:118758423-118758445 CTGCCACAGCCCCTGGCCTCAGG + Intergenic
1076163397 10:128263283-128263305 CTGCCACTGCAGCTGGTGTCAGG + Intergenic
1076214962 10:128686284-128686306 CTGCATCCGGGCCTGGGCTCAGG + Intergenic
1076473530 10:130736570-130736592 CTGCCTTCACACATGGGCTCAGG - Intergenic
1077153744 11:1082520-1082542 CTGCCCCGGCACCTGTGCCCTGG + Intergenic
1077466045 11:2734262-2734284 CCTGCTCTGCAGCTGGGCTCCGG - Intronic
1077535465 11:3122087-3122109 CTCCTTCTGCGCCTGGGCCCGGG + Exonic
1078051344 11:7967451-7967473 CTGCCTGTTCCCCTGGACTCTGG - Intergenic
1078431684 11:11292997-11293019 CTGCCACTGTGCCCGGGCTCTGG + Intronic
1078576523 11:12507544-12507566 CTGCCTCTGCCTCTTGGCTGGGG + Intronic
1078765352 11:14291355-14291377 CTTCCTTTGCACCTGTACTCAGG - Intronic
1080520700 11:33065726-33065748 CTGCCTCTGCAGCTTCCCTCAGG - Intronic
1080609650 11:33892900-33892922 CTGCCTCTGACCCTGGGCTTTGG + Intergenic
1080627351 11:34042640-34042662 AAGCCACTGCACCTGGCCTCAGG - Intergenic
1080630398 11:34069612-34069634 CATCTTCTGCACCTGGGGTCAGG + Intronic
1081325097 11:41734799-41734821 CTACCTCTGCTACTTGGCTCAGG + Intergenic
1081813232 11:45924728-45924750 CTGCCACAGGACCTGGGCTCAGG - Intronic
1083224901 11:61278754-61278776 GAGCCACTGCACCTGGCCTCAGG - Intronic
1083304222 11:61754364-61754386 CTGCATCTGTCCCGGGGCTCTGG + Intronic
1083766282 11:64843078-64843100 CTGCCTGTGGGCCTGGGCTTCGG - Intronic
1083819287 11:65158058-65158080 GAGCCCCTGCACCTGGCCTCTGG + Intergenic
1083880573 11:65546478-65546500 CTTCCGCTGCACCTGTGCCCAGG - Exonic
1083880796 11:65547376-65547398 CTGTCTCTCCACCTGGGGTGGGG - Intronic
1084095939 11:66911440-66911462 CTGCCATTGCACCTGGGTTATGG - Intronic
1084377159 11:68785261-68785283 CTCCCACTGCGCCTGGCCTCGGG - Intronic
1084753680 11:71221387-71221409 TGTCCTCTGCACCTGCGCTCCGG - Intronic
1086020240 11:82219595-82219617 GAGCCTCTGCACCTGGCCTAAGG + Intergenic
1087237617 11:95737670-95737692 CTGTCTCTGCCACTGGACTCTGG + Intergenic
1088789243 11:113209939-113209961 CTGCCTCTGTGCCTGTGCCCAGG - Intronic
1089632152 11:119790527-119790549 CTGCCTCTGTGCCTGGGCTCCGG - Intergenic
1091286433 11:134411211-134411233 TCCCATCTGCACCTGGGCTCAGG - Intronic
1091353164 11:134913829-134913851 CTGCCACTGCACCAGCCCTCAGG - Intergenic
1091582728 12:1798910-1798932 CTTCCTCTGCCCCTGGGCTCAGG - Intronic
1092225274 12:6744379-6744401 GTGCTTCCCCACCTGGGCTCAGG - Intergenic
1093026433 12:14249594-14249616 CTGCCTCTCCACCTCGGATACGG + Intergenic
1093718803 12:22414312-22414334 GAGCCACTGCACCTGGACTCAGG - Intronic
1094610528 12:31991115-31991137 CAGCCTCAACTCCTGGGCTCAGG - Intronic
1096408758 12:51362362-51362384 CTGCCTCTCCTCTTAGGCTCTGG + Intronic
1096590418 12:52655289-52655311 CAGCCCCTGCTGCTGGGCTCAGG + Intergenic
1096889202 12:54749634-54749656 CTGCCTCAGACCCTGGGCACTGG + Intergenic
1098369235 12:69739213-69739235 CCGCCTGGGCACTTGGGCTCCGG + Intronic
1100586664 12:95986902-95986924 CTGCCTCTTCATCTAGGCTATGG - Intronic
1101149066 12:101868098-101868120 CAACCTCTGCCTCTGGGCTCAGG + Intergenic
1101373681 12:104152696-104152718 CTGTCTCTGCACCTGTGATGTGG - Intergenic
1101953946 12:109197452-109197474 CTGCCTGTGCATCTGGGCTCTGG + Intronic
1102047822 12:109840793-109840815 CTTCCTCTCCACCTGGCCTCAGG - Intergenic
1102160363 12:110763841-110763863 CTGCCCATGCCCCTGGGATCTGG - Intergenic
1102472551 12:113167860-113167882 CTGCCTCTGGCCCTGGGCGCAGG + Intronic
1102569936 12:113821278-113821300 CTGCCTCTGCACCAGGCCCGTGG + Intronic
1102714511 12:114958624-114958646 GAGCCACTGCACCTGGCCTCTGG - Intergenic
1103664482 12:122552191-122552213 GAGCCACTGCACCTGGCCTCAGG + Intronic
1105607123 13:21935222-21935244 TGGCATCTGCACCTGGCCTCGGG + Intergenic
1105844370 13:24281686-24281708 CTGGGTCTGCTCATGGGCTCTGG - Intronic
1107877480 13:44803593-44803615 CTGCCTTTTGACCTTGGCTCTGG - Intergenic
1107998442 13:45884548-45884570 GTGACTCTGCCCCTGTGCTCTGG - Intergenic
1108210888 13:48138814-48138836 CAACCTCTGCCACTGGGCTCAGG + Intergenic
1108574281 13:51778122-51778144 CTCCCTCTGAACCCTGGCTCTGG + Intronic
1109178543 13:59185344-59185366 CAGCCTCAACTCCTGGGCTCAGG + Intergenic
1109297865 13:60556918-60556940 CAGCCACTGCACCCGGCCTCTGG - Intronic
1110238982 13:73245899-73245921 CTGCTACTGCACATGGGCTCTGG + Intergenic
1111858884 13:93675984-93676006 GAGCCACTGCACCTGGCCTCTGG - Intronic
1112177075 13:97036470-97036492 ATGCCACTGCACCTGGCATCAGG + Intergenic
1112982023 13:105396628-105396650 GTGCTTCTGAACGTGGGCTCTGG - Intergenic
1113481540 13:110625508-110625530 CTGCCTCTGGAGCTGGGCCCCGG - Intronic
1113723005 13:112574928-112574950 CTCCCTCCCCACCTGGGCCCTGG - Intronic
1113847232 13:113399323-113399345 CGGCCACTGCACCTGGGCCGCGG - Intergenic
1114650712 14:24282887-24282909 CTGAGCCTGCACCTGGACTCTGG + Intergenic
1115158043 14:30362489-30362511 CTGCATCTGCACGTGGCCACTGG + Intergenic
1115255370 14:31395268-31395290 CTGCCGCTGCACCTTGTCACAGG - Exonic
1116657843 14:47674312-47674334 CTTCCCCGGCGCCTGGGCTCTGG - Intronic
1117500978 14:56351091-56351113 TAGCCTCTACTCCTGGGCTCAGG + Intergenic
1119173046 14:72549266-72549288 CTGCCGCAGCAGCTGAGCTCTGG + Intronic
