ID: 900626595

View in Genome Browser
Species Human (GRCh38)
Location 1:3611399-3611421
Sequence GCTGCAGGTGCGGAGCGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 6, 3: 22, 4: 184}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900626588_900626595 0 Left 900626588 1:3611376-3611398 CCCGCTCCGCGGAGCCCAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 145
Right 900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG 0: 1
1: 1
2: 6
3: 22
4: 184
900626585_900626595 6 Left 900626585 1:3611370-3611392 CCCGCGCCCGCTCCGCGGAGCCC 0: 1
1: 1
2: 3
3: 36
4: 415
Right 900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG 0: 1
1: 1
2: 6
3: 22
4: 184
900626590_900626595 -6 Left 900626590 1:3611382-3611404 CCGCGGAGCCCAAGGTCGCTGCA 0: 1
1: 0
2: 1
3: 14
4: 122
Right 900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG 0: 1
1: 1
2: 6
3: 22
4: 184
900626583_900626595 15 Left 900626583 1:3611361-3611383 CCACAGGTGCCCGCGCCCGCTCC 0: 1
1: 0
2: 5
3: 39
4: 610
Right 900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG 0: 1
1: 1
2: 6
3: 22
4: 184
900626586_900626595 5 Left 900626586 1:3611371-3611393 CCGCGCCCGCTCCGCGGAGCCCA 0: 1
1: 0
2: 4
3: 27
4: 233
Right 900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG 0: 1
1: 1
2: 6
3: 22
4: 184
900626589_900626595 -1 Left 900626589 1:3611377-3611399 CCGCTCCGCGGAGCCCAAGGTCG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG 0: 1
1: 1
2: 6
3: 22
4: 184
900626582_900626595 28 Left 900626582 1:3611348-3611370 CCATAGGACGCAGCCACAGGTGC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG 0: 1
1: 1
2: 6
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900626595 Original CRISPR GCTGCAGGTGCGGAGCGTCC CGG Exonic
900228121 1:1542327-1542349 GCTGCAGGGGGAGAGCGTCCCGG + Intronic
900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG + Exonic
901687032 1:10948696-10948718 GCTGGAGGTGTGGGGTGTCCAGG + Exonic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
904200840 1:28818141-28818163 GCTGCAGGTGGGCAGAGTGCAGG + Intronic
906350081 1:45051161-45051183 GCTGCAGAAGTGGAGCGACCTGG - Exonic
906583622 1:46956578-46956600 GCTGAAGGAGAGGAGTGTCCAGG - Intergenic
911880826 1:103236488-103236510 GCTGCAGGGGCGGGGCTTCCAGG + Intergenic
912084514 1:105982173-105982195 GCTGCAGGGGCGGAGCCCTCAGG + Intergenic
916501280 1:165389418-165389440 GCTGCAGGTACAGAGGGCCCAGG - Intergenic
916629820 1:166600400-166600422 GGTGCAGGTGAGAAGTGTCCTGG - Intergenic
919378496 1:196824138-196824160 GCTGGGGGTGGGTAGCGTCCTGG - Intronic
920179339 1:204122891-204122913 GCAGCAGCTGCCGAGCATCCTGG - Exonic
920729869 1:208473406-208473428 GCTGGAGGTGCGGATCGTGGAGG + Intergenic
922817928 1:228464201-228464223 GCTCCAAGTGAGGTGCGTCCCGG - Intergenic
