ID: 900627069

View in Genome Browser
Species Human (GRCh38)
Location 1:3613219-3613241
Sequence CTTCCCGGGATCTCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900627056_900627069 3 Left 900627056 1:3613193-3613215 CCTCTCACCCACCCCCACTGACC 0: 1
1: 0
2: 11
3: 106
4: 1000
Right 900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 106
900627058_900627069 -5 Left 900627058 1:3613201-3613223 CCACCCCCACTGACCACCCTTCC 0: 1
1: 0
2: 3
3: 82
4: 830
Right 900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 106
900627059_900627069 -8 Left 900627059 1:3613204-3613226 CCCCCACTGACCACCCTTCCCGG 0: 1
1: 0
2: 0
3: 28
4: 300
Right 900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 106
900627063_900627069 -10 Left 900627063 1:3613206-3613228 CCCACTGACCACCCTTCCCGGGA 0: 1
1: 0
2: 0
3: 5
4: 153
Right 900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 106
900627061_900627069 -9 Left 900627061 1:3613205-3613227 CCCCACTGACCACCCTTCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 248
Right 900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 106
900627057_900627069 -4 Left 900627057 1:3613200-3613222 CCCACCCCCACTGACCACCCTTC 0: 1
1: 1
2: 2
3: 66
4: 564
Right 900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 106
900627055_900627069 24 Left 900627055 1:3613172-3613194 CCTACGGGGTTCTCAATTCTGCC 0: 1
1: 0
2: 1
3: 5
4: 60
Right 900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900627069 Original CRISPR CTTCCCGGGATCTCGGCTGC AGG Intergenic
900570693 1:3356884-3356906 CTACCCCGGATCCCGGCAGCGGG + Intronic
900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG + Intergenic
901425813 1:9182060-9182082 CTGCCCCGGAGCTTGGCTGCAGG + Intergenic
902315846 1:15617791-15617813 CGTACCTGGCTCTCGGCTGCGGG - Exonic
902478456 1:16700005-16700027 CGTCGCAGGAGCTCGGCTGCGGG + Intergenic
903068527 1:20715012-20715034 CATCCCGGCATCCAGGCTGCAGG - Intronic
903415247 1:23177853-23177875 CCTCCCCGGCCCTCGGCTGCAGG - Intergenic
904237120 1:29123085-29123107 CTCCCCGAGGTTTCGGCTGCGGG - Intronic
904499881 1:30907855-30907877 CTTCCCAGGGTCGCGGCAGCCGG - Intronic
906638503 1:47426761-47426783 CTTCCAGGGATTTCTCCTGCTGG - Intergenic
912709721 1:111941701-111941723 CTTCCCAGGGTCAGGGCTGCGGG - Intronic
923429237 1:233904990-233905012 CTTCCCAGGCTAGCGGCTGCAGG + Exonic
1066298321 10:34075446-34075468 CTCCCAGGGACCTGGGCTGCTGG + Intergenic
1076565455 10:131395544-131395566 CCTCCCTGGACCTCAGCTGCAGG - Intergenic
1080517817 11:33039888-33039910 CATCCCGGGATGTCGGGGGCAGG + Intronic
1084570932 11:69959503-69959525 CCTCCTGGGGGCTCGGCTGCTGG - Intergenic
1086424053 11:86666763-86666785 CTTCTCGAGATCTCTGCTTCAGG - Intronic
1086943948 11:92826788-92826810 CTGCACGGGATCTAGCCTGCAGG - Intronic
1089100499 11:115958659-115958681 CTTCCCGGGCTCAGGCCTGCAGG + Intergenic
1089153936 11:116386138-116386160 CTTCCCAGGATCTCACCTGTGGG + Intergenic
1089385011 11:118061679-118061701 CTTCCTGCGACCTGGGCTGCTGG + Intergenic
1093260434 12:16929943-16929965 CTTCCCTTGGTCTCGTCTGCTGG - Intergenic
1094314563 12:29124045-29124067 GTTGCCAGGATCTGGGCTGCAGG - Intergenic