1119683714 14:76613218-76613240 CTTCCTCTGGAGCTGGGGTCGGG + Intergenic
1119749597 14:77068004-77068026 GTGGCTCAGCACATGGGCTCTGG - Intergenic
1119892568 14:78193991-78194013 CCCCCTCTGCATCTGGACTCTGG + Intergenic
1119939718 14:78627468-78627490 CTGCCTCTGGAAAAGGGCTCTGG - Intronic
1121137404 14:91510705-91510727 CTGCCCCTGCCCCTGGCCTGCGG + Intergenic
1121421785 14:93821078-93821100 CCGCCCCTGCACCTTGGCTCAGG + Intergenic
1121536369 14:94693863-94693885 GAGCCACTGCACCTGGTCTCAGG + Intergenic
1121603959 14:95226977-95226999 CTGTCTCTGCTCCTGGGTACAGG + Intronic
1121864391 14:97348797-97348819 CTGCCTCTTCACGAGGGCACAGG + Intergenic
1121954217 14:98199335-98199357 CTGCCTCTTCACTTGGTCTCAGG + Intergenic
1122060696 14:99134854-99134876 CTCCCTCTGCACCTGGAGTGGGG + Intergenic
1122122797 14:99563460-99563482 CTGCCTGTGCCTGTGGGCTCAGG - Intronic
1122689355 14:103524372-103524394 CTGCCTTTGGGCCTTGGCTCTGG - Intergenic
1122778417 14:104133335-104133357 CTTGCTCTGCAGCTGGGCCCTGG + Intergenic
1122790242 14:104181343-104181365 CTACCTTTGCTCATGGGCTCAGG + Intergenic
1122884129 14:104703033-104703055 ATGCCTGTGCAGCTGGGCTCAGG - Intronic
1123121910 14:105920606-105920628 CTGACTCTGGACCTGGGGACAGG + Intronic
1123143665 14:106107909-106107931 CTTCCTCTGCACCTGTGCTGTGG + Intergenic
1123401887 15:19995486-19995508 CTCCCTCTGCACCTGCCCTGAGG + Intergenic
1123404601 15:20012255-20012277 CTGACTCTGGACCTGGGGACAGG + Intergenic
1123511227 15:21002149-21002171 CTCCCTCTGCACCTGCCCTGAGG + Intergenic
1123513934 15:21018902-21018924 CTGACTCTGGACCTGGGGACAGG + Intergenic
1123578058 15:21692921-21692943 CTCCCTCTGCACCTGCCCTGAGG + Intergenic
1123614683 15:22135403-22135425 CTCCCTCTGCACCTGCCCTGAGG + Intergenic
1124006811 15:25801263-25801285 CTTCCACTGCACTTGGGTTCGGG + Intronic
1124434583 15:29636347-29636369 TTGGCTCAGCTCCTGGGCTCTGG + Intergenic
1125100639 15:35908294-35908316 GTGCCACTGCACCTGGCCTAAGG + Intergenic
1127930541 15:63594247-63594269 TGGCCTCTTCACCTGGGCCCTGG + Intronic
1128157377 15:65400519-65400541 CTAGCTCAGCACCTGGCCTCAGG + Intronic
1128536998 15:68499155-68499177 TAGCCACTGCACCTGGCCTCAGG - Intergenic
1128678181 15:69627140-69627162 TTGCCTCTGCACTTCAGCTCGGG + Intergenic
1129668806 15:77595561-77595583 CTGCCTCTGCCCCTGGCCCATGG - Intergenic
1129705828 15:77793509-77793531 CTACCACTGCACCTTTGCTCAGG + Intronic
1129832180 15:78678118-78678140 CTGCCTCTTCCCCTAGGCACTGG + Intronic
1130235766 15:82132214-82132236 CTGCCTCAGCACCAGGACACAGG - Intronic
1130823673 15:87521297-87521319 CTGTCTCTGAAACTTGGCTCAGG - Intergenic
1130906274 15:88242821-88242843 CTGCATCTGTACCTAGGCTGTGG - Intronic
1131261346 15:90889644-90889666 GTGGCTTTGCACCTGGGCTGCGG + Intronic
1131392781 15:92062677-92062699 CTGCCTCTGGACCACAGCTCTGG - Intronic
1132339254 15:101067720-101067742 CTGGATCTGCTCCTGAGCTCTGG + Intronic
1202986928 15_KI270727v1_random:427166-427188 CTCCCTCTGCACCTGCCCTGAGG + Intergenic
1132699842 16:1217698-1217720 CTGCTGCCGCACCTGGGCTGGGG - Intronic
1132739131 16:1402376-1402398 GAGCCGCTGCACCTGGCCTCTGG - Intronic
1132802056 16:1759321-1759343 ACGCCTCTGTGCCTGGGCTCAGG - Intronic
1132825607 16:1903875-1903897 CTGCATCTCCACCTGGGCTGGGG - Intergenic
1132852085 16:2029383-2029405 CTCCCTCTGCACTCAGGCTCCGG - Intronic
1132863100 16:2081188-2081210 CTCCCTCTGCCCCTGGGAACAGG - Intronic
1132863113 16:2081224-2081246 CTCCCTCTGTCCCTGGGCTCTGG - Intronic
1133202887 16:4215239-4215261 CTGCCTCAGCCCCTGCACTCTGG - Intronic
1133251795 16:4487175-4487197 CAGCCTCAACTCCTGGGCTCAGG - Intronic
1133502982 16:6382988-6383010 CTGCCTCTGCAGCTGAGCCCTGG - Intronic
1134111221 16:11516460-11516482 TTCCCTCTGCAGCTGGGCTCTGG + Intronic
1134323382 16:13184317-13184339 CTGCCTCAGATCCTGGGCTATGG + Intronic
1134515386 16:14882693-14882715 CTGCCGCTGCACCTGGGTGTGGG + Intronic
1134703059 16:16281338-16281360 CTGCCGCTGCACCTGGGTGTGGG + Intronic
1134964484 16:18430777-18430799 CTGCCGCTGCACCTGGGTGTGGG - Intronic
1134968771 16:18513312-18513334 CTGCCGCTGCACCTGGGTGTGGG - Intronic
1135660703 16:24294117-24294139 CTGCTTCTGCACCTACGATCAGG - Intronic
1136103169 16:28010324-28010346 CTGCCTCTGCATTTGGGGTCTGG - Intronic
1136119898 16:28126047-28126069 CTGTCTCTGTCCCTGGACTCTGG - Intronic
1136448746 16:30340203-30340225 ATGCCCCTGCACCTGGGCCAGGG + Intergenic
1136626298 16:31464339-31464361 CTGCCCCTTAACCTTGGCTCTGG + Intronic
1137008136 16:35297414-35297436 CTGCCTCGGCCCCTGTGCACAGG + Intergenic
1137238969 16:46638672-46638694 CTGGCTCTGCTTCTGAGCTCAGG - Intergenic
1137262665 16:46844066-46844088 CCGCCCCTGCTCCTGGCCTCGGG - Intergenic
1137552150 16:49445012-49445034 CTGCCTCTGCACCTGGCTTTTGG + Intergenic
1137559101 16:49491902-49491924 GAGCCTCTGCTGCTGGGCTCCGG + Intronic
1137733337 16:50706155-50706177 CTGCCTCTGGGCCTTGGCTCTGG - Intronic
1138535803 16:57659712-57659734 CTGCCTCTCCCACTTGGCTCTGG + Intronic
1138555642 16:57769830-57769852 CTTCATCTCCACCTGGGCTCTGG + Exonic
1139338828 16:66253754-66253776 CTGCCTCTGGACTTGGACTCAGG + Intergenic
1139368207 16:66446880-66446902 CTGCATCTGGACCTGTGCCCAGG + Intronic