922842036 1:228650463-228650485 GCTGCAGGAGGGCAGCATCCTGG + Intergenic
923490274 1:234478395-234478417 GCTGCTGGTCCTGAGCGCCCTGG - Exonic
1064086433 10:12349408-12349430 GCTGGAGGCGGGGAGCGGCCGGG + Intergenic
1064128055 10:12681445-12681467 GCTGCAGGAGCGGAGGCTGCAGG - Intronic
1067039330 10:42940662-42940684 GCTGCGGTTGCGAAGCCTCCTGG + Intergenic
1069577555 10:69541612-69541634 GCTGCAGGGGCGGAGCCCTCAGG - Intergenic
1070753337 10:78976683-78976705 GCTGGAGGTCCGGGGAGTCCAGG - Intergenic
1075796411 10:125123168-125123190 GCTTCAGCTGGGGACCGTCCTGG + Intronic
1077890309 11:6413504-6413526 TCTCCAGGTGCGGTGCGCCCAGG + Intronic
1077918502 11:6626153-6626175 GCTGCAGGTGCGGGGTGTGATGG - Exonic
1082847947 11:57741480-57741502 GCTGTAGGAGCAGAGCTTCCGGG + Intronic
1083052965 11:59793262-59793284 GCTGCAGGTGCAGGGAGTTCAGG + Intronic
1083148079 11:60773385-60773407 TCTGCAGGTGAGGAGCAGCCTGG + Exonic
1083308488 11:61772734-61772756 GCTGCAGCTGCCAAGCTTCCTGG - Intronic
1084372551 11:68753494-68753516 GCAGCAGGTGCAGAGCCTCCAGG - Intergenic
1085384864 11:76151804-76151826 GCTGCAGGAGCAGGGCGTTCTGG - Intergenic
1086606220 11:88699739-88699761 GCTGCACGAGCAGAGTGTCCAGG + Intronic
1091848174 12:3673739-3673761 GCTGCATGTGAGGAGCTTCAAGG + Intronic
1091968315 12:4764146-4764168 GAGGCAGGAGCGGAGCATCCTGG + Intronic
1094842939 12:34349559-34349581 GCTGCACATGCGCAGGGTCCTGG - Intergenic
1096686138 12:53289446-53289468 GCTGCAGGGGCTGAGCCTTCAGG + Exonic
1104515758 12:129424939-129424961 GCTGCAGGTGGGGAGCGGGATGG - Intronic
1108662631 13:52600401-52600423 TCGGCAGCTGCGGAGCGCCCCGG - Intergenic
1109938520 13:69327428-69327450 GATGCATGTGCAGAGCGTTCAGG + Intergenic
1113633856 13:111906619-111906641 GCTCCAGGTGCGTAGCGGCCAGG - Intergenic
1113857151 13:113453460-113453482 CCAACAGCTGCGGAGCGTCCTGG + Exonic
1113916858 13:113879157-113879179 GCTGCAGCTGAGGAGAGTGCTGG + Intergenic
1119750996 14:77077210-77077232 GCTGGGGCTGCGGAGAGTCCGGG + Intergenic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1122884338 14:104703917-104703939 GCTGCAGCTGCTGGACGTCCTGG + Exonic
1125722443 15:41851733-41851755 GCTGCAAGTGGGGAGCTGCCTGG + Intronic
1125748301 15:42012207-42012229 AGTGCAGGTGCGGAGAGTCTGGG - Intronic
1128505812 15:68271953-68271975 GCTGCAGGGGCGGAGCAGGCAGG - Intergenic
1129468845 15:75738946-75738968 GCTGCAGGTGCAGAGCGTCCCGG - Intergenic
1130273952 15:82466843-82466865 GCAGAAGGTGCTGAGGGTCCTGG - Intergenic
1130282927 15:82533057-82533079 GCTGCAGGTGCAGAGCATCCTGG - Intergenic
1130466300 15:84194217-84194239 GCAGAAGGTGCTGAGGGTCCTGG - Intergenic
1130497964 15:84479319-84479341 GCAGAAGGTGCTGAGGGTCCTGG + Intergenic
1130588594 15:85198810-85198832 GCAGAAGGTGCTGAGGGTCCTGG - Intergenic