1096155045 12:49336978-49337000 CGTCCCGGGCTCTGAGCTGCGGG + Exonic
1097020946 12:56020645-56020667 CATCCAGGGCTTTCGGCTGCTGG + Intronic
1102655745 12:114480969-114480991 CTTCCCCAGCTCTCCGCTGCAGG - Intergenic
1104046913 12:125169816-125169838 CATCTGGGGATCTCTGCTGCTGG - Intergenic
1104062494 12:125280557-125280579 CTCCCCTGGACCTAGGCTGCCGG + Intronic
1104638442 12:130452138-130452160 CTTCCCAAGCTCTCCGCTGCTGG + Intronic
1117377582 14:55129787-55129809 CTTCCCCAGATCACGGCCGCGGG + Intronic
1118776865 14:68978866-68978888 CCTGCCGGGCTCTCGGCTCCGGG - Intronic
1121109493 14:91303101-91303123 CTTCCCTGGACCTCCCCTGCAGG - Intronic
1126794103 15:52245727-52245749 CATCACTGCATCTCGGCTGCTGG - Intronic
1128387890 15:67163656-67163678 CTTCCCTGAACCTCTGCTGCTGG + Intronic
1129383809 15:75184606-75184628 CTGCCCGGGACCTCACCTGCAGG - Intergenic
1131277621 15:90994891-90994913 CTTCCCTGAGTCCCGGCTGCCGG + Intronic
1133031399 16:3012904-3012926 CTCTGCGGGCTCTCGGCTGCAGG - Exonic
1133058456 16:3159048-3159070 CTTCACGGAGTCTCGGCCGCAGG + Intergenic
1134271238 16:12735068-12735090 CTTCCCTAGCTCTCTGCTGCTGG - Intronic
1142688527 17:1591501-1591523 CTGCCCGGGACCCCGGCTGGGGG + Intronic
1149512566 17:57256065-57256087 CATTCCCGGATCTCGGCGGCAGG + Intronic
1150259217 17:63774504-63774526 CTTCCCGGCACCCCGGCCGCCGG - Intronic
1152252354 17:79218656-79218678 CCTCCCTGCATCTCGGCTCCCGG - Intronic
1152342503 17:79733090-79733112 CTGCCTGGGATCTCGTCTGATGG + Intronic
1152433043 17:80260338-80260360 CTGCCCGGGGTCTGGGCTTCCGG + Intergenic
1160779048 19:869703-869725 CTTCCCCGGAGCAGGGCTGCTGG + Intronic
1162668708 19:12237278-12237300 ATGCCCGGGGTCCCGGCTGCTGG + Intronic
1162698472 19:12495721-12495743 ACTCCCGGGATCCTGGCTGCCGG - Intronic
1167172111 19:47840030-47840052 CATCCCGGGATCTAAACTGCAGG - Exonic
1168240842 19:55088128-55088150 TTTCCCTGGCTCGCGGCTGCTGG + Intergenic
1202712475 1_KI270714v1_random:25836-25858 CGTCGCAGGAGCTCGGCTGCGGG + Intergenic
925552604 2:5092792-5092814 TTTCCCTGGCTCTCGGCTGGAGG + Intergenic
927606728 2:24492051-24492073 CCTCTCGGAATCTCGCCTGCCGG + Exonic
930636013 2:53806347-53806369 CTTCCCCTTATCTCAGCTGCAGG + Intronic
931844870 2:66193229-66193251 CTGCCCTGGTTCTTGGCTGCAGG + Intergenic
937901737 2:127025100-127025122 CATCCCGGGGTCCCGGCTGCTGG - Intergenic
946988289 2:225299691-225299713 CTTCTTGGGATCTCGACTGGTGG - Intergenic
948130416 2:235596575-235596597 CTTCCCGGGTTCCTGGTTGCAGG + Intronic
1172870100 20:38130354-38130376 CTCCACGGGGTCTGGGCTGCAGG + Exonic
1175954996 20:62604661-62604683 CAGCCCGAGATCCCGGCTGCAGG - Intergenic
1178555794 21:33588809-33588831 CCACCCGGGATCGCCGCTGCGGG - Intronic
1178885272 21:36479925-36479947 CTGCCCAGGCTCTCGGCTCCGGG + Exonic
1178954015 21:37007029-37007051 CCTCCCGGGAACCCGGCTGCCGG - Intronic
1180183911 21:46130197-46130219 CACCCCGGGATCAGGGCTGCTGG - Intronic
1182904104 22:33921252-33921274 CGGCCCGGGATCCCGGCTCCGGG - Intronic
1183357105 22:37365441-37365463 CTTCCCTGGAGCCCTGCTGCGGG + Intergenic
1183732955 22:39628635-39628657 CTTGCCGGGGTCACAGCTGCCGG - Intronic
1183752161 22:39727712-39727734 CTTTCCGGGATCCGGGCTGAAGG - Intergenic