1139435008 16:66931600-66931622 TTGCCACTGCACCTGGGCCTGGG + Intergenic
1139947888 16:70654190-70654212 CAGCCTCTGCCCCTGGTGTCCGG - Intronic
1141208979 16:81958694-81958716 CTGCCCCTGCAGCACGGCTCTGG - Exonic
1141483048 16:84319501-84319523 CGGCCACGTCACCTGGGCTCAGG - Exonic
1141774963 16:86117081-86117103 GTGCCACTGCACCTGGCTTCTGG + Intergenic
1141925792 16:87168352-87168374 GAGCCACTGCACCTGGCCTCAGG - Intronic
1142373477 16:89695496-89695518 CTGCCTCTGGACCTGGCCCTGGG - Intronic
1142717666 17:1755771-1755793 CTGCCCCAGCTCCTGGGCTCTGG - Intergenic
1143099469 17:4497569-4497591 CTGCCTGTGGACGTGGGGTCCGG + Intergenic
1143268622 17:5659156-5659178 TTGATCCTGCACCTGGGCTCTGG - Intergenic
1143479272 17:7219291-7219313 CTGCCTGGGCACATGGTCTCTGG + Exonic
1144803857 17:17950882-17950904 TTCCCTCTGCACCAAGGCTCTGG - Intronic
1145261587 17:21357836-21357858 ATGGCCCTGCAGCTGGGCTCTGG - Intergenic
1145416660 17:22718892-22718914 CTCCCTCTGCTCCTGCACTCAGG + Intergenic
1146314604 17:31797184-31797206 CTCACTCTGCTCCTGGGCTCTGG - Intergenic
1147444160 17:40464609-40464631 CTTCATCTGCCCCTGAGCTCAGG - Intergenic
1147613875 17:41817167-41817189 GTGCCTCCCCACCTGGGCTATGG + Exonic
1147984226 17:44295559-44295581 CTGCCATTCCACCTGGGCTGGGG + Intergenic
1148201366 17:45752114-45752136 CTGGGCCAGCACCTGGGCTCTGG + Intergenic
1148480390 17:47956177-47956199 GAGCCACTGCACCTGGCCTCTGG - Intronic
1148496293 17:48055116-48055138 CCGCCTCTGCTCCTGGGTCCAGG + Intronic
1149429233 17:56583788-56583810 CTGCCTCTCCTTCTGGGCTAGGG + Intergenic
1149459362 17:56814518-56814540 CTGCCTCTTCCCTTGGGCCCCGG - Intronic
1149953683 17:61021135-61021157 CAACCTCTGCTCTTGGGCTCAGG + Intronic
1150066519 17:62114478-62114500 GAGCCACTGCACCTGGCCTCAGG - Intergenic
1150128182 17:62652423-62652445 CTGCCTCCGCCCCCGCGCTCCGG + Intronic
1151488511 17:74417726-74417748 CTGGCTATGCACCTGTGCTGGGG + Intergenic
1151523486 17:74647814-74647836 TGGACTCTGCAGCTGGGCTCTGG - Intergenic
1151898395 17:76995887-76995909 ATGCCTCTGGAGCTGGCCTCAGG - Intergenic
1152298220 17:79480647-79480669 CTGCCTCGGCGCCTTGGCACTGG + Intronic
1152581061 17:81165806-81165828 CTGCTTCTGCTGCTGGGCTCGGG + Intronic
1152615817 17:81337293-81337315 GTGCTCCTGCACCTGGGCACTGG + Intergenic
1152705798 17:81843025-81843047 CTGCATCTGCACCTCGTCCCAGG + Intergenic
1152782916 17:82234328-82234350 TTGCCTCTGCACCTGGACACCGG - Exonic
1152912176 17:83011122-83011144 CCACCTCTGTGCCTGGGCTCAGG - Intronic
1153530206 18:6038536-6038558 AAGCCACTGCACCTGGCCTCTGG + Intronic
1153834141 18:8949285-8949307 CTCACTCTCCACCTGCGCTCTGG - Intergenic
1153988712 18:10376281-10376303 CAGCCTCTGCCCCTCGGCTTGGG + Intergenic
1155233098 18:23793412-23793434 CTGCTTCAGCCCCTGGGCTTTGG - Intronic
1157128568 18:44981298-44981320 CTGGCTCTGTAGCTTGGCTCAGG - Intronic
1158350964 18:56563959-56563981 CTGCCTCTGCTCCTTGTTTCAGG + Intergenic
1159357345 18:67354278-67354300 CAGCCCCAGCATCTGGGCTCTGG + Intergenic
1160564491 18:79778612-79778634 CTCCCTCTGCATCGGGGCTCAGG - Intergenic
1160569143 18:79804522-79804544 GTGTTTCTGCACCTTGGCTCAGG - Intergenic
1160735774 19:661810-661832 CAGCCTCTTCCCCTGGGCACAGG + Intronic
1160805293 19:989924-989946 CTGGAACTGCACCCGGGCTCAGG + Intronic
1160819629 19:1052052-1052074 CTGCGCCGTCACCTGGGCTCCGG + Exonic
1160876414 19:1298434-1298456 GTGGCTCTCCACCTGGGGTCAGG + Intronic
1161005670 19:1935070-1935092 CTGCCTCTTCACAGGGGCACGGG - Intergenic
1161248034 19:3265454-3265476 CTGCCTCTGAACTTCTGCTCGGG - Intronic
1161453720 19:4360194-4360216 CAGCCCCTGCACCTGGGAACTGG + Intergenic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161548248 19:4895578-4895600 CCGCCTCTGCACCTGGACTCGGG + Intronic
1162456922 19:10790845-10790867 CAGCCTCACCACTTGGGCTCAGG + Intronic
1163384793 19:16993094-16993116 CTGCCTCTGAACCTGCACCCAGG + Intronic
1163448299 19:17360650-17360672 TTGCCCCTGCCCCTGGGCTAGGG + Intronic
1163508754 19:17723167-17723189 CTGCCTCAGGACCTTTGCTCCGG + Intronic
1163622197 19:18367718-18367740 CTGCCTCTCCAAGTGGCCTCAGG - Exonic
1163679411 19:18672110-18672132 CCTCCCTTGCACCTGGGCTCAGG + Intergenic
1163681751 19:18686720-18686742 CTTCCTCATCACCTGGGGTCAGG + Intronic
1164555566 19:29248370-29248392 CTGGCTGTGTACCTGGGCTTTGG + Intergenic
1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG + Intergenic
1164709222 19:30343517-30343539 CTTCATCTCCACCTGGGCACAGG - Intronic
1164711338 19:30359250-30359272 CTGTGTCTGCCCCTGTGCTCAGG - Intronic
1164757714 19:30702711-30702733 CTGCTTCTGTGCCTGGGCTCAGG + Intronic
1164827557 19:31295660-31295682 CTGCCTCTGGACCTGGGCCCTGG + Intronic
1164918013 19:32067525-32067547 CTGCCTCTGCAGGTGGGCATGGG - Intergenic
1165098656 19:33425083-33425105 GAGCCACTGCACCTGGCCTCTGG - Intronic
1165141163 19:33700748-33700770 CTTTCTGTGCCCCTGGGCTCTGG - Intronic
1165375189 19:35436984-35437006 CTGCCTCTCCTCCCTGGCTCAGG + Intergenic
1165741347 19:38206994-38207016 AGGCCACTGCACCTGGGCTAGGG + Exonic
1166074978 19:40408710-40408732 CTGCCTCGGTCTCTGGGCTCAGG + Intronic
1166141882 19:40809616-40809638 CAGCTCCTGCACCTTGGCTCAGG + Intronic
1166304511 19:41929831-41929853 CGGTCTCAGCACCTGGGCGCTGG - Intronic