1130846832 15:87755419-87755441 GCTGCAGGTGCCTGGCGTCTTGG - Intergenic
1131829661 15:96345951-96345973 GCTGCAGAAGCGAAGAGTCCCGG - Intergenic
1132185616 15:99799616-99799638 GCTGCAGGTACAGAGCGTCCCGG - Intergenic
1132392900 15:101451621-101451643 GCTGCAGCTGCGGAGCGGACGGG - Intronic
1132431379 15:101764925-101764947 GTTGCAGGTACAGAGCGTCCCGG + Intergenic
1132502502 16:290792-290814 GCTGCAGGTGCTGAGGTGCCCGG - Intronic
1136414443 16:30095186-30095208 GCTGCCGGTGGGGAGCTGCCAGG + Intronic
1139528112 16:67528836-67528858 GCGGCAGCTGCGGCGCGACCAGG + Intronic
1140126899 16:72125222-72125244 GCTGGAGGTGAGGAGCTGCCAGG - Exonic
1142210811 16:88807670-88807692 GCTGCAGGTGTGGAGGGGCCGGG - Intronic
1142346454 16:89557107-89557129 GCTGCACGTGCGGGTGGTCCGGG + Exonic
1142502268 17:339723-339745 GTTGCAGGTGCGGTGCCTACAGG + Intronic
1143830274 17:9645594-9645616 GCTCCAGGCGCGGAGCCCCCGGG - Exonic
1144105233 17:11978374-11978396 CCTGCAGGTGGGGAGCTTCTGGG + Exonic
1144723841 17:17491399-17491421 GCAGCAGCTGCAGAGCCTCCGGG + Exonic
1146949382 17:36895016-36895038 GCTGGAGGTGCGGAGCTGGCTGG - Intergenic
1147224651 17:38967374-38967396 GCTGCAGCTCCGGAGCCTACGGG - Exonic
1147988593 17:44320226-44320248 GCTGCTGCTGCGGAGGATCCGGG - Exonic
1148493412 17:48037651-48037673 GCTGCGGGTACGGAGCGGGCGGG - Exonic
1148503256 17:48107687-48107709 CCTGTAGGGGCGGGGCGTCCCGG + Exonic
1148807879 17:50273339-50273361 ACTCCAGGCGCGGAGCTTCCGGG - Intronic
1150675643 17:67244745-67244767 GCTGGGGGTGGGGAGCGTGCGGG - Intronic
1151748131 17:76022418-76022440 GCAGCAGCTGCGGAGCCTCGTGG - Exonic
1151903435 17:77032970-77032992 GCAGCAGGTGAGGAGGGACCGGG - Intergenic
1152410116 17:80118860-80118882 GCAGAAGGTGCTGGGCGTCCTGG + Intergenic
1152581138 17:81166084-81166106 GCCGCAGGTGCGGAGCGCGCCGG + Intergenic
1152639725 17:81444515-81444537 GCTGCGGGTGCGGGGCAGCCAGG - Exonic
1152753493 17:82077435-82077457 GCTGCAGGTGGGCAGTGTCCAGG - Intergenic
1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG + Intergenic
1154502482 18:15003704-15003726 CCTGCAGGTGCTGGGCCTCCAGG - Intergenic
1156399542 18:36728121-36728143 GCTTCAGTTGCAGAGGGTCCAGG + Intronic
1156889819 18:42178035-42178057 GATGCAGGTGCAGAGTGTTCAGG - Intergenic
1157519644 18:48336776-48336798 GCTGAAGCTGGGGAGCATCCTGG - Intronic
1159282903 18:66310394-66310416 GCTGCAGGGGCGGGGCCTCATGG - Intergenic
1160038004 18:75319168-75319190 GCTGCAGGGGCTGAGCATTCAGG + Intergenic
1160870071 19:1273872-1273894 GCTGCACGTGGGGAGCGTAATGG - Intronic
1160951050 19:1667598-1667620 GCTGGAGGTGTGGGGCGGCCAGG - Intergenic
1161102351 19:2427398-2427420 GCTGCAGGTGCGGGGCTGGCCGG - Exonic
1162895980 19:13764864-13764886 CCCGCAGGTGCGGGGCGCCCCGG + Exonic
1163291951 19:16384763-16384785 CCTGCAGGTGCGAGGCGTCCAGG - Intronic