1183942273 22:41302347-41302369 CTTCCCGCGGGCCCGGCTGCAGG - Intronic
1184120028 22:42444141-42444163 CACCCCGGGCTCTCGGCAGCCGG + Intergenic
1184619420 22:45663808-45663830 CTTTCTGTGATCTTGGCTGCTGG + Intergenic
1185139083 22:49090246-49090268 CTTCCAGGGAGCACAGCTGCTGG - Intergenic
1185316078 22:50179665-50179687 CTTCCCTGGCTCTGGGCTGGGGG - Exonic
1185387354 22:50541004-50541026 CTCCTGGGGATCTCAGCTGCAGG + Intergenic
953015970 3:39076420-39076442 CTTGCCGGGATGTTGGCTGTGGG + Intronic
956814819 3:72898631-72898653 CTCCCCGGGTGCTCGGGTGCAGG - Intronic
960702535 3:120451469-120451491 CATCCCGGGGTCACGGCAGCAGG + Intergenic
961434851 3:126909877-126909899 CTTCCCAGGCTCTGTGCTGCAGG + Intronic
963106708 3:141653713-141653735 CTTCCCTGGAACTCTGCTGGGGG + Intergenic
965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG + Intronic
969076471 4:4582730-4582752 ATTCCAGGGATCTAGGTTGCAGG - Intergenic
969331927 4:6478839-6478861 CTTCCCGGGACCCCGGCTGATGG + Intronic
970525158 4:16924637-16924659 TGTCCCGGGATCTCATCTGCAGG - Intergenic
980499107 4:133625909-133625931 CTTCCAGGGATTTGGGCTGCAGG - Intergenic
983497538 4:168460493-168460515 CTTTCCAGGATCTGGGCGGCAGG + Intronic
985786489 5:1898023-1898045 CTGCCCGGGATCTTTCCTGCAGG + Intergenic
986056009 5:4137326-4137348 ATTCCTGGGATCTTTGCTGCAGG + Intergenic
990699655 5:58460730-58460752 CGGCCCGGGATCCCGGCTGCGGG - Intergenic
996417728 5:123228168-123228190 CTTCCCAGGCTCTAGGCTGTAGG - Intergenic
1002441323 5:179265870-179265892 TTTCCCGGGGCCTGGGCTGCAGG + Intronic
1003400775 6:5788708-5788730 CTTCCAGGGATGTTGTCTGCAGG - Intergenic
1006029567 6:31169594-31169616 CTTCCCCGGATCTCTGCCTCAGG - Intronic
1006788565 6:36684075-36684097 CTTCCTTGTATCTCTGCTGCAGG + Exonic
1006843207 6:37044877-37044899 GTTCTCGGTTTCTCGGCTGCTGG + Exonic
1015318170 6:131841273-131841295 CTTCACGGGATTTCGTTTGCTGG - Intronic
1019060045 6:169250792-169250814 ATTCCCAGGAGCTCAGCTGCAGG - Exonic
1019293192 7:260443-260465 CTTCCTGGGGCCTCGGCTCCTGG + Exonic
1023507663 7:40917559-40917581 ATACCCAGGATCTAGGCTGCAGG + Intergenic
1032800928 7:135316838-135316860 CTTCCCTGGAGCATGGCTGCCGG - Intergenic
1035782545 8:2239775-2239797 CTCCCCGGGATCAAGGCTGGGGG + Intergenic
1035809576 8:2479813-2479835 CTCCCCGGGATCAAGGCTGGGGG - Intergenic
1037772807 8:21812325-21812347 CTTGCCGGGGTCTCAGCTGCTGG + Intronic
1039949009 8:42153263-42153285 CTTCCCGGCGCCGCGGCTGCGGG + Intronic
1041537868 8:58948133-58948155 CTTCCTGGGACCTGGGCTGGGGG + Intronic
1044073286 8:87788731-87788753 CATCCCAGGCTCTGGGCTGCTGG + Intergenic
1048857943 8:138699972-138699994 CTGTCAGGGATCTGGGCTGCTGG - Intronic
1049201923 8:141344511-141344533 CTGCCCGGGATTGCAGCTGCGGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058802908 9:108562155-108562177 CTTCTGGGGATTTCAGCTGCTGG - Intergenic
1060198894 9:121640454-121640476 CTTCCCGGGACAGAGGCTGCAGG + Intronic
1062052353 9:134454178-134454200 CTGCCCGGGATCACAGCCGCTGG + Intergenic
1199471637 X:148202150-148202172 CTCCCTGGGATCTGGGCAGCTGG + Intergenic
1200249985 X:154547558-154547580 CTTCCCGAGTTCTCGGGGGCGGG + Intronic