1166321424 19:42021507-42021529 TTTCCTCCCCACCTGGGCTCTGG - Intronic
1166328387 19:42065143-42065165 ATCCCTCTGCCCCTGGCCTCTGG - Intronic
1167157160 19:47745820-47745842 CTGGCCTTGCACCTGGGCGCAGG - Intronic
1168485643 19:56759922-56759944 CACCTGCTGCACCTGGGCTCTGG - Intergenic
925415624 2:3668293-3668315 CTGCCTCTGCAACTTGGCAAAGG - Intronic
925631378 2:5897013-5897035 CTGCCTCTGGACTTGAACTCAGG + Intergenic
925671289 2:6312181-6312203 CTGAATTTGCACCTGGGCTAAGG + Intergenic
925858921 2:8156476-8156498 CTGACTCTGAACCTGACCTCAGG + Intergenic
925979273 2:9164081-9164103 CTGCCCCTGCCCCGGGGCACTGG - Intergenic
926166207 2:10523239-10523261 CTGCCTCTGCTCCTCTGCCCAGG - Intergenic
926740002 2:16102954-16102976 ATGCCTCGGCCCCTGGGCTCAGG - Intergenic
927182018 2:20453475-20453497 CCGTATCTGCACCTGGGTTCAGG - Intergenic
927661992 2:25001097-25001119 CTGCAGCTGCACCTGGGACCAGG + Intergenic
927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG + Intergenic
927793548 2:26029511-26029533 GAGCCACTGCACCTGGCCTCTGG + Intergenic
928284104 2:29974054-29974076 CTGCCTCTGTGCCTTGGGTCAGG + Intergenic
928840743 2:35601464-35601486 CTGCTTCTTCATCTTGGCTCAGG + Intergenic
929226217 2:39514188-39514210 CTGCCACTTCTCCTGGGCTGAGG - Intergenic
929556292 2:42927558-42927580 CTCCCTCTGCTCCTGGCCTCTGG - Intergenic
929929078 2:46238234-46238256 TTGCCTCTGCACCTTTGCTCAGG + Intergenic
930387180 2:50711618-50711640 AAGCCACCGCACCTGGGCTCAGG + Intronic
930878903 2:56249796-56249818 CTGTGTCTACACCTGGGCCCTGG + Intronic
932771140 2:74501573-74501595 TCCCCTCTGCAGCTGGGCTCAGG + Intronic
932783452 2:74578605-74578627 CCACATCTGCATCTGGGCTCTGG - Intronic
933446733 2:82389762-82389784 CTGCCTCTGCACCTCAGCAGAGG - Intergenic
933456209 2:82522973-82522995 CTGCCTTTGCAGCCGGGCGCGGG - Intergenic
934111625 2:88748790-88748812 CAACCTCTGCTCCTGGGCTCAGG + Intronic
934717584 2:96552498-96552520 GGTCCTCTGCTCCTGGGCTCAGG - Exonic
935673970 2:105578498-105578520 CTGGCATTGCACCTGGGCTGGGG - Intergenic
936078482 2:109416822-109416844 CAACCTCTGCTTCTGGGCTCAGG - Intronic
936741305 2:115512413-115512435 GAGCCACTGCACCTGGCCTCTGG + Intronic
937994066 2:127679874-127679896 CTGCCCCAGGACCTGGGCTGTGG - Intronic
939577180 2:143909693-143909715 CTGCTTCTGCACATAGTCTCTGG + Intergenic
940321357 2:152380561-152380583 CCACCTCTGCACCTTGGCTCAGG + Intronic
941924931 2:170885261-170885283 CAGCCTCACCACTTGGGCTCAGG - Intergenic
942284036 2:174395909-174395931 CAGCCGGTGCAGCTGGGCTCCGG - Intronic
942678627 2:178453228-178453250 CTGCCTCTGCTCATGTGCTCAGG - Intronic
942943705 2:181650040-181650062 GTGCCTCTGCACTTGGGCCTGGG + Intronic
943445801 2:187986588-187986610 CTATCTATGCACCTGGTCTCAGG + Intergenic
944117699 2:196207099-196207121 CTGCCTCCCCATCTGGCCTCAGG - Intronic
945865014 2:215164332-215164354 CTGCCTCTGCCTCTGGCCTCTGG - Intergenic
946377794 2:219324183-219324205 CAGCCTCTGCAACTTTGCTCTGG + Intergenic
946399691 2:219461786-219461808 CTGCCGCAACTCCTGGGCTCTGG + Intronic
947342332 2:229152945-229152967 CTGGCCCTGCAGCTGGGCCCGGG + Intronic
947445803 2:230161725-230161747 CTGCCAATGCATCTGAGCTCTGG + Intergenic
947607842 2:231500703-231500725 GAGCCACTGCACCTGGCCTCTGG + Intergenic
947714144 2:232331395-232331417 CTGTCTCTGCCCCTGGGCCGGGG - Intronic
948012970 2:234664647-234664669 CTGCTTCTGCCCCTGTGCTCAGG - Intergenic
948189272 2:236045623-236045645 CTGCCCCTCCACCTGGCTTCAGG - Intronic
948226077 2:236310217-236310239 CTGCCTTTTCTCCTGGGCCCAGG - Intergenic
949026760 2:241770014-241770036 CCGGCTCTGTCCCTGGGCTCTGG + Intergenic
1169076156 20:2760789-2760811 CTGGCCCTGCTCCTGGGCTCTGG + Intergenic
1171460849 20:25297087-25297109 CTGGCTCTGCACCTGGTATATGG + Exonic
1171519979 20:25768281-25768303 CTCCCTCTGCTCCTGCACTCAGG + Intronic
1171556940 20:26088212-26088234 CTCCCTCTGCTCCTGCACTCAGG - Intergenic
1171769493 20:29311508-29311530 AAGCCACTGCACCTGGACTCCGG - Intergenic
1171797584 20:29578359-29578381 CAGCCTCTTCCCCTTGGCTCAGG + Intergenic
1172169251 20:32918925-32918947 CTCCCTCTGCACCTGGGCCAAGG - Intronic
1172479898 20:35264976-35264998 CTGCCTGTCCTCCAGGGCTCTGG - Intronic
1172809471 20:37637024-37637046 CAGCCTCTGGACCTGAGCTTCGG - Intergenic
1172973278 20:38888709-38888731 CTCCCTTTGCACGTGGGTTCAGG + Intronic
1173648734 20:44650086-44650108 CTCCCTCTGCCCTTGGGCTGGGG - Intronic
1173861222 20:46284963-46284985 CTGCCTCTCCATCTCTGCTCAGG + Intronic
1174625749 20:51912961-51912983 CTGCCTTTGGACCTTGGCACTGG + Intergenic
1175756466 20:61533406-61533428 CTGCCTCTGCAGCAGGACTTGGG - Intronic
1175815558 20:61881565-61881587 CTGCCTTTGGAACTGGGCCCAGG + Intronic
1176056023 20:63149679-63149701 CTGGGTCTGCAGCTGGGCCCAGG + Intergenic
1176227571 20:64010365-64010387 CAGACACTGAACCTGGGCTCAGG - Intronic
1176381850 21:6117699-6117721 CGGCCCCTGCTCCTGGGCCCTGG + Intronic
1176725162 21:10425612-10425634 GAGCCACTGCACCTGGCCTCAGG + Intergenic
1177566574 21:22830795-22830817 CTTCCTCAGGACCTGGGGTCGGG + Intergenic
1178977153 21:37229946-37229968 CAGCCTCACCTCCTGGGCTCAGG + Intronic
1179040508 21:37798278-37798300 CAGCCCCTCCACATGGGCTCTGG + Intronic