1163480839 19:17555504-17555526 GGTGCGGGGGCGGGGCGTCCTGG + Intergenic
1163647519 19:18498215-18498237 GCTGCAGGTGCGGGGAGGCGGGG + Intronic
1163695697 19:18762216-18762238 GCTGGAGGTGCGCAGCTCCCGGG - Intronic
1165080029 19:33301793-33301815 ACTGCAGGTGCGGGGCGGCCAGG + Exonic
1168105651 19:54164418-54164440 GCTGCAGGTGCGGACGGTCTTGG - Exonic
925024184 2:594873-594895 GCTGCAGGGGAGGTGGGTCCGGG + Intergenic
926107190 2:10159891-10159913 GCTGGAGGTGGGAAGCGCCCAGG + Intronic
927138891 2:20116283-20116305 GCAGTAGGTGGGGAGTGTCCAGG + Intergenic
927219134 2:20690624-20690646 GCTGCAGGTGCGGAGTTCTCCGG - Intronic
927606600 2:24491614-24491636 GCTGCGGGTGCGGAGCCTCCCGG + Intergenic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
932791004 2:74654448-74654470 GCTGGCGGTGCTGAGCGGCCCGG + Exonic
937375810 2:121334967-121334989 GCTGCAGGTGCCTGGCCTCCAGG - Intergenic
938131816 2:128722653-128722675 GCTGCAGGTGCTGCTGGTCCTGG + Intergenic
938339033 2:130523195-130523217 GTGGCAGGCGCGGAGGGTCCAGG - Exonic
938350805 2:130597555-130597577 GTGGCAGGCGCGGAGGGTCCAGG + Exonic
938381028 2:130836819-130836841 TTTGCGGGGGCGGAGCGTCCGGG + Intergenic
938501662 2:131833876-131833898 CCTGCAGGTGCTGGGCCTCCAGG - Intergenic
940196925 2:151104983-151105005 GATGCATGTGCAGAACGTCCAGG - Intergenic
942346109 2:175004846-175004868 GCCGCAGGTGGGCCGCGTCCCGG - Intronic
944696139 2:202201891-202201913 GCTGCAGGTCCGGTTCGTCTCGG + Intergenic
945326980 2:208493367-208493389 GCTGCTGGTGCTGTGCGTCACGG - Exonic
946339377 2:219058221-219058243 GCGGCAGGTGCAGAGCGTCTCGG + Intronic
948124302 2:235553735-235553757 GGTGCAGGAGAGGAGCGTTCAGG + Intronic
948479122 2:238239511-238239533 GCTGACGGTGCGGCGGGTCCAGG - Exonic
948596908 2:239085445-239085467 GCTGCAGGAGCTCAGCGTCTAGG - Intronic
948826228 2:240574549-240574571 TCTGCCGGTGCAGGGCGTCCAGG - Exonic
948892111 2:240912547-240912569 GGGGCAGGTACGGAGCCTCCAGG + Intergenic
948941757 2:241200309-241200331 ACTCCAGGTGAGGAGAGTCCTGG - Intronic
1170024088 20:11869973-11869995 GCTGAAGATGTGGAGCTTCCTGG + Intergenic
1170736485 20:19017641-19017663 GGTGCAGATGGGGAGCCTCCGGG - Intergenic
1172095282 20:32457364-32457386 GGTGCAGGTGTGGAGCCGCCAGG - Intronic
1172984153 20:38969074-38969096 GCTGCAGGTACAGAGGGGCCAGG + Exonic
1175368615 20:58471811-58471833 GCTGCAGGAGCTGGGCCTCCAGG - Intronic
1175889707 20:62310745-62310767 GCTGCCGGTGCGGCCCCTCCTGG + Exonic
1175892162 20:62320723-62320745 CCTGCAGGTACTGAGCGTCCTGG - Exonic
1175955498 20:62606967-62606989 GCTGCAGGTGCAGAGTCCCCAGG - Intergenic
1176179535 20:63742819-63742841 GCACCAGGTGGGGAGGGTCCTGG + Intronic
1176238598 20:64065584-64065606 GCTGCAGGTGCAGAGGGCCTCGG + Intronic
1178855417 21:36246312-36246334 GCTGCAGGTGCTGATTGTCTTGG + Exonic