1179053860 21:37914344-37914366 CACCCTCGGCGCCTGGGCTCTGG + Intronic
1179375501 21:40846909-40846931 CTGACGGCGCACCTGGGCTCCGG - Exonic
1179444328 21:41420723-41420745 GTGCCGCTGCACTTGGGATCCGG - Exonic
1179550819 21:42142328-42142350 CTTCATCTGCCCCTGGGCTGTGG - Exonic
1179560808 21:42215075-42215097 CTGCTTCTCCACCTGGGCCGAGG - Intronic
1179741622 21:43420540-43420562 CGGCCCCTGCTCCTGGGCCCTGG - Intronic
1179829239 21:43985859-43985881 CTTGCACTGCACCTAGGCTCAGG + Exonic
1180167951 21:46039839-46039861 CTGCCTCTGCATCTGCGCGGTGG + Intergenic
1180498906 22:15914753-15914775 ATGCCTCTGCACTTGAGCTTGGG - Intergenic
1181312562 22:21953003-21953025 CTGCGGCTCCACCTGGGCTCCGG + Intergenic
1181671612 22:24427969-24427991 CTGCAGCTGCACCCGGGCTGTGG + Intronic
1182004711 22:26950201-26950223 GAGCCACTGCACCTGGCCTCTGG + Intergenic
1182146018 22:27997162-27997184 CTGCCTCTCCTCCTGCGCTTAGG - Intronic
1182367516 22:29788995-29789017 CTGGCCCTGCACCAGGTCTCAGG + Exonic
1182410530 22:30181287-30181309 GAGCCACTGCACCTGGCCTCAGG + Intergenic
1182676156 22:32041638-32041660 CTGCACCTGCACCTGGGTTCAGG + Intergenic
1182795052 22:32985796-32985818 CTGCCTCTGAACCTCTGCACAGG + Intronic
1183370672 22:37430186-37430208 TTGCCTCTGTGCATGGGCTCTGG - Intergenic
1183745090 22:39687375-39687397 CTGCAGGTGCCCCTGGGCTCAGG + Exonic
1183933348 22:41248490-41248512 CTGCCTCAGCTGGTGGGCTCTGG + Intronic
1184533482 22:45071325-45071347 CTGTCACTGCCCCTGGTCTCTGG + Intergenic
1184608116 22:45585982-45586004 CTGCAGCAGCTCCTGGGCTCAGG + Intronic
1185106208 22:48871389-48871411 CTGGCTCTGCAGCTGGGAGCAGG + Intergenic
1185247305 22:49779978-49780000 CTCACCCTGCACCTGGGGTCTGG - Intronic
1185278927 22:49961721-49961743 CTGCTTGTGGACCTGCGCTCCGG + Exonic
949667069 3:6351960-6351982 CTGCCACTGCTCCTGTGCTCTGG + Intergenic
949926681 3:9047532-9047554 CTGCCTCTGCAACTGACCTCTGG + Intronic
950440342 3:13006757-13006779 ATGCCCCTGCCCCTGGGCCCAGG - Intronic
951264789 3:20552753-20552775 CAGCAACAGCACCTGGGCTCGGG + Intergenic
951678442 3:25268641-25268663 CTGCCTCAGCACCTTTGCACTGG + Intronic
951847842 3:27103643-27103665 CTTCCTTTGCCCCTGAGCTCAGG - Intergenic
952344879 3:32473954-32473976 CTCCGTCTGCCCCTGGGCTTGGG + Intronic
953305072 3:41821541-41821563 CTGTCCCTCCACTTGGGCTCAGG + Intronic
954132769 3:48568738-48568760 CTGGCTCTGGACCTGGGCCTGGG + Intronic
954576983 3:51681753-51681775 GTGCCTGCCCACCTGGGCTCTGG + Intronic
954636728 3:52074947-52074969 CTCCCTCTGCCCCTGTGCTGGGG - Intergenic
954643278 3:52115007-52115029 CTGCCCGTGCCCTTGGGCTCAGG - Intronic
956661890 3:71607084-71607106 ATGCCTCTGTACCTGGGCCTGGG - Intergenic
956718394 3:72098218-72098240 CTGCCTCAGCACCATGGCTCAGG - Intergenic
956738789 3:72258967-72258989 CTGGCTGTGCACGTGGGCACCGG + Intergenic
959236139 3:103724372-103724394 CTGCCACTGCACTTTAGCTCAGG - Intergenic
959574635 3:107921316-107921338 CTGCCTCTGCACCCGGGGAGTGG + Intergenic
961219093 3:125185859-125185881 CTGCCTTTCCACTTGGGCCCTGG - Intronic
961319581 3:126063535-126063557 CTCCCTCTGCACCTGGGCACAGG + Intronic
961439329 3:126943408-126943430 TTGCCTCCTCACCTGGGGTCAGG + Intronic
961651519 3:128418879-128418901 CTGCCTCTGCCCCTGCTCTCTGG + Intergenic
962934579 3:140068032-140068054 CTGCCACTGCCCCCGGGCTTGGG - Intronic
963631392 3:147734992-147735014 GAGCCGCTGCACCTGGCCTCTGG + Intergenic
963890464 3:150630946-150630968 GAGCCACTGCACCTGGGCTGTGG - Intergenic
966523972 3:180901256-180901278 GTGCCACTGCACCTGGCCTTGGG - Intronic
966524318 3:180904469-180904491 CTGCCTCAGCTCCTGACCTCAGG - Intronic
967762632 3:193242287-193242309 CTGCCTCAGCTACTGGTCTCTGG - Intronic
967840458 3:194001161-194001183 GAGCCGCTGCACCTGGCCTCTGG - Intergenic
967850095 3:194075891-194075913 CTGCCTCAGCACATGGGTTCAGG + Intergenic
968500480 4:947626-947648 CTGTCCCTGCACCAGGGCTGAGG + Intronic
968598847 4:1499674-1499696 CTTCCTCCACCCCTGGGCTCTGG + Intergenic
968783009 4:2597460-2597482 CTGCCTCTGCCCTTGGGAACAGG + Intronic
968808950 4:2791632-2791654 CTTCCTCTATGCCTGGGCTCAGG + Intergenic
968913203 4:3486055-3486077 CTGACTCTGCAGCTGGGGTCGGG + Intronic
968913833 4:3488631-3488653 CTGCCACTGCTCCTGGACTTTGG + Intronic
968935715 4:3609138-3609160 CTGGCTCTGCATCGGGGCTTGGG - Intergenic
969088010 4:4670824-4670846 CTGCCTCTGTGGCAGGGCTCAGG - Intergenic
969114063 4:4860377-4860399 CTCCCTCTGCGCCTGGGTTCTGG - Intronic
969869382 4:10095176-10095198 TTGCCTCCGCACCAGCGCTCAGG - Intronic
971894863 4:32579458-32579480 CTGCCTTTGCAGCTGGTCTCTGG + Intergenic
972086600 4:35225038-35225060 CAACCTCTGCATCTGGGCCCAGG + Intergenic
972610479 4:40651337-40651359 CTGCCTTTGCACCCGTCCTCCGG - Intergenic
973631523 4:52825028-52825050 CTGGCTCTGCCCCTCGTCTCTGG + Intergenic
973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG + Intronic
975351471 4:73351916-73351938 CAGCCTCAACTCCTGGGCTCAGG + Intergenic
977153597 4:93545165-93545187 CTGCCTCTGCACCTGAATTTAGG - Intronic
977309274 4:95364605-95364627 CGGCCTTTGAGCCTGGGCTCTGG - Intronic
979192270 4:117876418-117876440 CAGCCCCTGCCCCTGTGCTCTGG + Intergenic
979259878 4:118636047-118636069 CTGCCTCTGCCCCAGAGCTGGGG - Intergenic
980133386 4:128837164-128837186 CTGTTTCTGCACCTGAGCTAGGG + Intronic
980972372 4:139578767-139578789 CTGCCTCTGCCCCTGTCCTGAGG + Intronic
981659192 4:147146263-147146285 CTGCAGCTGCGCCTGAGCTCTGG - Intergenic
982133085 4:152247747-152247769 CTGCCTCTGCAGAGAGGCTCTGG - Intergenic
983172399 4:164551094-164551116 CTGCTTCTGCACCTAAGCCCTGG - Intergenic
983696203 4:170534855-170534877 TTGCCTCTGCAACTGGTCTTTGG - Intergenic
984919130 4:184748550-184748572 CTGTCCCTGCAGCTGGGCTCTGG + Intergenic
985721066 5:1489325-1489347 CTGCCCCTACAGCTGGGTTCAGG + Intronic
985834873 5:2262858-2262880 CTGCCCCTGCCCTTGGGGTCGGG - Intergenic
985977071 5:3428508-3428530 CTGCCGCTGCGCCTGGGGTCTGG - Intergenic
986574593 5:9198857-9198879 CTGCCTCTGCACCTGGCCCAAGG - Intronic
988541443 5:32113670-32113692 GAGCCACTGCACCTGGCCTCTGG - Intergenic
989214584 5:38891642-38891664 CTGCCCCTGCCCCAGGCCTCTGG + Intronic
990003872 5:50923252-50923274 CTGCGTCTGCACGTGGCCGCCGG + Intergenic
990851592 5:60211061-60211083 CTTTCTCTCCACCTGGGCGCTGG + Intronic
991005558 5:61824730-61824752 CTCCCTCTGCACGTGCTCTCTGG - Intergenic
992321062 5:75613428-75613450 CAACCTCTACACTTGGGCTCTGG - Intronic
992944212 5:81793909-81793931 CTGCCTGTCCCCCTGGGCTTTGG + Intergenic
993593502 5:89825165-89825187 GAGCCACTGCACCTGGCCTCAGG - Intergenic
993692773 5:91023334-91023356 CTTGCTTTTCACCTGGGCTCTGG - Intronic
993991166 5:94660450-94660472 CTGGCAGTGCACTTGGGCTCTGG + Intronic
994072900 5:95621135-95621157 CAGGCTCTGCACCTTGGCGCGGG - Exonic
994525768 5:100903254-100903276 CAGCTTCTGCAGCTGGGTTCGGG + Exonic
994591825 5:101783527-101783549 CGGCCTCTGCAGTTGGGCTCAGG + Intergenic
995460586 5:112399211-112399233 CTGCCTCAGGACCTTTGCTCAGG + Intronic
996450630 5:123619196-123619218 CAGCCTCGACTCCTGGGCTCAGG - Intergenic
997196867 5:131986109-131986131 CTGCCTCTGTGCCTGTGCCCAGG - Intronic
997271134 5:132539044-132539066 CAGCCTCACCTCCTGGGCTCAGG + Intergenic
997590667 5:135070220-135070242 CTGCCCCTGCTCCTGGTCTTTGG + Intronic
998356439 5:141540698-141540720 GAGCCACTGCACCTGGTCTCAGG + Intronic
1000040538 5:157481539-157481561 CTGCCCCTGCACCTGACCTGGGG - Intronic
1000053981 5:157587585-157587607 CAACCTCTGCCTCTGGGCTCAGG + Intergenic
1000163321 5:158622453-158622475 GAGCCACTGCACCTGGCCTCTGG - Intergenic
1001019454 5:168170658-168170680 CTTGCTCTGCACCTGGGTTACGG + Intronic
1001089741 5:168728634-168728656 GAGCCACTGCACCTGGGCTTTGG - Intronic
1001156251 5:169274775-169274797 TTGGTTATGCACCTGGGCTCTGG + Intronic
1001673911 5:173496885-173496907 CTGCCTTTGATCCTGGGGTCTGG - Intergenic
1001933117 5:175687104-175687126 CTGCCCCTGCTCCTGGGGGCTGG - Intergenic
1002094411 5:176822703-176822725 CTGCCTCTGCCCCAGAGTTCTGG + Intronic
1002172432 5:177382922-177382944 TTGTCTGTGCACCTGGGCTCTGG - Intronic
1002350616 5:178580925-178580947 CAGCCTCCGCTCCTGGACTCAGG - Intronic
1002490022 5:179569207-179569229 CTGCCTTTTCACCTGTGCCCTGG - Intronic
1002527010 5:179820612-179820634 CAGCCTCTGCACCTGGGATCAGG - Intronic
1002578804 5:180194820-180194842 CCGCCACTGCACGTGGGCTGGGG - Intronic
1002685504 5:181006027-181006049 CTGCCGCTGCTGCAGGGCTCAGG - Exonic
1002994822 6:2272847-2272869 CTGCCTCTTGACCAGGGATCAGG + Intergenic
1003159822 6:3625333-3625355 CTGCCTCTGCAGCTCAGCCCTGG - Intergenic
1003267382 6:4577868-4577890 CTGCCTCTGGAGCTGGGGTGGGG - Intergenic
1003879915 6:10470779-10470801 CTGCTGCTGCAGCTGGTCTCAGG + Intergenic
1005344413 6:24875321-24875343 CTGCCTCTGCAGATTGACTCTGG - Intronic
1005674125 6:28136892-28136914 CTGCCTAAGCACTTGGGTTCCGG + Intergenic
1005992115 6:30909917-30909939 CTGCTTCTGTTCCAGGGCTCAGG + Exonic
1006034550 6:31201345-31201367 CTGGCTCTGCACCTGGGGTCCGG + Intronic
1006299222 6:33185030-33185052 CTTCCTCTTCACCTGGGGTGGGG + Exonic
1006338258 6:33432039-33432061 CTCCCTCTGCCCCTCAGCTCCGG - Intronic
1006468027 6:34207728-34207750 GAGCCACTGCACCTGGCCTCAGG + Intergenic
1006592873 6:35171018-35171040 GTGCCTCTGCATCTTGGCTTAGG - Intergenic
1007345761 6:41228469-41228491 CTGCTGCTGCTCCTGGCCTCAGG + Exonic
1007630232 6:43269454-43269476 CTGCCTCAGAATCTAGGCTCTGG - Intronic
1010394191 6:75372076-75372098 GTGCCACTGCACCCGGCCTCTGG - Intronic
1012938161 6:105389755-105389777 CTGCCTCTGGATCCGGGCTAGGG + Intronic
1016295407 6:142568024-142568046 TTGCCTCTCCTCCTTGGCTCAGG - Intergenic
1016392957 6:143592996-143593018 ATGCCACTGCACCTGCACTCCGG + Intronic
1016506504 6:144786615-144786637 CTGCCTCTGTGCCTTTGCTCAGG + Intronic
1017984632 6:159432777-159432799 ATCCCTCTGCACCTGTGCTTTGG - Intergenic
1018237094 6:161737144-161737166 CTTCCTGTGCACCTGCACTCGGG - Intronic
1018686819 6:166309631-166309653 CTGTCTCTGCCGGTGGGCTCAGG + Intergenic
1018915781 6:168131568-168131590 CTGCTTCTCCACCTGTGCTCCGG + Intergenic
1018967052 6:168497352-168497374 CGGCCTCTGCACCTGCCCCCAGG + Intronic
1019186778 6:170225083-170225105 CTGCCTGAGCACCTGGGAGCTGG - Intergenic
1019229753 6:170549911-170549933 ATGACTAAGCACCTGGGCTCTGG + Intronic
1019267136 7:124255-124277 CTGCGTGTGCACCTGTCCTCAGG - Intergenic
1019338442 7:496026-496048 CTGCACCTGGATCTGGGCTCAGG - Intergenic