1179435673 21:41360570-41360592 GCTGCTGGTGAGGGGCGTGCAGG + Intergenic
1180945267 22:19689045-19689067 GCTGCGGGTGTGGGGCATCCAGG + Intergenic
1182327876 22:29528001-29528023 GCTGCAGGTGCAGAGGGTCCGGG - Intronic
1182359990 22:29740656-29740678 CCTGCAGGAGCTGAGCATCCAGG - Exonic
1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG + Intronic
1183456608 22:37926442-37926464 GCTGCAGTTCCTGAGCGACCTGG + Intronic
1183473792 22:38024673-38024695 CATGCAGGTGCGGAGGGTCAAGG + Intronic
1183492261 22:38122932-38122954 GCTGCAGGTGCTGAGGTCCCAGG - Intronic
1184497008 22:44847951-44847973 CCTGCAGGAGAGGAGCTTCCAGG - Exonic
1184820896 22:46908651-46908673 CAGGCTGGTGCGGAGCGTCCCGG + Intronic
1185259321 22:49853220-49853242 GCTGGCGGTGCGGAGCGCACGGG - Intergenic
1185314947 22:50174946-50174968 CCTGCAGGTGCAGCGGGTCCAGG + Intronic
951100642 3:18684331-18684353 GCTGCAGGGGCAGAGCCTCATGG + Intergenic
951906953 3:27715365-27715387 GCGGCGGGTGCGCAGCGTCTGGG + Intergenic
952979119 3:38720969-38720991 GCTGCAGGTGCCCAGTGCCCTGG - Intronic
953853163 3:46481127-46481149 GGTGCAGGTACTGAGCTTCCTGG - Intronic
954101013 3:48372615-48372637 GCTGCAGGTGTGCAGACTCCCGG - Intronic
954327125 3:49869742-49869764 GCTGCAGGTGCGGGGCGGGCCGG - Exonic
957430811 3:80103944-80103966 GCTGCAGCTGAGAAGGGTCCAGG - Intergenic
968498466 4:932049-932071 GCTGCGGGTGCGGCGGGTCCTGG - Exonic
969244599 4:5924377-5924399 GCTGGATGTGGGGAGGGTCCAGG - Intronic
974628464 4:64453604-64453626 GCTGCAGGTGTGGAGCCCTCAGG - Intergenic
980159240 4:129139183-129139205 GCTGCAGAAGTGGAGCGACCTGG - Intergenic
981079224 4:140622413-140622435 GGTCCTGGTGCGGAGCGGCCAGG - Exonic
981782245 4:148442933-148442955 GCTGCAGGTGGAGAGCGTGAGGG - Intronic
983455083 4:167953270-167953292 GCTGCAGGGGTGGAGCCTCGTGG + Intergenic
985132944 4:186757460-186757482 GCTGTAGGTTTGGAGAGTCCTGG - Intergenic
986209820 5:5661419-5661441 CCTGCAGGAGGGGAGCGTGCTGG + Intergenic
987313396 5:16701619-16701641 GCTGCAGGAGCGGCGGGACCAGG - Exonic
987708308 5:21482207-21482229 GCTGCAGGAGCGGAGGTGCCAGG + Intergenic
988647304 5:33108553-33108575 GCTGCAGGTGCAGAGCCCTCTGG + Intergenic
990108431 5:52293130-52293152 GCTGCAGGAGCGAAGCCTCATGG - Intergenic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
997709301 5:135990521-135990543 GCTGGAGGTGCTGAGGGTGCTGG + Intergenic
997709313 5:135990566-135990588 GCTGGAGGTGCTGAGGGTGCTGG + Intergenic
998498867 5:142614638-142614660 GCTGCAGGTCCCGAACGTCCAGG - Intronic
1000609635 5:163359986-163360008 GCTGCAGGGGTGGAGCCTCATGG + Intergenic
1007546472 6:42698396-42698418 GCTGCTGGAGAGGAGCGTGCCGG - Exonic
1009791191 6:68403603-68403625 GCTGCAGGGGCAGAGCCTCATGG - Intergenic
1012179862 6:96139573-96139595 GCCGCAGGGGCGGAGGGTCATGG - Intronic
1014913608 6:127119962-127119984 GCCGGAGGTGCGGAGTTTCCAGG + Intronic
1016732840 6:147444804-147444826 GCTGACTGTGCGGAGCATCCAGG + Intergenic
1016986821 6:149901382-149901404 TCTGCAGGTGCGGGGCCACCAGG + Intergenic
1017754804 6:157520203-157520225 ACTGCAGGGGAGGAGCCTCCAGG + Intronic
1019190211 6:170246827-170246849 GCTGCAGGGGCGGTGAGTGCGGG - Intergenic
1019190291 6:170247034-170247056 GCTGCAGGGGCGGTGAGTGCCGG - Intergenic
1019476708 7:1247808-1247830 GCTCCAGGTCCTGAGGGTCCGGG - Intergenic
1019481063 7:1267088-1267110 GCTCCAGGTGGGCAGGGTCCAGG + Intergenic
1019503508 7:1377655-1377677 TCTGGAGGTGGGGAGGGTCCTGG - Intergenic
1020111736 7:5451557-5451579 GCCGCAGGTGCAGAGCCCCCGGG - Intronic
1022957050 7:35390577-35390599 GCTCTAGGTGCTGAGCGGCCTGG - Intergenic
1023838477 7:44082235-44082257 CCTGCAGGTGCGGGGCGGCGCGG - Exonic
1026968505 7:74454454-74454476 TCTGGAGGTGGGGGGCGTCCCGG + Intronic
1029506486 7:100966497-100966519 GCTGCTGGCGCTGGGCGTCCGGG + Exonic
1035255898 7:157627159-157627181 GCTGCAGGTGCGGTGCACACTGG - Intronic
1035443414 7:158922611-158922633 GGTGCAGGTGGGGAGAGTCACGG + Intronic
1035667392 8:1389114-1389136 GCTGCAGGTGGGGAGGGCTCTGG + Intergenic
1036579001 8:10055052-10055074 GCTGCAGGTGCCCTGGGTCCCGG - Intronic
1037763220 8:21756019-21756041 GCTGGAGGAGTGGAGCGGCCGGG + Intronic
1039484325 8:37899348-37899370 GCTGCAGGCGCGGGGCCTGCGGG - Exonic
1041467708 8:58173718-58173740 GCTGCAGATGCTGCGGGTCCAGG - Intronic
1048197142 8:132340744-132340766 GATACAGGTGCAGAACGTCCAGG - Intronic
1049194482 8:141308020-141308042 GCTGCAGGTGCCCGGCGCCCAGG + Intronic
1049468498 8:142764562-142764584 GCTGTGGGGGCTGAGCGTCCGGG + Exonic
1049519535 8:143080874-143080896 GCTGGAGGTGGGGGACGTCCTGG + Intronic
1049657105 8:143803781-143803803 GCTGCTGGTGCGGAGGGACCCGG - Exonic
1049682068 8:143923700-143923722 GCAGCAGGAGCAGAGCGTGCTGG - Exonic
1049815496 8:144597281-144597303 GCTGCTGGTGCAGAGTGTCCTGG - Intronic
1050299955 9:4248121-4248143 GATGCATGTGCAGAACGTCCAGG + Intronic
1057285330 9:93749025-93749047 GCTGCAGGGGCGGAGCCCTCAGG - Intergenic
1061060923 9:128250324-128250346 GCTGCAGGTGCAGAGCGTACCGG + Exonic
1061152300 9:128835853-128835875 GCTGCAGGTGGGCTGGGTCCTGG - Exonic
1061577969 9:131519480-131519502 GCTGCAGGTGAGGAGCGGCCAGG + Exonic
1062364318 9:136201793-136201815 GCTCCGGGTGCGGAGCGTCGAGG + Intronic
1062384369 9:136303276-136303298 GCTGCAGGTGCGCAGAGCCTGGG + Exonic
1185825568 X:3245869-3245891 TCTGCAGTTGCTGAGAGTCCTGG - Intergenic
1186515782 X:10165319-10165341 GCTGCAGAAGAGGAGAGTCCTGG + Intronic
1187888129 X:23907947-23907969 GGCGCAGGGGCGGAGCCTCCTGG - Exonic
1191192158 X:57678914-57678936 GCTGCGGGCGCTGAGCCTCCTGG - Intergenic
1197749237 X:129953353-129953375 GCCGCGGGTGCTGAGCCTCCGGG + Intergenic