1019351648 7:556843-556865 CTGCCTCTGTCCCTGGGGCCGGG + Intronic
1019434797 7:1017160-1017182 CTGCCTCTGGCCCCAGGCTCAGG + Intronic
1019447195 7:1077437-1077459 GAGCCACTGCACCTGGCCTCAGG + Intronic
1019504980 7:1386211-1386233 CGGCCGCTGCACCTGCTCTCGGG - Intergenic
1019718480 7:2554250-2554272 CAGCCTCTGCGTCTGGTCTCTGG + Intronic
1019810456 7:3161540-3161562 GTGCCACTGCACCTGGCCACTGG + Intronic
1020005960 7:4783916-4783938 CTGCCTCTGCTGCGGGGCTTGGG + Intronic
1020155646 7:5722001-5722023 CAGCCTCAACTCCTGGGCTCAGG + Intronic
1021087701 7:16442970-16442992 GAGCCACTGCACCTGGCCTCAGG - Intergenic
1021828034 7:24573710-24573732 CCCCCTCGGCACCTGGGCTTCGG + Intronic
1022053502 7:26703911-26703933 GTGCTTCAGAACCTGGGCTCTGG - Intronic
1022140804 7:27491712-27491734 CTGCTTCTGCAGCAGGGCTAGGG + Intergenic
1022471003 7:30681955-30681977 CGGCCTCTCCACGAGGGCTCCGG + Exonic
1022517518 7:30985422-30985444 CTGCCTCTGGGCCTGAGCTCAGG - Intronic
1022766893 7:33423252-33423274 CTGCCTCTGCTGCTGGGGTCAGG + Intronic
1023836007 7:44067544-44067566 CTGCTTCTGACCCTTGGCTCCGG + Intronic
1023841975 7:44103219-44103241 CTGCCTCTGCACTTGGCCCATGG + Intergenic
1024122322 7:46257303-46257325 CTGCCTCTGCTGCGGGCCTCAGG + Intergenic
1024426238 7:49229543-49229565 CTGCATCTCCACCTGGGTCCTGG - Intergenic
1024530713 7:50390221-50390243 CTTCCTCTGCACCATGGCGCAGG - Intronic
1024597029 7:50946995-50947017 CTCCCATTGCACCTGGGCACTGG + Intergenic
1024599008 7:50963225-50963247 CAGCCTTTGCTCCTGGGCTTTGG + Intergenic
1025177214 7:56808049-56808071 CTGCCTCTGCCCCAGAGCTGGGG + Intergenic
1025280458 7:57623238-57623260 CTCCCTCTGCTCCTGCACTCAGG + Intergenic
1025304273 7:57842269-57842291 CTCCCTCTGCTCCTGCACTCAGG - Intergenic
1025694578 7:63768337-63768359 CTGCCTCTGCCCCAGAGCTGGGG - Intergenic
1026014892 7:66665104-66665126 CTGGCTCTGGGCCTCGGCTCTGG + Intronic
1026086414 7:67266779-67266801 AAGCCACTGCACCTGGCCTCTGG + Intergenic
1026690733 7:72548050-72548072 AAGCCACTGCACCTGGCCTCTGG - Intergenic
1026805596 7:73427828-73427850 CAGCCTGTGTACCTGGGCACAGG + Intergenic
1028863723 7:95683159-95683181 CTCCCTCTGCCCCTGTGCTAAGG - Intergenic
1029143850 7:98431560-98431582 GAGCCACTGCACCTGGCCTCTGG + Intergenic
1029367881 7:100127852-100127874 CAGCCCCTGCGCCTGGGCCCGGG + Exonic
1029624152 7:101709281-101709303 GGGCCTTTGCACCTGGGCTATGG + Intergenic
1030033234 7:105388266-105388288 CGGCGTCTGCCGCTGGGCTCCGG - Intronic
1031388754 7:121186980-121187002 CTGGGCCTGCCCCTGGGCTCTGG + Intronic
1031584071 7:123512966-123512988 CTGCATCTGCAGCCCGGCTCTGG - Intronic
1032491251 7:132326212-132326234 CTGCCTTTGAACTTGGACTCAGG + Intronic
1032570715 7:132993557-132993579 CTGCCTACGCACCAGAGCTCAGG + Intronic
1033033343 7:137847223-137847245 CAGCGTCGGCAGCTGGGCTCAGG - Intergenic
1033128460 7:138725188-138725210 CTGACTCACCTCCTGGGCTCAGG - Intronic
1033451739 7:141468115-141468137 CTTCCTCTGGATCTGGGCTTTGG + Intronic
1033710463 7:143937870-143937892 CGCCCTCTGCACTTTGGCTCAGG - Intergenic
1033774123 7:144587894-144587916 CTGCCTTTGCAGTTGGGCTGGGG + Intronic
1034160236 7:148988675-148988697 CTGCCTCTGAGCCTGGCCACTGG - Intergenic
1034498531 7:151435888-151435910 CTACCTCTGCTCCTGGACTGAGG + Intronic
1034612646 7:152385801-152385823 GAGCCACTGCACCTGGCCTCAGG - Intronic
1035000299 7:155607273-155607295 GAGCCACTGCACCTGGCCTCTGG - Intergenic
1035050607 7:155996824-155996846 CTGGCTTTGCAGCTGGGCACGGG - Intergenic
1035056790 7:156041211-156041233 CTGCCTGTGCACCTGGAGCCAGG + Intergenic
1035112115 7:156491995-156492017 CTGCCTCTGTCCCTTGGATCTGG - Intergenic
1035412536 7:158656611-158656633 TTGCCTCTGCTCCTGGGGGCAGG - Exonic
1035464998 7:159069172-159069194 CCGCCTCAGCAACTGTGCTCAGG + Intronic
1035596163 8:859635-859657 CTGTCTCAGCACCAGGCCTCTGG + Intergenic
1035699127 8:1624740-1624762 CTCCCGCTGCACCTGGGCAGTGG - Intronic
1036301318 8:7571496-7571518 CAGCCTCGGAAACTGGGCTCTGG - Intergenic
1036588049 8:10143244-10143266 CTCCCTCTTCACTTGGTCTCGGG - Intronic
1036643740 8:10599688-10599710 CTGCCTTTTCCCCTGGGCTTGGG - Intergenic
1036897393 8:12647041-12647063 CTGCCTAGGCCCCTGGGCTGAGG + Intergenic
1037769337 8:21789530-21789552 CGGCCTCGGCTCCTGGGCGCAGG - Intronic
1037889888 8:22618510-22618532 CTGCCCCAGCACATGGGCACAGG + Intronic
1038634645 8:29275879-29275901 CTTCCTCTGCTCCTAGGCTCAGG - Intergenic
1038791006 8:30668177-30668199 CTGCCTCTTCACCTAGGCTAGGG + Intergenic
1040488382 8:47896361-47896383 CAGCCACTGCACCTGGCCTGGGG - Intronic
1044672552 8:94697860-94697882 CAACCTCTGCTCCTGGGTTCAGG + Intronic
1045429725 8:102102592-102102614 ATGCCTCGGAAGCTGGGCTCCGG - Intronic
1048027269 8:130598122-130598144 CTGCCTCTGCATCAGGACCCGGG - Intergenic
1048841751 8:138572755-138572777 CTTCCTCCTCACCTGGACTCAGG + Intergenic
1048888014 8:138924282-138924304 CTGGTTCTGCACCTGGGCCCTGG + Intergenic
1049034326 8:140062495-140062517 CTGCCTCTTCCACTGGCCTCTGG + Intronic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1049353568 8:142176980-142177002 CTGGCTCTGTCCCGGGGCTCAGG - Intergenic
1049414845 8:142490508-142490530 TGGCCACTGGACCTGGGCTCTGG + Intronic
1049611631 8:143558634-143558656 CGGCCTTTGGACCTGGGCTTGGG + Intronic
1049657863 8:143806686-143806708 CTGCCTGTGCACCAGGCCTGGGG - Intronic
1049796275 8:144498626-144498648 CTGCCCCCACCCCTGGGCTCTGG + Intronic
1050007414 9:1147389-1147411 GAGCCACTGCACCTGGCCTCAGG + Intergenic
1050011800 9:1192762-1192784 GAGCCACTGCACCTGGCCTCAGG - Intergenic
1051857273 9:21582608-21582630 GAGCCACTGCACCTGGGCCCAGG + Intergenic
1052398578 9:27972251-27972273 CTGCATCAGCAGCTGGGTTCCGG + Intronic
1052857519 9:33416431-33416453 CTGCCCCGGCACCTGGGGCCTGG - Intergenic
1052965208 9:34335330-34335352 CTGCCTCTGCACCTGGTGTTGGG - Intronic
1053227010 9:36368136-36368158 GGGCCACTGCACCTGGCCTCAGG + Intronic
1053648951 9:40143902-40143924 ATGCCTCTGCACTTGAGCTTGGG - Intergenic
1053702425 9:40708914-40708936 GAGCCACTGCACCTGGCCTCAGG + Intergenic
1053756793 9:41319959-41319981 ATGCCTCTGCACTTGAGCTTGGG + Intergenic
1053788447 9:41669093-41669115 CAGCCTCTTCCCCTTGGCTCAGG - Intergenic
1054156692 9:61645675-61645697 CAGCCTCTTCCCCTTGGCTCAGG + Intergenic
1054176731 9:61880432-61880454 CAGCCTCTTCCCCTTGGCTCAGG - Intergenic
1054412484 9:64832372-64832394 GAGCCACTGCACCTGGCCTCAGG + Intergenic
1054476464 9:65576684-65576706 CAGCCTCTTCCCCTTGGCTCAGG + Intergenic
1054535632 9:66232271-66232293 ATGCCTCTGCACTTGAGCTTGGG + Intergenic
1054660804 9:67700374-67700396 CAGCCTCTTCCCCTTGGCTCAGG + Intergenic
1056090040 9:83196314-83196336 GTGGCTCTGCACCTGGGATGGGG + Intergenic
1056196421 9:84233230-84233252 CTGCCTCTGGAGCTGGGTCCAGG + Intergenic
1056365643 9:85901868-85901890 ATGCCACTGCACCTGGCTTCAGG + Intergenic
1056702865 9:88925296-88925318 GGGCCTCCGCCCCTGGGCTCTGG + Intergenic
1056990813 9:91408246-91408268 CTGCCTCTGCGTCTGGGATGGGG - Intergenic
1057064268 9:92033966-92033988 CTGACTTGGCACCTGGCCTCAGG + Intronic
1057185140 9:93053217-93053239 CTGCCTCTTCACCAGCCCTCTGG - Intergenic
1059301436 9:113316886-113316908 CTGCCTTTTCACCTTGTCTCTGG - Exonic
1059628510 9:116093504-116093526 GTGAATCTGCACCTGGGCACTGG - Intergenic
1059754992 9:117284387-117284409 CAGCCACCGCACCTGGCCTCTGG + Intronic
1059886432 9:118749541-118749563 GTGCCTGTGCATCTGGGCTCAGG - Intergenic
1060115256 9:120935395-120935417 CTGGCTGTGCAGCTGGGCACTGG - Intergenic
1060137141 9:121168414-121168436 CTGCCTCCTCTCCTGGGCTCTGG - Intronic
1060296930 9:122349284-122349306 CTGCCACTACACCTGGCCCCTGG + Intergenic
1060501212 9:124157263-124157285 AAGCCACTGCACCTGGCCTCTGG + Intergenic
1061801295 9:133114684-133114706 CTGCCTGGGCACCTGCCCTCAGG - Intronic
1061837653 9:133340214-133340236 CTGGCTCTGGACCTGGCTTCTGG - Exonic
1061868950 9:133509965-133509987 CTGCTTCTGCTCCCAGGCTCGGG + Intergenic
1061869467 9:133513129-133513151 CTGGCTCCGCTCCTGGGCTGGGG - Intergenic
1062049087 9:134437987-134438009 CAGGCTCTGCCCCCGGGCTCCGG + Intronic
1062062027 9:134501985-134502007 CGGGCTCTGCTCCTGCGCTCTGG + Intergenic
1062263201 9:135673582-135673604 CTGCCTCTGTAGCTGGGGGCGGG - Intergenic
1062316959 9:135972041-135972063 GTGCCTCTGGACCTGGGTGCAGG - Intergenic
1062368414 9:136223259-136223281 CTGCCCCTGCACCTGGTCCCTGG + Intronic
1062554582 9:137108146-137108168 CTCCCCCAGAACCTGGGCTCAGG - Intronic
1062603919 9:137334284-137334306 GAGCCACTGCACCTGGCCTCAGG + Intronic
1062723488 9:138057931-138057953 CTCCCTCTATCCCTGGGCTCAGG + Intronic
1185591184 X:1278400-1278422 GAGCCACTGCACCTGGCCTCTGG - Intronic
1186286822 X:8053365-8053387 CTCCTTCTGCACCTGGGCTCGGG + Intergenic
1186468524 X:9803463-9803485 CTGCCTCTCCACCCAGCCTCTGG - Intronic
1186529617 X:10282120-10282142 CTGCCCCAGCTCCTGGGCTCTGG + Intergenic
1188207992 X:27382687-27382709 GAGCCACTGCACCTGGCCTCTGG - Intergenic
1188734560 X:33696464-33696486 CTGCCTCTGTACCTCAGCTTGGG + Intergenic
1189486490 X:41436700-41436722 CTGCCTCAGCTCCTAGGCTCAGG - Intergenic
1189502820 X:41580099-41580121 CAGCCTCTATACTTGGGCTCAGG - Intronic
1190418075 X:50200394-50200416 CTGCCTCTGACCCTGGGGTGTGG + Intronic
1190738164 X:53269413-53269435 CAGTCTCTCCACCTGGACTCTGG + Intronic
1190775717 X:53550889-53550911 CTCCCTCTGTACCCGGGCTTCGG + Exonic
1191842317 X:65522132-65522154 CTGCTCCTCCACCTGTGCTCTGG - Intronic
1192585928 X:72318130-72318152 AAGCCACTGCACCTGGCCTCTGG - Intergenic
1194751087 X:97684874-97684896 CAGCCTCAACTCCTGGGCTCAGG + Intergenic
1195372181 X:104187364-104187386 GAGCCGCTGCACCTGGCCTCTGG + Intronic
1196881396 X:120201034-120201056 CTGCCTCTGCCCAAGGGTTCTGG - Intergenic
1197868774 X:131046052-131046074 CTGGCTCTGCCCCTGGATTCTGG - Intergenic
1198157321 X:133974129-133974151 CAACCTCTGCCTCTGGGCTCAGG + Intronic
1198176783 X:134164356-134164378 CAGCCACTGCACCCGGCCTCAGG - Intergenic
1199272335 X:145898784-145898806 CTACCTCTGCTACTGGCCTCTGG + Intergenic
1199758468 X:150887061-150887083 CTGCCTCAAGCCCTGGGCTCAGG - Intronic
1199760619 X:150901620-150901642 CTGCCAATGCACATGGGTTCAGG + Intergenic
1199982304 X:152927811-152927833 CTGCCTTTGTCCCTGGGCCCTGG - Intronic
1200062568 X:153490091-153490113 CTGGTGCTGCTCCTGGGCTCTGG + Intronic
1200247008 X:154531761-154531783 GTGACTCAGCTCCTGGGCTCAGG + Exonic
1201075102 Y:10180922-10180944 GAGCCACTGCACCTGGACTCTGG + Intergenic